- Mar 2021
-
github.blog github.blog
-
Some pesky non-human users (namely computers) have taken to “hotlinking” assets via the raw view feature — using the raw URL as the src for a <script> or <img> tag.
-
-
www.biorxiv.org www.biorxiv.org
-
Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.
Learn more at Review Commons
Reply to the reviewers
Overall, we were pleased that the reviewers found our study carefully designed and interesting. We have addressed their comments below.
Reviewer #1 (Evidence, reproducibility and clarity)
The manuscript by Kern, et al., demonstrates that phagocytosis in macrophages is regulated in part by the intermolecular distance of phagocytosis-promoting receptors engaging phagocytic targets. Cells expressing chimeric receptors containing cytosolic domains of Fc receptors (FcR) and defined ligand-binding DNA domains were used to drive phagocytosis of opsonized glass beads coated with complementary DNA ligands of defined spacing and number. These so-called origami ligands allowed manipulation of receptor spacing following engagement, which allowed the demonstration that tight spacing of ligands (7 nm or 3.5 nm) optimized signaling for phagocytosis. The study is carefully performed and convincing. I have a few technical concerns and minor suggestions.
1. It is assumed that the origami preparations were entirely uniform. How much variation was there? Is that supported by TIRF microscopy of origami preparations? Was the TIRF microscopy calibrated for uniformity of fluorescence (ie., shade correction)?
Our laboratory, Dong et al., has extensively characterized the origami uniformity and robustness of these exact pegboards. This paper was just posted on bioRxiv (Dong et. al, 2021). We have also cited this paper in our revised manuscript in reference to the characterization of the DNA origami (Line 117).
We did not use any shade correction. Instead we only collected data from a central ROI in our TIRF field. To check for uniformity of illumination, we plotted the origami pegboard fluorescent intensity along the x and y axis. We observed very modest drop off in signal - the average signal intensity of origamis within 100 pixels of the edge is 76 ± 6% the intensity of origamis in a 100 pixel square in the center of the ROI. Fitting this data with a Gaussian model resulted in very poor R values. While this may account for some of the variation in signal intensity at individual points, we expect the normalized averages of each condition to be unaffected. We have amended the methods to describe this strategy (Lines 851-854).
[[images cannot be shown]]
2. Likewise, how much variation was there in the expression of the chimeric receptors? Large variation in receptor numbers per cell could significantly alter the quantitative studies. Aside from the flow sorting for cells expressing two different molecules, how were cells selected for analysis?
We thank the reviewer for bringing up this point. We confirmed comparable receptor expression levels at the cell cortex of the DNA CAR-𝛾 and the DNA CAR-adhesion used throughout the paper. We also have confirmed that receptor levels at the cell cortex were similar for the large DNA CAR constructs used in Figure 6C-D. This data is now included in Figures S5 and S7. We have also altered the text to include this (lines 169-172):
Expression of the various DNA CARs at the cell cortex was comparable, and engulfment of beads functionalized with both the 4T and the 4S origami platforms was dependent on the Fc__𝛾R signaling domain (Figure S5).
When quantifying bead engulfment, cells were selected for analysis based on a threshold of GFP fluorescence, which was held constant throughout analysis for each individual experiment. We have amended the “Quantification of engulfment” methods section to convey this (lines 921-923).
3. The scale of the origami relative to the cells is difficult to discern in Figures 2C and D. Additional text would be helpful to indicate, for example, that the spots on the Fig. 2D inset indicate entire origami rather than ligand spots on individual origami particles.
Thank you for pointing this out, we see how the legend was unclear and have corrected it (lines 453-454), including specifically noting “Each diffraction limited magenta spot represents an origami pegboard.” We have also outlined the cell boundary in yellow to make the cell size more clear.
4. Figure 5 legend, line 482: How was macrophage membrane visualized for these measurements?
We have added the following clarification (line 535-536): “The macrophage membrane was visualized using the DNA CAR__𝛾, which was present throughout the cell cortex.”
5. line 265: "our data suggest that there may be a local density-dependent trigger for receptor phosphorylation and downstream signaling". This threshold-dependent trigger response was also indicated in the study of Zhang, et al. 2010. PNAS.
The Zhang et al. study was influential in our study design, and we wish to give the appropriate credit. Zhang et al. found that a sufficient amount of IgG is necessary to activate late (but not early) steps in the phagocytic signaling pathway. In contrast, our study addresses IgG concentration in small nanoclusters. We find that this nanoscale density affects receptor phosphorylation. Thus, we think these two studies are distinct and complementary.
Lines 283-287 now read:
While this model has largely fallen out of favor, more recent studies have found that a critical IgG threshold is needed to activate the final stages of phagocytosis (Zhang et al., 2010). Our data suggest that there may also be a nanoscale density-dependent trigger for receptor phosphorylation and downstream signaling.
6. line 55: Rephrase, “we found that a minimum threshold of 8 ligands per cluster maximized FcgR-driven engulfment.” It is difficult to picture how a minimum threshold maximizes something.
We now state “we found that 8 or more ligands per cluster maximized FcgR-driven engulfment.”
7. line 184: Rephrase, "we created... pegboards with very high-affinity DNA ligands that are predicted not to dissociate on a time scale of >7 hr". Remove "not".
Thank you for pointing this out, it is now correct.
Reviewer #1 (Significance):
This study provides a significant advance in understanding about the molecular mechanisms of signaling for particle ingestion by phagocytosis.
Reviewer #2 (Evidence, reproducibility and clarity):
The manuscript on “Tight nanoscale clustering of Fcg-receptors using DNA origami promotes phagocytosis" studies how clustering and nanoscale spacing of ligand molecules for a chimeric Fcg-receptors influence the phagocytosis of functionalized silicon beads by macrophage cell lines. The basis of this study is the design of a chimeric Fc-receptor (DNA-CARg) comprising an extracellular SNAP-tag domain that can be loaded with single-stranded (ss) DNA, the transmembrane part of CD86 and the cytosolic part of the Fc-receptor g-chain containing an immunoreceptor tyrosine-based activation motif (ITAM) as well as a C-terminal green fluorescent protein (GFP). As control the authors used a similar designed DNA-CAR that is lacking the intracellular ITAM-containing FCg tail. The chosen target for this chimeric DNA-CAR, are silicon beads covered by a lipid bilayer that contains biotin-labelled lipids that, via Neutravidin, can be loaded with a biotinylated DNA origami pegboard displaying complimentary ss-DNA as ligand for the DNA-CAR. The DNA origami pegboard contains four ATTO647N fluorescence for visualization and the ssDNA ligand in different quantities and spacing.
Using these principles, the authors study how ligand affinity, concentration and spacing influence the activation of the DNA-CARg and the engulfment of the loaded beads.
The authors show that bead engulfment is increased between 2 till 8 ssDNA ligands on the pegboard. After this, ligand numbers do not play a role anymore in the engulfment. They then study the role of the ligand spacing using pegboards that either contain 4 single strand DNA ligands in close (7nm/3,5nm) proximity or a more spaced version using 21/17,5 nm or 35/38,5 nm. The authors find that the bead engulfment is maximally and positively affected by the close spacing of the ssDNA ligands. In their final experiments the authors vary the design of the DNA-CARs by tetramerization of the ITAM-containing Fcg-signaling subunit. In their discussion the authors mention different possibilities for the effect of spacing on the engulfment process.
I think that, in general, this is an interesting study. However, it has some caveats and open issues that should be clarified before its publication.
Major comments
1. As a general comment, it is somewhat a pity that the authors did not use the endogenous FcR as a control. It would have been quite easy for the authors to place the SNAP-tag domain on the Fcg extracellular domain which would allow to do all their experiments in parallel, not only with the DNA-CAR, but also with a DNA-containing wild type receptor. Such a control would be important because, by using a CD86 transmembrane domain, the authors do not know whether the nanoscale localization of their chimeric receptors is reflecting that of the endogenous Fcg receptor.**
We agree with the reviewer completely. We have repeated experiments shown in Figure 4A with a DNA-CAR containing the Fc𝛾 transmembrane domain instead of CD86 as the reviewer suggests. We also included a DNA-CAR version of the Fc𝛾R1 alpha chain, although this construct was not expressed as well as the others. These data are now included in Figure S5, and referenced in lines 167-168.
2. An important issue that is discussed by the authors but not addressed in this manuscript is whether the different amount and spacing of the ligand is only impacting on signaling or also on the mechanical stress of the cells. Indeed, mechanical stress on the cytoskeleton arrangement could influence the engulfment process. For this, it would be very important to test that the different bead engulfment, for example, those shown in Fig. 4, is strictly dependent on signaling kinases. The authors should repeat the experiment of Fig. 4 a and b in the presence or absence of kinase inhibitors such as the Syk inhibitor R406 or the Src inhibitor PP2 to show whether the different phase of engulfment is dependent on the signaling function of these kinases. This crucial experiment is clearly missing from their study.
We agree this is an interesting point. We find that ligand spacing affects receptor phosphorylation; however this does not preclude effects on downstream aspects of the signaling pathway. We will clarify this by adding the following comment to the manuscript (line 299-301):
While our data pinpoints a role for ligand spacing in regulating receptor phosphorylation, it is possible that later steps in the phagocytic signaling pathway are also directly affected by ligand spacing.
The DNA-CAR-adhesion in Figure 1 strongly suggests that intracellular signaling is essential for phagocytosis. We have now included additional controls using this construct as detailed in our response to point 3 below. Unfortunately, Src and Syk inhibitors or knockout abrogate Fc𝛾R mediated phagocytosis (for example, PMIDs 11698501, 9632805, 12176909, 15136586) and thus would eliminate phagocytosis in both the 4T and 4S conditions. This precludes analysis of downstream steps in the phagocytic signaling pathway.
3. Another problem of this study is that the authors show in Fig. 1A the control DNA-CAR-adhesion but then hardly use it in their study. For example, the crucial experiments shown in Fig. 4 should be conducted in parallel with DNA-CAR-adhesion expressing macrophage cells. This study could provide another indication whether or not ITAM signaling is important for the engulfment process.
We have added this control. It is now included in Figure S5 and S7. Figure 3D also shows that the DNA-CAR-adhesion combined with the 4T origami pegboards does not activate phagocytosis and we have amended the text to make this more clear (line 152).
4. Another important aspect is how the concentration of the loaded origami pegboard is influencing the engulfment process. In particular, it would be interesting to show the padlocks with different spacings such as the 4T closed spacing versus 4s large spacing show a different dependency on the concentration of this padlock loading on the beads. This would be another important experiment to add to their study.**
We agree that this is an interesting question. We suspect that at a very high origami density, 4S signaling would improve, and potentially approach the 4T. However, we are currently coating the beads in saturating levels of origami pegboards. Thus we cannot increase origami pegboard density and address this directly.
Minor comments:
1. The definition of the ITAM is Immunoreceptor Tyrosine-based Activation Motif and not "Immune Tyrosine Activation Motif" as stated by the authors.
We have corrected this.
2. The authors discuss that it is the segregation of the inhibitory phosphatase CD45 from the clustered Fc receptors is the major mechanism explaining their finding that 4T closed spacing is more effective than 4s large spacing. With the event of the CRISPR/Cas9 technology it is trivial to delete the CD45 gene in the genome of the RAW264.7 macrophage cell line used in this study and I am puzzled why they author are not conducting such a simple but for their study very important experiment (it takes only 1-2 month to get the results).
This experiment may be informative but we have two concerns about its feasibility. First, CD45 is a phosphatase with many different roles in macrophage biology, including activating Src family kinases by dephosphorylating inhibitory phosphorylation sites (PMID 8175795, 18249142, 12414720). Second, CD45 is not the only bulky phosphatase segregated from receptor nanoclusters. For example, CD148 is also excluded from the phagocytic synapse (PMID 21525931). CD45 and CD148 double knockout macrophages show hyperphosphorylation of the inhibitory tyrosine on Src family kinases, severe inhibition of phagocytosis, and an overall decrease in tyrosine phosphorylation (PMID 18249142). CD45 knockout alone showed mild phenotypes in macrophages. We anticipate that knocking out CD45 alone would have little effect, and knocking out both of these phosphatases would preclude analysis of phagocytosis. Because of our feasibility concerns and the lengthy timeline for this experiment, we believe this is outside of the scope of our study.
In our discussion, we simplistically described our possible models in terms of CD45 exclusion, as the mechanisms of CD45 exclusion have been well characterized. This was an error and we have amended our discussion to read (lines 335-343):
As an alternative model, a denser cluster of ligated receptors may enhance the steric exclusion of the bulky transmembrane proteins like the phosphatases CD45 and CD148 (Bakalar et al., 2018; Goodridge et al., 2012; Zhu, Brdicka, Katsumoto, Lin, & Weiss, 2008).
Reviewer #2 (Significance):
The innovative part of this study is the combination of SNAP-tag attached, chimeric Fc-receptor with the DNA origami pegboard technology to address important open question on receptor function.
Referees cross-commenting
I find most of my three reviewing colleagues reasonable I also agrée to Reviewer #1 comments 2
Likewise, how much variation was there in the expression of the chimeric receptors?
Large variation in receptor numbers per cell could significantly alter the quantitative studies. Aside from the flow sorting for cells expressing two different molecules, how were cells selected for analysis?
But I want to add it is not only the amount of receptors but ils the nanoscale location that is key to receptor function
We have ensured that all receptors are trafficked to the cell surface. We have also measured their intensity at the cell cortex as discussed in response to Reviewer 1.
Reviewer #3 (Evidence, reproducibility and clarity):
This is a very nicely done synthetic biology/biophysics study on the effect of ligands spacing on phagocytosis. They use a DNA based recognition system that the group has previously use to investigate T cell signaling, but express the SNAP tag linked transmembrane receptor in a macrophage cell line and present the ligands using DNA origami mats to control the number and spacing of complementary ligands that are designed to be in the typical range for low or high affinity FcR, a receptor that can trigger phagocytosis. The study offers some very nice quantitative data sets that will be of immediate interest to groups working in this area and, in the future, for design of synthetic receptors for immunotherapy applications. Other groups are working on similar platform for TCR. I don't feel there is any need for more experiments, but I have some questions and suggestions. Answering and considering these could clarify the new biological knowledge gained.
We thank the reviewer for their support of our manuscript. Given the reviewer’s statement that no new experiments are required, we have answered their questions to the best of our ability given the current data. Should the editor decide that any of these topics require experimental data to enhance the significance of the paper, we are happy to discuss new experiments.
Reviewer #3 (Significance):
I think the significance would be increased by addressing these questions, that would help understand how the synthesis system described related to other system directed as similar questions and more natural settings.
1.The densities of the freely mobile DNA ligands required to trigger phagocytosis is quite high. Was the length of the DNA duplexes optimized? The entire complex for both the intermediate and high affinity duplexes seems quite short, perhaps <10 nm. Might the stimulation be more efficient if a short stretch of DS DNA is added to increase the length to 12-13 nm?
The extracellular domain of the DNA-CAR (SNAP tag and ssDNA strand) are approximately 10 nm (PMID 28340336). The biotinylated ligand ssDNA is attached to the bilayer via neutravidin, resulting in a predicted 14 nm intermembrane spacing. The endogenous IgG FcR complex is 11.5 nm. Bakalar et al (PMID 29958103) tested the effect of antigen height on phagocytosis and found that the shortest intermembrane distance tested (approximately 15 nm) was the most effective. As the reviewer notes, the optimal distance between macrophage and target may be larger than our DNA-CAR. However we think the intermembrane spacing in our system is within the biologically relevant range.
We saw robust phagocytosis at 300 molecules/micron of ssDNA, which is similar to the IgG density used on supported lipid bilayer-coated beads in other phagocytosis studies (PMID 29958103, 32768386). As the reviewer noticed, this is significantly higher than ligand density necessary to activate T cells (PMID 28340336). We have added a comment on ligand density to lines 96-97.
2. Are the origami mats generally laterally mobile on the bilayers. If so, what is the diffusion coefficient? Can one detect the mats accumulating in the initial interface between the bead and cell, particularly in cased where there is no phagocytosis? Would immobility of the mats make them more efficient at mediating phagocytosis compared to the monodispersed ligands, which I assume are highly mobile and might even be "slippery".
We have confirmed that our bead protocol generally produces mobile bilayers, where his-tagged proteins can freely diffuse to the cell-bead interface (see accumulation of a his-tagged FRB binding to a transmembrane FKBP receptor at the cell-bead synapse below). We can qualitatively say that the origamis appear mobile on a planar lipid bilayer (see Dong et. al 2021 and images below). Directly measuring the diffusion coefficient on the beads is extremely difficult because the beads themselves are mobile (both diffusing and rotating), and cannot be imaged via TIRF. We do not see much accumulation of the origami at cell-bead synapses. This could reflect lower mobility of the origamis, or could be because the relative enrichment of origamis is difficult to detect over the signal from unligated origamis.
Overall, we expect the origami pegboards (tethered by 12 neutravidins) are less mobile than single strand DNA (tethered by a single neutravidin, supported by qualitative images below). We are uncertain whether this promotes phagocytosis. At least one study suggests that increased IgG mobility promotes phagocytosis (PMID 25771017). However, the zipper model would suggest that tethered ligands may provide a better foothold for the macrophage as it zippers the phagosome closed (PMID 14732161). Hypothetically, ligand mobility could affect signaling in two ways - first by promoting nanocluster formation, and second by serving as a stable platform for signaling as the phagosome closes. Since our system has pre-formed nanoclusters, the effect of ligand mobility may be quite different than in the endogenous setting.
[[image cannot be shown]]
In the above images, a 10xHis-FRB labeled with AlexaFluor647 was conjugated to Ni-chelating lipids in the bead supported lipid bilayer. The macrophages express a synthetic receptor containing an extracellular FKBP and an intracellular GFP. Upon addition of rapamycin, FRB and FKBP form a high affinity dimer, and FRB accumulates at the bead-macrophage contact sites.
[[image cannot be shown]]
In the above images, single molecules were imaged for 3 sec. The tracks of each molecule are depicted by lines, colored to distinguish between individual molecules. The scale bar represents 5 microns in both panels.
3. Breaking down the analysis into initiation and completion is interesting. When using the non-signalling adhesion constructs, would they get to the initiation stage or would that attachment be less extensive than the initiation phase.
This is an interesting question. While we did not include the DNA-CAR-adhesion in our kinetic experiments, we have now quantified the frequency of cups that would match our ‘initiation’ criteria in 3 representative data sets where macrophages were fixed after 45 minutes of interaction with origami pegboard-coated beads. We found that an average of 16/125 of 4T beads touching DNA-CAR-adhesion macrophages met the ‘initiation’ criteria and an average of 2/125 were eaten (14% total). In comparison, we examined 4T beads touching DNA CAR𝛾 macrophages and found that on average 23/125 met the ‘initiation’ criteria, and 45/125 were already engulfed (54%). This suggests that the DNA-CAR-adhesion alone may induce enough interaction to meet our initiation criteria, but without active signaling from the FcR this extensive interaction is rare. We have added this data in a new Figure S6 and commented on this in lines 213-215.
4. It would be interesting to put these results in perspective of earier work on spacing with planar nanoarrays, although these can't be applied to beads. For integrin mediated adhesion there was a very distinct threshold for RGD ligand spacing that could be related to the size of some integrin-cytoskeletal linkers (PMID: 15067875). On the other hand, T cell activation seemed more continuous with changes in spacing over a wide range with no discrete threshold (PMID: 24117051, 24125583) unless the spacing was increased to allow access to CD45, in which case a more discrete threshold was generated (PMID: 29713075). The results here for phagocytosis with the very small ligands that would likely exclude CD45 seems to be more of a continuum without a discrete threshold, although high densities of ligand are needed. This issue of continuous sensing vs sharp threshold is biologically interesting so would be good assess this by as consistent standards are possible across systems.**
We agree that this is an interesting body of literature worth adding to our discussion. We have added a paragraph that puts our study in the context of prior work on related systems, including these nanolithography studies (Line 364-382):
How does the spacing requirements for Fc__𝛾R nanoclusters compare to other signaling systems? Engineered multivalent Fc oligomers revealed that IgE ligand geometry alters Fcε receptor signaling in mast cells (Sil, Lee, Luo, Holowka, & Baird, 2007). DNA origami nanoparticles and planar nanolithography arrays have previously examined optimal inter-ligand distance for the T cell receptor, B cell receptor, NK cell receptor CD16, death receptor Fas, and integrins (Arnold et al., 2004; Berger et al., 2020; Cai et al., 2018; Deeg et al., 2013; Delcassian et al., 2013; Dong et al., 2021; Veneziano et al., 2020). Some systems, like integrin-mediated cell adhesion, appear to have very discrete threshold requirements for ligand spacing while others, like T cell activation, appear to continuously improve with reduced intermolecular spacing (Arnold et al., 2004; Cai et al., 2018). Our system may be more similar to the continuous improvement observed in T cell activation, as our most spaced ligands (36.5 nm) are capable of activating some phagocytosis, albeit not as potently as the 4T. Interestingly, as the intermembrane distance between T cell and target increases, the requirement for tight ligand spacing becomes more stringent (Cai et al., 2018). This suggests that IgG bound to tall antigens may be more dependent on tight nanocluster spacing than short antigens. Planar arrays have also been used to vary inter-cluster spacing, in addition to inter-ligand spacing (Cai et al., 2018; Freeman et al., 2016). Examining the optimal inter-cluster spacing during phagosome closure may be an interesting direction for future studies.
Additional experiments performed in revision
In addition to these reviewer comments, we have added additional controls validating the DNA-CAR-4x𝛾 used in Figure 6c,d. We compared the DNA-CAR-4x𝛾 to versions of the DNA-CAR-1x𝛾-3x𝛥ITAM construct with the functional ITAM in the second and fourth positions (see the schematics now included Figure S7). We found that four individual receptors with a single ITAM each were able to induce phagocytosis regardless of which position the ITAM was in. However the DNA-CAR-4x𝛾 construct, which also contains 4 ITAMs, was not. This further validates the experiment presented in 6c,d. We also fixed minor errors we discovered in the presentation of data for Figures 1C and S1A.
-
Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.
Learn more at Review Commons
Reviewer #3
Evidence, reproducibility and clarity
This is a very nicely done synthetic biology/biophysics study on the effect of ligands spacing on phagocytosis. They use a DNA based recognition system that the group has previously use to investigate T cell signaling, but express the SNAP tag linked transmembrane receptor in a macrophage cell line and present the ligands using DNA origami mats to control the number and spacing of complementary ligands that are designed to be in the typical range for low or high affinity FcR, a receptor that can trigger phagocytosis. The study offers some very nice quantitative data sets that will be of immediate interest to groups working in this area and, in the future, for design of synthetic receptors for immunotherapy applications. Other groups are working on similar platform for TCR. I don't feel there is any need for more experiments, but I have some questions and suggestions. Answering and considering these could clarify the new biological knowledge gained.
Significance:
I think the significance would be increased by addressing these questions, that would help understand how the synthesis system described related to other system directed as similar questions and more natural settings.
- The densities of the freely mobile DNA ligands required to trigger phagocytosis is quite high. Was the length of the DNA duplexes optimized? The entire complex for both the intermediate and high affinity duplexes seems quite short, perhaps <10 nm. Might the stimulation be more efficient if a short stretch of DS DNA is added to increase the length to 12-13 nm?
- Are the origami mats generally laterally mobile on the bilayers. If so, what is the diffusion coefficient? Can one detect the mats accumulating in the initial interface between the bead and cell, particularly in cased where there is no phagocytosis? Would immobility of the mats make them more efficient at mediating phagocytosis compared to the monodispersed ligands, which I assume are highly mobile and might even be "slippery".
- Breaking down the analysis into initiation and completion is interesting. When using the non-signalling adhesion constructs, would they get to the initiation stage or would that attachment be less extensive than the initiation phase.
- It would be interesting to put these results in perspective of earier work on spacing with planar nanoarrays, although these can't be applied to beads. For integrin mediated adhesion there was a very distinct threshold for RGD ligand spacing that could be related to the size of some integrin-cytoskeletal linkers (PMID: 15067875). On the other hand, T cell activation seemed more continuous with changes in spacing over a wide range with no discrete threshold (PMID: 24117051, 24125583) unless the spacing was increased to allow access to CD45, in which case a more discrete threshold was generated (PMID: 29713075). The results here for phagocytosis with the very small ligands that would likely exclude CD45 seems to be more of a continuum without a discrete threshold, although high densities of ligand are needed. This issue of continuous sensing vs sharp threshold is biologically interesting so would be good assess this by as consistent standards are possible across systems.
-
Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.
Learn more at Review Commons
Referee #2
Evidence, reproducibility and clarity
The manuscript on "Tight nanoscale clustering of Fcg-receptors using DNA origami promotes phagocytosis" studies how clustering and nanoscale spacing of ligand molecules for a chimeric Fcg-receptors influence the phagocytosis of functionalized silicon beads by macrophage cell lines. The basis of this study is the design of a chimeric Fc-receptor (DNA-CARg) comprising an extracellular SNAP-tag domain that can be loaded with single-stranded (ss) DNA, the transmembrane part of CD86 and the cytosolic part of the Fc-receptor g-chain containing an immunoreceptor tyrosine-based activation motif (ITAM) as well as a C-terminal green fluorescent protein (GFP). As control the authors used a similar designed DNA-CAR that is lacking the intracellular ITAM-containing FCg tail. The chosen target for this chimeric DNA-CAR, are silicon beads covered by a lipid bilayer that contains biotin-labelled lipids that, via Neutravidin, can be loaded with a biotinylated DNA origami pegboard displaying complimentary ss-DNA as ligand for the DNA-CAR. The DNA origami pegboard contains four ATTO647N fluorescence for visualization and the ssDNA ligand in different quantities and spacing. Using these principles, the authors study how ligand affinity, concentration and spacing influence the activation of the DNA-CARg and the engulfment of the loaded beads.
The authors show that bead engulfment is increased between 2 till 8 ssDNA ligands on the pegboard. After this, ligand numbers do not play a role anymore in the engulfment. They then study the role of the ligand spacing using pegboards that either contain 4 single strand DNA ligands in close (7nm/3,5nm) proximity or a more spaced version using 21/17,5 nm or 35/38,5 nm. The authors find that the bead engulfment is maximally and positively affected by the close spacing of the ssDNA ligands. In their final experiments the authors vary the design of the DNA-CARs by tetramerization of the ITAM-containing Fcg-signaling subunit. In their discussion the authors mention different possibilities for the effect of spacing on the engulfment process.
I think that, in general, this is an interesting study. However, it has some caveats and open issues that should be clarified before its publication.
Major comments
- As a general comment, it is somewhat a pity that the authors did not use the endogenous FcR as a control. It would have been quite easy for the authors to place the SNAP-tag domain on the Fcg extracellular domain which would allow to do all their experiments in parallel, not only with the DNA-CAR, but also with a DNA-containing wild type receptor. Such a control would be important because, by using a CD86 transmembrane domain, the authors do not know whether the nanoscale localization of their chimeric receptors is reflecting that of the endogenous Fcg receptor.
- An important issue that is discussed by the authors but not addressed in this manuscript is whether the different amount and spacing of the ligand is only impacting on signaling or also on the mechanical stress of the cells. Indeed, mechanical stress on the cytoskeleton arrangement could influence the engulfment process. For this, it would be very important to test that the different bead engulfment, for example, those shown in Fig. 4, is strictly dependent on signaling kinases. The authors should repeat the experiment of Fig. 4 a and b in the presence or absence of kinase inhibitors such as the Syk inhibitor R406 or the Src inhibitor PP2 to show whether the different phase of engulfment is dependent on the signaling function of these kinases. This crucial experiment is clearly missing from their study.
- Another problem of this study is that the authors show in Fig. 1A the control DNA-CAR-adhesion but then hardly use it in their study. For example, the crucial experiments shown in Fig. 4 should be conducted in parallel with DNA-CAR-adhesion expressing macrophage cells. This study could provide another indication whether or not ITAM signaling is important for the engulfment process.
- Another important aspect is how the concentration of the loaded origami pegboard is influencing the engulfment process. In particular, it would be interesting to show the padlocks with different spacings such as the 4T closed spacing versus 4s large spacing show a different dependency on the concentration of this padlock loading on the beads. This would be another important experiment to add to their study.
Minor comments:
- The definition of the ITAM is Immunoreceptor Tyrosine-based Activation Motif and not "Immune Tyrosine Activation Motif" as stated by the authors.
- The authors discuss that it is the segregation of the inhibitory phosphatase CD45 from the clustered Fc receptors is the major mechanism explaining their finding that 4T closed spacing is more effective than 4s large spacing. With the event of the CRISPR/Cas9 technology it is trivial to delete the CD45 gene in the genome of the RAW264.7 macrophage cell line used in this study and I am puzzled why they author are not conducting such a simple but for their study very important experiment (it takes only 1-2 month to get the results).
Referees cross-commenting
I find most of my three reviewing colleagues reasonable
I also agree to Reviewer #1 comments 2
Likewise, how much variation was there in the expression of the chimeric receptors? Large variation in receptor numbers per cell could significantly alter the quantitative studies. Aside from the flow sorting for cells expressing two different molecules, how were cells selected for analysis?
But I want to add it is not only the amount of receptors but ils the nanoscale location that is key to receptor function.
Significance:
The innovative part of this study is the combination of SNAP-tag attached, chimeric Fc-receptor with the DNA origami pegboard technology to address important open question on receptor function.
-
-
www.jackfranklin.co.uk www.jackfranklin.co.uk
-
but I like that Svelte comes with a good CSS story out the box.
comes with a good CSS story out the box
-
I like this approach more because I can scan the code that renders the Box component and easily spot that it takes two children. If the Box took any props, they'd be within the opening <Box> tag, and they would be distinct from any children props.
Tags
- making intentions clear/explicit
- Svelte: styles
- I agree
- intention-revealing
- being explicit
- out of the box
- library/framework should provide this (standard solution) rather than everyone having to write their own slightly different solution (even if it is easy enough to write yourself)
- Svelte: slot
- distinction
- annotation meta: may need new tag
- me too
- Svelte
- clarity
Annotators
URL
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.03.23.21253460: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics approval and consent to participate: The plasma sample use was reviewed by the WRAIR Human Subjects’ Protection Branch which determined that the research does not involve human subjects (NHSR protocol WRAIR #2567, WRAIR#2755, #EID-029) as the samples used were de-identified and no link between samples and subjects exists.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">As this was a retrospective analysis of COVID-19 samples collected during a public health investigation of a local outbreak, no a priori power calculation was carried out.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The detection antibody, SULFO-TAG either with anti-human IgG (Cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">No D20JL, MSD) antibody or anti-human IgM (Cat.No D20JP, MSD) was diluted to 2 µg/ml in Diluent 100 (MSD) and added to the wells (50 µl/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was carried out in R using the stats, ggplot2, and corrplot,.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This limitation is highlighted in the apparent 50% IgM seropositivity for MERS-CoV in the Control Group. While there was a MERS outbreak in South Korea in 2015, there were only 186 confirmed cases in that outbreak [21] and a more likely explanation is that this reflects a cross-reactivity from immunity to a related beta coronavirus. On a similar note, we were surprised to find 25% IgG seropositivity for SARS-CoV-2 in the Control group. Given that they were all seronegative to SARS-CoV-2 by IgM, this suggests the possibility of either a prior asymptomatic SARS-CoV-2 infection or cross-reactivity from immunity to another coronavirus. Assessing the serological landscape of CoV-specific IgM and IgG responses resulted in several key observations: 1) IgG seropositivity to seasonal OC43 and HKU1 as well as influenza H3 was high, while IgM seropositivity to these antigens was low; 2) IgM seropositivity to SARS-CoV-2 was highly specific, with 90% seropositivity in COVID-19 samples and 0% seropositivity in Control or Pre-COVID samples; 3) SARS-CoV-2 IgG responses were highly cross-reactive with almost 60% of SARS-CoV-2 IgG seropositive samples being seropositive for all five CoV spike antigens; and 4) IgM and IgG SARS-CoV-2 spike responses appear to show different fine specificities, with IgM spike responses being largely recapitulated by the SARS-CoV-2 RBD antigen, while IgG spike responses were not. Taken together these observations suggest a few explanations. First, that the IgM res...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.03.23.21254165: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Research Design: Ethical approval for the study was granted by the MBRU, Institutional Review Board (Reference # MBRU-IRB-2020-032).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A Strengths, Weaknesses, Opportunities, and Threats (SWOT) analysis of the impact on education of the pandemic highlights, among many of the factors discussed in the preceding paragraphs, the opportunity for educational leadership in times of crisis and the challenge of executing it with budgetary constraints (36). The COVID-19 experience is also a living example to demonstrate to students the health inequities and difficult ethical decisions in a contemporary life or death scenarios; it constituted an invaluable experience that reinforces knowledge of health systems and standards of practice (7). Resilience, grit, and tolerance have transformed from mere teaching points to demonstrable practice (7). The tag: front-liner, has become a proud identity, inspirational for the budding physician. This study is characterized by several limitations that are worth shedding light on. Although the focus on a single program enabled the development of thorough reflections and insights, the generalizability of the generated findings is limited to institutions that are characteristically and contextually like MBRU. It would be worthwhile for future studies to collect data from several programs and run a comparative analysis. The small sample size and low response rate were also limitations. The data collection extended until after the end of course assessments, and hence, the perception of the participating students might have been influenced by their performance in the respective exams and...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.24.435771: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: ACE2 antibody abcam, ab27269 1:400 TMPRSS2 antibody Santa Cruz sc-515727 1:400 Anti-NP, sino-biological 40143-MM05 1:400 Anti-NP, sino-biological 40143-R001 1:400 Anti-NP, thermofisher MA1-7401 1:400 K8/K18, progen, 90001 1:400 Donkey-anti-rabbit750, abcam ab175731</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies: ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-NP</div><div>suggested: (Bio-Rad Cat# MCA400, RRID:AB_2151884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With rigorous washing steps in between the proteins were detected with mouse anti-strep-tag-antibodies (IBA) and goat anti-mouse IgG antibodies (Life Biosciences). IDISCO: SARS-CoV-2 infected and non-infected Syrian hamster lungs were provided in 10% formalin, for longer storage hamster lungs were kept in PBS and 0.01% sodium azide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Obtained image stacks were analyzed with ImageJ v1.54f and Imaris 9.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the 3D renders obtained imaging data was imported into Imaris, display adjustments were made for each channel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The generated surfaces were subsequently used to mask the TMPRSS2 and ACE2 channels, after which statistical values were obtained and exported to GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 6. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.23.436684: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: Blood and peripheral blood mononuclear cells (PBMCs) were isolated from COVID19+ patients using protocols approved by Institutional Review Boards at Fred Hutch Cancer Research Center, University of Washington and Seattle Children’s Research Institute.<br>Consent: Informed consent was obtained from all participants and the University of Washington and/or Fred Hutchinson Cancer Research Center and CHUM Institutional Review Boards approved the entire study and procedures.<br>IACUC: All experiments adhered to the guidelines approved by the Emory University Institutional Animal Care and Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Peripheral blood mononuclear cells (PBMCs) and serum from pre-pandemic controls were blindly selected at random from the study “Establishing Immunologic Assays for Determining HIV-1 Prevention and Control”, with no considerations made for age, or sex, participants were recruited at the Seattle Vaccine Trials Unit (Seattle, Washington, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell Lines: All cell lines were incubated at 37°C in the presence of 5% CO2. 293-6E (human female, RRID:CVCL_HF20) and 293T cells (human female, RRID:CVCL_0063) cells were maintained in Freestyle 293 media with gentle shaking.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We recently reported an initial characterization of the anti-S antibody responses generated by CV1 (Seydoux et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Some samples appear to show enhanced binding in the presence of ACE2, perhaps because ACE2 binding stabilizes and exposes their binding sites, these antibodies are considered not competitive with ACE2. mAb competition BLI: To measure competition between individual mAbs for binding to SARS-CoV-2 S-2P and RBD, S-2P and RBD were biotinylated using EZ-Link NHS-PEG4 Biotin at a molar ratio of 1:2/ Biotinylated protein was purified using a Zeba spin desalting column.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-2P</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-OC43, HCoV-HKU1, HCoV-NL63 and HCoV-229E S1+S2 ECTs (Cat#’s 40607-V08B, 40606-V08B, 40604-V08B, 40605-V08D), SARS-HCoV-2 S1 domain (CAT#: 40591-V08B1), SARS-CoV-2 S1 N-terminal domain (CAT#40591-V41H) SARS-HCoV-2 S2 extra-cellular domain (CAT#: 40590-V08B) and SARS-CoV2 RBD (CAT#: 40150-V05H) were purchased from SinoBiologicals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines: All cell lines were incubated at 37°C in the presence of 5% CO2. 293-6E (human female, RRID:CVCL_HF20) and 293T cells (human female, RRID:CVCL_0063) cells were maintained in Freestyle 293 media with gentle shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>the</div><div>detected: ( RRID:CVCL_HF20)</div></div><div style="margin-bottom:8px"><div>293T</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmids expressing the HIV-1 Gag and pol (pHDM-Hgpm2), HIV-1Rev (pRC-CMV-rev1b), HIV-1 Tat (pHDM-tat1b), the SARS CoV2 spike (pHDM-SARS-CoV-2 Spike) and a luciferase/GFP reporter (pHAGE-CMV-Luc2-IRES-ZsGreen-W) were co-transfected into 293T cells at a 1:1:1:1.6:4.6 ratio using 293 Free transfection reagent (EMD Millipore Cat #72181) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The culture supernatant was harvested after 72 hours at 32°C, clarified by centrifugation, filtered and frozen at −80C. 293 cells stably expressing ACE2 (HEK293T-hACE2) were seeded at a density of 4000 cells/well in a 100 µl volume in flat clear bottom, black walled, tissue culture 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The media was aspirated from 293T-ACE2 cells and 100 µl of the virus-antibody mixture was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monitoring RBD-binding to 293-ACE2 cells by flow cytometry: 8 pmol of biotinylated S-2P with strep tag peptide sequence on C terminus were mixed with 10 pmol of mAb and incubated for 10 min at RT in a round-bottom tissue culture 96-well plate. 200,000 HEK293T-hACE2 cells in 50 µL of cDMEM were then added to each well and the mixture of cells + RBD or S-2P + mAb was incubated for 20 min on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of k18-hACE2 mice with SARS-CoV-2: B6.Cg-Tg(K18-ACE2)2Prlmn/J mice were purchased from Jackson Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IMGT/V-QUEST was used to assign V, D, J gene identity, and CDRL3 length to the sequences (Brochet et al., 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The V(D)J enriched library was sequenced on an Illumina HiSeq or MiSeq.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining model building was completed using COOT (Emsley and Cowtan, 2004) and refinement was performed in Phenix (Adams et al., 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural figures were made in Pymol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles were picked with DogPicker (Voss et al., 2009) and processed in RELION 3.0 (Scheres, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis: Sequences were analyzed using Geneious software (Version 8.1.9)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All graphs were completed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
Zartek is a leading software development company based in Qatar and India. We have a team of 20+ developers experienced
This is my annotation updated.
-
-
en.wikipedia.org en.wikipedia.org
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.22.436481: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 Pseudovirus Neutralization Assay: PSV was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24, 25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays 104 293T-hACE2 cells were plated in 100uL media per well in 96 well white-wall white-bottom plates (Perkin Elmer) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">([Agonist] vs. response---variable slope-four parameters), and the Area Under Curve (AUC) were calculated using GraphPad Prism 9.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
hypothes.is hypothes.is
-
gracej001
my first annotation
-
-
en.wikipedia.org en.wikipedia.org
-
Dictionary writers list polysemes under the same entry; homonyms are defined separately.
This describes how you can tell which one it is by looking at the dictionary entry.
-
-
trailblazer.to trailblazer.to
-
Note how a handful of default steps lead into six standardized termini, allowing to plug protocols into different adapters. Imagine replacing your self-written API adapter with a canonical JSON-API adapter, for example.
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.22.436337: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 infection and treatment conditions: For all in vivo experiments, the 6 to 8 weeks male and female mice were intranasally challenged with 1 x 105 FFU in 25-30 µl volume under anesthesia (0.5 - 5 % isoflurane delivered using precision Dräger vaporizer with oxygen flow rate of 1 L/min).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody depletion of immune cell subsets: For evaluating the effect of NK cell depletion during CV3-1 prophylaxis, anti-NK1.1 (clone PK136; 12.5 mg/kg body weight) or an isotype control mAb (BioXCell; clone C1.18.4; 12.5 mg/kg body weight) was administered to mice by i.p. injections every 2 days starting at 48 h before SARS-CoV-2-nLuc challenge till 8 dpi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NK1.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">containing Fc blocking antibody against CD16/CD32 (BioLegend Inc) before staining with antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were incubated 1 hr with 10% calf serum in PBS to block nonspecific antibody binding, then incubated 2 hrs with anti-S antiserum (Cohen et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were rinsed (4x 10’) with PBS then labeled for 2 hrs with 10 nm gold conjugated goat anti-mouse secondary antibody (Ted Pella, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48 hours post transfection, 293T cells were stained with CV3-1 and CV3-25 antibodies (5μg/mL), using cross-reactive anti-SARS-CoV-1 Spike CR3022 or mouse anti-His tag (Sigma-Aldrich) as positive controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV3-25</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor-647-conjugated goat anti-human IgG (H+L) Abs (Invitrogen) and goat anti-mouse IgG (H+L) Abs (Invitrogen) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-mouse SARS-CoV-2 nucleocapsid protein (Clone 1C7, Bioss Antibodies)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following extensive washing with PBS, an anti-mouse IgG HRP secondary antibody solution was formulated in PBS + 1% non-fat milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody dependent cellular cytotoxicity (ADCC) assay: For evaluation of anti-SARS-CoV-2 ADCC activity, parental CEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ADCC activity</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Second, serially diluted clarified tissue homogenates were used to infect Vero-E6 cell culture monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Uninfected monolayer of Vero cells treated identically served as controls to determine basal luciferase activity to obtain normalized relative light units.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were maintained in complete Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher, Cat. #11965–092) containing 10% fetal bovine serum (Gibco, Thermo-Fisher, Cat. #16140–071), 1% HEPES Buffer Solution (15630–130), and 1 % penicillin– streptomycin (Thermo Fisher, Cat. #15140–122).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudoviral particles were produced by transfecting 2×106 HEK293T cells with pNL4.3 Luc R-E- (3.5 μg), plasmids encoding for SARS-CoV-2 Spike or SARS-CoV-1 Spike (3.5 μg) protein and VSV-G (pSVCMV-IN-VSV-G, 1 μg) using the standard calcium phosphate method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected by the calcium phosphate method with the pNL4.3 R-E-Luc plasmid (NIH AIDS Reagent Program) and a plasmid encoding for SARS-CoV-2 Spike at a ratio of 5:4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were used as effector cells and were stained with another cellular dye (cell proliferation dye eFluor670).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YARC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image sequences were assembled and converted to videos using Image J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Nikon Elements AR version 4.5 software (Nikon Instruments Inc, Americas) and figures assembled with Photoshop CC and Illustrator CC (Adobe Systems, San Jose, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were processed and plotted using GraphPad Prism 8 v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo software (Treestar) was used to generate FACS plot shown in Figure S7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic tilt-series and large-area montaged overviews were acquired automatically using the SerialEM software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic data was calculated, analyzed, and modeled using the IMOD software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017) on iMac Pro and MacPro computers (Apple, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMOD</div><div>suggested: (IMOD, RRID:SCR_003297)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-MEN particles were then re-suspended in 50 mM pH 7.5 HEPES buffer, labeled with Cy3B(3S) and Cy5 derivative (LD650-CoA) and purified through an optiprep gradient as previously described (Lu et al., 2019; Lu et al., 2020; Munro et al., 2014) smFRET images of S-MEN particles was acquired on a home-built prism-based total internal reflection fluorescence (TIRF) microscope, as described previously (Lu et al., 2020). smFRET data analysis was performed using MATLAB (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(MathWorks)-based customized SPARTAN software package (Juette et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPARTAN</div><div>suggested: (SPARTAN, RRID:SCR_014901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P values were indicated as ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; ∗∗∗∗, p < 0.0001. Schematics: Schematics for showing experimental design in figures were created with BioRender.com.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 65, 66, 67, 68, 62 and 63. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.16.434488: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Residues 1-617 of human ACE2 ectodomain (UniProtKB Q9BYF1C) and SARS-CoV-2 spike residues 319-530 (GenBank QHD43416.1) with the G485R mutation, were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were integrated using XDS and scaled with AIMLESS from the CCP4 program suite (Winn et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular replacement was performed using Phaser from the Phenix program suite with the SARS-CoV-2 Spike RBD-ACE2 structure (PDB ID: 6LZG) used as a search model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternate rounds of model building and refinement were performed using Coot (Emsley et al., 2010), REFMAC5 (Murshudov et al., 2011) and phenix.refine (Afonine et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.31.229781: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All procedures in this study involving animals were reviewed and approved by the Minnan Normal University Animal Ethics and Welfare Committee (MNNU-AEWC-2020001).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse experiments: Specific pathogen-free, 8-week-old male transgenic hACE2 mice and WT male mice (C57BL/6 background) were purchased from the experimental animal center of GemPharmatech (Nanjing, China).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and reagents: Anti-His-Tag, anti-p-IKK, anti-p-JNK, and anti-p-c-Jun antibodies, FITC-conjugated donkey anti-mouse IgG, and Cy3-conjugated donkey anti-rabbit IgG were purchased from Affinity Biosciences, Inc. (Cincinnati, OH, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His-Tag,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-His-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-p-IKK, anti-p-JNK,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-p-c-Jun</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-822, RRID:AB_627262)</div></div><div style="margin-bottom:8px"><div>Cy3-conjugated donkey anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-ACE2 antibody, HRP-conjugated anti-mouse IgG, and HRP-conjugated anti-rabbit IgG were obtained from Abcam (Cambridge, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies His-Tag (1:200, Affinity, T0009, USA) and ACE2 (1:200, Abcam, ab15348, UK) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Abcam Cat# ab15348, RRID:AB_301861)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then blocked in 5% non-fat milk for 1 h at room temperature and incubated with primary antibodies (including anti-ACE2, anti-p-IKK, anti-p-JNK, anti-p-c-Jun, and anti-β-actin antibodies) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-p-IKK, anti-p-JNK, anti-p-c-Jun,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then washed with Tris buffered saline buffer with Tween 20 (TBST) for three times and incubated with secondary antibody (HRP-conjugated anti-IgG) for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">8 μM TAPI-1 was added to Vero E6 cells 30 min in advance of any additional treatment conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse experiments: Specific pathogen-free, 8-week-old male transgenic hACE2 mice and WT male mice (C57BL/6 background) were purchased from the experimental animal center of GemPharmatech (Nanjing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and reagents: Anti-His-Tag, anti-p-IKK, anti-p-JNK, and anti-p-c-Jun antibodies, FITC-conjugated donkey anti-mouse IgG, and Cy3-conjugated donkey anti-rabbit IgG were purchased from Affinity Biosciences, Inc. (Cincinnati, OH, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Affinity Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse experiments: Specific pathogen-free, 8-week-old male transgenic hACE2 mice and WT male mice (C57BL/6 background) were purchased from the experimental animal center of GemPharmatech (Nanjing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GemPharmatech</div><div>suggested: (GemPharmatech, RRID:SCR_017239)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein signals were evaluated by integrated option density (IOD) using Image J software (National Institutes of Health, Bethesda, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All data were analyzed with GraphPad Prism 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.08.331645: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Inclusion criteria were as follows; 1) Age above 18 years; 2) PCR verified SARS-CoV-2 within the preceding 12 weeks; 3) Full recovery from acute COVID-19 illness; 4) Able to give informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After sample incubation, bound IgG was detected by incubation with MSD SULFO-TAG Anti-Human IgG Antibody and subsequently measured on a MESO QuickPlex SQ 120 Reader (Cat. No. AI0AA-0) after addition of GOLD Read Buffer B (Cat. No. R60AM-2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: IgA antibodies were measured using the Anti-SARS-CoV-2 IgA ELISA from Euroimmun (Euroimmun Medizinische Labordiagnostika AG, Lübeck, Germany, Cat. No. El 2606-9601 A), according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgA type antibodies were detected by incubation with peroxidase labelled anti-human IgA followed by a chromogen solution, resulting in color development in positive wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were cultured in DMEM, containing 10% FBS and 50 U/mL P/S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 hour of incubation at 37°C BHK-G43 cells were washed three times in PBS and fresh media was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-G43</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data and Statistical analyses: Flow cytometry data was analyzed using FlowJo (Version 10.7.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data was processed and graphed in GraphPad Prism version 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.18.099507: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The ACS have been conducted in accordance with the ethical principles set out in the declaration of Helsinki and all participants provided written informed consent.<br>IRB: The study was approved by the Academic Medical Center institutional Medical Ethics Committee of the University of Amsterdam.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">n=24 Live Attenuated vaccine) and HBV antibodies (n=17 natural infection, n=16 HBsAg vaccination)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HBV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of CMV-specific antibodies from sera: CMV-specific antibodies were purified using antigen-coated plates (Serion ELISA classic, Cytomegalovirus IgG, Würzburg, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Serion ELISA classic , Cytomegalovirus IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of Measle- and Mump-virus specific antibodies from sera: Ag-specific antibodies were purified using antigen-coated plates (Serion ELISA classic, Measles IgG and Mumps IgG, Würzburg, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Serion ELISA classic , Measles IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Mumps IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As positive control, anti-HIV gp120 monoclonal was used (IgG1 b12; 100 µg purified antibody in PBS at 1 mg/ml; NIH Aids Reagent Program, La Jolla, CA, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of anti-N and anti-S specific antibodies from plasma: SARS-Cov-2-specific antibodies were purified using antigen-coated plates (NUCN, Roskilde, Denmark).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of total IgG from sera: Total IgG1 antibodies were captured from 2 µL of serum using Protein G Sepharose 4 Fast Flow beads (GE Healthcare, Uppsala, Sweden) in a 96-well filter plate (Millipore Multiscreen, Amsterdam, The Netherlands) as described previously (11) or by using Protein G cartridges on the AssayMAP Bravo (Agilent Technologies, Santa Clara, USA) Briefly, 1 µL serum diluted in PBS were applied to the cartridges, followed by washes of PBS, LC-MS pure water and finally eluted with formic acid (1%)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sera: Total IgG1 antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Total IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Briefly , 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometric IgG-Fc glycosylation analysis: Eluates containing either antigen-specific antibodies or total IgG were collected in V-bottom plates, dried by vacuum centrifugation for 2.5 hours at 50°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>total IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were coated (over-night, 4°C) with recombinant trimerized spike protein produced as described recently (28) or N protein (accession number MN908947, produced in HEK cells with HAVT20 leader peptide, 10xhis tag and a Brit tag as in (23)) in PBS(5 µg/mL and 1 µg/mL, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As positive control, anti-HIV gp120 monoclonal was used (IgG1 b12; 100 µg purified antibody in PBS at 1 mg/ml; NIH Aids Reagent Program, La Jolla, CA, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Aids Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometry results were extracted and evaluated using FlexAnalysis software (Bruker Daltonics) for all samples except for the Measles virus, and Mumps virus cohorts that were analyzed with Skyline software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Skyline</div><div>suggested: (Skyline, RRID:SCR_014080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad Prism version 7.02 for Windows (GraphPad Software Inc.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.17.20104869: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: The study protocols were approved by the University of Melbourne Human Research Ethics Committee (#2056689) and all associated procedures were carried out in accordance with the approved guidelines.<br>Consent: All participants provided written informed consent in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies for surface staining included: CD19-ECD (J3-119) (Beckman Coulter), CD20 Alexa700 (2H7), IgM-BUV395 (G20-127), CD21-BUV737 (B-ly4), IgD-Cy7PE (IA6-2), IgG-BV786 (G18-145) (BD), CD14-BV510 (M5E2), CD3-BV510 (OKT3), CD8a-BV510 (RPA-T8), CD16-BV510 (3G8), CD10-BV510 (HI10a), CD27-BV605 (O323) (Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD21-BUV737</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD14-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OKT3</div><div>suggested: (BD Biosciences Cat# 566779, RRID:AB_2869862)</div></div><div style="margin-bottom:8px"><div>CD8a-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD10-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27-BV605</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following stimulation, cells were washed, stained with Live/dead Blue viability dye (ThermoFisher), and a cocktail of monoclonal antibodies: CD27 BUV737 (L128), CCR7 Alexa700 (150503), CD45RA PeCy7 (HI100), CD20 BUV805 (2H7), CD14 BUV395 (MOP9) (BD Biosciences), CD3 BV510 (SK7), CD4 BV605 (RPA-T4), CD8 BV650 (RPA-T8)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (BD Biosciences Cat# 742012, RRID:AB_2871310)</div></div><div style="margin-bottom:8px"><div>CCR7</div><div>suggested: (BD Biosciences Cat# 741981, RRID:AB_2871284)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: (BD Biosciences Cat# 742052, RRID:AB_2871341)</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BD Biosciences Cat# 563781, RRID:AB_2744325)</div></div><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BD Biosciences Cat# 740241, RRID:AB_2739988)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) or HCoV-HKU1 S protein (isolate N5;residues 1 – 1290) were synthesised with furin cleavage site removed and P986/987 stabilisation mutations39, a C-terminal T4 trimerisation domain, Avitag and His-tag, expressed in Expi293 cells and purified by Ni-NTA affinity and size-exclusion chromatography using a Superose 6 16/70 column (GE Healthcare) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Residual virus infectivity in the plasma/virus mixtures was assessed in quadruplicate wells of Vero cells incubated in serum-free media containing 1 μg/ml TPCK trypsin at 37°C/5% CO2; viral cytopathic effect was read on day 5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data are available via ProteomeXchange with identifier PXD019163.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProteomeXchange</div><div>suggested: (ProteomeXchange, RRID:SCR_004055)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pairwise correlations were assessed using Spearmans tests in Prism 8.0 (Graphpad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.17.20133793: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: This study has been conducted in accordance with the ethical principles set out in the declaration of Helsinki and all participants provided written informed consent, if applicable.<br>IRB: Approval was obtained from the Medical Ethics Committees from the Academic Medical Center, VU University Medical Center and Elisabeth-TweeSteden Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The average age of participants was 31 years (SD 4.2), 7 (50%) were female and none reported relevant comorbidities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Development of SARS-CoV-2 RBD and NP based bridging assays: The RBD-mFc and RBD-ST proteins were produced as described by Okba et al.[15] The NP was produced in HEK cells with HAVT20 leader peptide, 10xhis-tag and a BirA-tag as described by Dekkers et al.[24] MaxiSORP microtiter plates (ThermoFisherScientific, US) were coated with 100 µL per well 0.125 µg/mL RBD-mFc or NP in PBS overnight at 4 ° C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing and analysis: Statistical analysis were carried out using Graphpad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are some limitations to this study. Further investigation of cross-reactivity for the different coronaviruses may be necessary since the RBD of SARS-CoV-2 may show cross-reactivity with other human coronaviruses (HCoV), and in particular SARS-CoV-1. However, we anticipate that this will not alter our findings due to the limited number of cases with SARS-CoV-1 in Europe. [37] By including a large population of healthy controls the risk of having missed substantial cross-reactivity against other HCoV is also limited; especially since antibodies against HCoV are detected in the majority of the population (>90% for all four HCoV).[38,39] Furthermore, although this study provides an insight into the antibody response in the early phase of infection in non-hospitalized patients, the number of cases is still modest. Our study describes the early antibody kinetics in a population based on probable exposure and not based on symptoms or hospitalized patients who are RT-PCR positive. Yet, this provides an unbiased view of the performance of the developed serological assay and the antibody response in patients with mild SARS-CoV-2 infection. In summary, this study demonstrates the use of a sensitive bridging assay to study seroprevalence in non-hospitalized COVID-19 patients, and provides insight into the early kinetics of the antibody response to SARS-CoV-2 in this population.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.21.214932: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were GeneTex 632604 anti-Spike antibody (mouse monoclonal) and anti-calnexin (C5C9) rabbit mAb (CST #2679) were detected with 2nd anti-Mouse IgG Alexa 488 (Life tech Cat# A11029) and anti-rabbit IgG Dylight 633 (Thermo Fisher #35563) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-calnexin</div><div>suggested: (Thermo Fisher Scientific Cat# MA3027A488, RRID:AB_2633337)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Molecular Probes Cat# A-11029, RRID:AB_138404)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG Dylight 633</div><div>suggested: (Thermo Fisher Scientific Cat# 35563, RRID:AB_1965953)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A stable Spike expressing 293T cell line was generated by infection with pBOB-CAG-SARS-CoV2-Spike-HA lentiviral vector https://www.addgene.org/141347/ followed by single cell cloning and screening by cell extract immunoblotting of individual clones with HA tag antibody (CST #3724).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence was performed following the Cell Signaling Technology protocol (https://www.cellsignal.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.cellsignal.com/</div><div>suggested: (Cell Signaling Technology, RRID:SCR_004431)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.25.217158: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: After this step, the pellets were placed on ice and resuspended with propidium iodide, which is a viability marker of cells and the cytotoxic activity of antibodies was determined by flow cytometry, after gating on lymphocytes, based on their morphology.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, bound FcγR molecules were revealed with peroxidase conjugated anti-tag antibody (Miltenyi, 120-003-811; 1/5000 in 2% bovine serum albumin) and tetramethylbenzidine (TMB) reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound pig IgG were revealed with a secondary anti-pig-HRP-conjugated antibody (Bethyl Laboratories, USA) diluted in washing buffer, at 1:1000, incubated 1h at RT and washed 3 times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-pig-HRP-conjugated</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human Fc tag was then revealed with a specific HRP-conjugated anti-human IgG secondary antibody (diluted in in PBS-Tween-0.05%-1% skimmed milk powder at 1:1000, incubated 1h at RT and washed 3 times).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins from SARS-CoV-2 have been manufactured from Hek-293 cells and were purchased from Interchim, Monluçon, France.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hek-293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Swine serum dilutions were mixed with equal volumes of SARS-CoV-2 (BetaCoV/Hong Kong/VM20001061/2020 [KH1], corresponding to the D614 variant) or SARS-CoV (strain HK39849, SCoV) at a dose of 200 plaque-forming units determined by Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding to human FcγR: The binding of IgG from DKO swine to the FcγRI, FcγRIIa and FcγRIIb human receptors was tested using an ELISA assay and BIAcore surface plasmon resonance (SPR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIAcore</div><div>suggested: (Biacore T100 System, RRID:SCR_019679)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">His-Tagged FcγRI, FcγRIIa and FcγRIIb receptors (CD64/32a/32b, R&D Systems; 100μL, 2.4 μg/mL in 2% bovine serum albumin) were then added and incubated for 2h at room temperature (RT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R&D Systems</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed on GraphPad Software (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04431219</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">First in Human Study: LIS1, an Induction Treatment in Kidney…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04453384</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Safety and Efficacy of XAV-19 in Patie…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.24.205583: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals: All animal studies were conducted at Oregon Health and Sciences University and approved by the Institutional Animal Care and Use Committee (IACUC, IP00001707).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In vivo Fluc mRNA transfection via intravenous administration: Female BALB/c mice (8-12 weeks) were sedated using isoflurane, and LNPs encapsulating Fluc mRNA were intravenously administered via tail vein.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies used were: rabbit monoclonal anti-V5 tag at 1:1,000 (Cell Signaling Technology, 13202), rabbit monoclonal anti-6x-His tag at 1:1,000 (Thermo Fisher Scientific, MA5-33032), and mouse monoclonal anti-β-actin at 1:10,000 (R&D Systems, MAB8929).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x-His</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-33032, RRID:AB_2810125)</div></div><div style="margin-bottom:8px"><div>MA5-33032</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-33032, RRID:AB_2810125)</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies used were goat polyclonal anti-rabbit HRP (Jackson ImmunoResearch, 111-035-003) and anti-mouse HRP (115-035-003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 111-035-003, RRID:AB_2313567)</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 115-035-003, RRID:AB_10015289)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used for pull-down were mouse monoclonal anti-His tag (sc-8036) or anti-V5 tag (sc-81594) antibody (Santa Cruz Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>sc-81594</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-81594, RRID:AB_1131162)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The collected BALF was incubated with Dynabeads having anti-V5 tag antibody for 20 min at room temperature with rotation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To probe hACE2, anti-ACE2 antibody (Santa Cruz Biotechnology, sc-390851) and anti-mouse HRP were used as the primary and secondary antibodies at 1:200 and 1:2,000, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-390851, RRID:AB_2861379)</div></div><div style="margin-bottom:8px"><div>sc-390851</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-390851, RRID:AB_2861379)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T/17 cell line was purchased from ATCC (CRL-11268).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were cultured in MEM supplemented with 10% heat-inactivated FBS, 1% penicillin/streptomycin, non-essential amino acids, and sodium pyruvate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro Fluc mRNA transfection assay: For in vitro Fluc mRNA transfection assays, cells were seeded on a white 96 well plate at 4×103 cells/well for 293T and Hep G2 cells or at 104 cells/well for Calu-3, followed by overnight incubation for cell attachment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Hep G2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: For neutralization assay, 293T-hACE2 cells were seeded into white 96-well plates at 2×104 cells/well and grown for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo hsACE2 mRNA transfection via intravenous administration: Female BALB/c mice (8-12 weeks) were sedated using isoflurane, and LNPs encapsulating hsACE2 mRNA were administered to animals via tail vein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33 and 34. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.07.29.227249: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the antibodies anti-ACE2 (1:100), S-RBD-His-tag (1:50), anti-LAMP1 (1:50) and anti-LC3b (1:50) were added and slides were incubated overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-RBD-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-LAMP1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-LC3b</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following blocking, membranes were incubated overnight at 4°C with the primary antibodies anti-ACE2 (1:1000), anti-LAMP1 (1:2000), anti-LC3b (1:1000) and anti-His-tag (1:1000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (AnaSpec; EGT Group Cat# 29673-1000, RRID:AB_11232932)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">immunofluorescence microscopy: For immunefluorescence, HUVEC cells were cultured into 8-well Lab-TekTM II Chamber Slides (NuncTM) and were then treated with either 17β-diol at 3nM or S-equol at 10nM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUVEC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band intensity was quantified using ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed, and graphs were prepared with Prism 6.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The OPLSAA based DoGlycans software was used for building all models35 (S-T1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DoGlycans</div><div>suggested: (doGlycans, RRID:SCR_015758)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To address the structural interactions, we performed molecular dynamics simulations using GROMACS (v.2019.4)46 with the OPLS/AA force field parameters47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PatchDock algorithm discard all unacceptable complex and results are assorted by geometry shape complementarity score.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PatchDock</div><div>suggested: (PatchDock, RRID:SCR_017589)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular interactions were analyzed with LigPlot software58 and the pdb files required was constructed with fortran based own computer programs and the statistical data results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LigPlot</div><div>suggested: (LigPlot+, RRID:SCR_018249)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 24, 32, 22 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.29.227595: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Vaccination of CD-1 mice with the hAd5 S-Fusion + N-ETSD vaccine candidate: CD-1 female mice (Charles River Laboratories) 7 weeks of age were used for immunological studies performed at the vivarium facilities of Omeros Inc. (Seattle, WA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The constructs created included: Transfection of HEK 293T cells with hAd5 constructs: To determine surface expression of the RBD epitope by vaccine candidate constructs, we transfected HEK 293T cells with hAd5 construct DNA and quantified surface RBD by flow cytometric detection using anti-RBD antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were harvested 1, 2, 3, and 7 days post transfection by gently pipetting cells into medium and labeled with an anti-RBD monoclonal antibody (clone D003 Sino Biological Catalog # 40150-D003) and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG-Fc</div><div>suggested: (Thermo Fisher Scientific Cat# H10104, RRID:AB_2536546)</div></div><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: (Thermo Fisher Scientific Cat# H10104, RRID:AB_2536546)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To label N, cells were then incubated with an anti-flag monoclonal (Anti-Flag M2 produced in mouse, Sigma cat# F1804) antibody at 1:1000 in phosphate buffered saline with 3% BSA overnight at 4°C, followed by washes in PBS and a 1 hour incubation with a goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 555 (Life Technologies, Cat# A32727) at 1:500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A32727, RRID:AB_2633276)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For co-localization studies, cells were also incubated overnight at 4°C with a sheep anti-Lamp1 Alexa Fluor 488-conjugated (lysosomal marker) antibody (R&D systems, Cat# IC7985G) at 1:10 or a rabbit anti-CD71 (transferrin receptor, endosomal marker) antibody (ThermoFisher Cat# PA5-83022) at 1:200.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Lamp1</div><div>suggested: (Rockland Cat# 200-301-G09, RRID:AB_2611215)</div></div><div style="margin-bottom:8px"><div>anti-CD71 (transferrin receptor, endosomal marker)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After removal of the primary antibody, two washes in PBS and three 3 washes in PBS with 3% BSA, cells were incubated with fluor-conjugated secondary antibodies when applicable at 1:500 (Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, Life technologies, A-11034) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11034, RRID:AB_2576217)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S2 (SinoBiological Cat #40590-T62) was used as the primary antibody and IRDye® 800CW Goat anti-Rabbit IgG (H + L) (Li-Cor, 925-32211) as the secondary antibody using the Ibind Flex platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S2</div><div>suggested: (Imported from the IEDB Cat# S2, RRID:AB_2833224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with ACE2-Fc for 20 minutes and, after a washing step, were then labeled with a PE conjugated F(ab’)2-goat anti-human IgG Fc secondary antibody at a 1:100 dilution, incubated for 20 minutes, washed and acquired on flow cytometer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent-conjugated antibodies against mouse CD8β antibody (clone H35-17.2, ThermoFisher), CD4 (clone RM4-5, BD), IFN-γ (clone XMG1.2, BD), and TNF-α (clone MP6-XT22, BD) and staining was performed in the presence of unlabeled anti-CD16/CD32 antibody (clone 2.4G2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse CD8β</div><div>suggested: (Bio X Cell Cat# BE0223, RRID:AB_2687706)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 391503, RRID:AB_2721611)</div></div><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α</div><div>suggested: (Leinco Technologies Cat# T798, RRID:AB_2832121)</div></div><div style="margin-bottom:8px"><div>anti-CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells (2-4 × 105 cells per well of a 96-well plate) were added to the ELISpot plate containing an immobilized primary antibodies to either IFN-γ or IL-4 (BD), and were exposed to various stimuli (e.g. control peptides, target peptide pools/proteins) comprising 2 μg/mL peptide pools or 10 μg/mL protein for 36-40 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-4 (BD)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for detection of antibodies: For antibody detection in sera from inoculated mice, ELISAs specific for spike and nucleocapsid antibodies, as well as for IgG subtype (IgG1, IgG2a, IgG2b, and IgG3) antibodies were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG subtype (IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the wells were washed with PBST and 100 μL of a 1/5000 dilution of anti-mouse IgG HRP (GE Health Care; Cat # NA9310V), or anti-mouse IgG1 HRP (Sigma; Cat # SAB3701171), or anti-mouse IgG2a HRP (Sigma; Cat # SAB3701178), or anti-mouse IgG2b HRP (Sigma; catalog# SAB3701185), or anti-mouse IgG3 HRP conjugated antibody (Sigma; Cat # SAB3701192) was added to wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calculation of relative μg amounts of antibodies: A standard curve of IgG was generated and absorbance values were converted into mass equivalents for both anti-S and anti-N antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The constructs created included: Transfection of HEK 293T cells with hAd5 constructs: To determine surface expression of the RBD epitope by vaccine candidate constructs, we transfected HEK 293T cells with hAd5 construct DNA and quantified surface RBD by flow cytometric detection using anti-RBD antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunocytochemical labeling of hAd5 infected HeLa cells: To determine subcellular localization of N after infection or transfection of HeLa cells with hAd5 N-wild type (WT) or hAd5 N-ETSD (each with a flag tag to allow labeling), 48 hours after infection or transfection cells were fixed with 4% paraformaldehyde (PFA) and permeabilized with 0.4% Triton X100, in PBS) for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant ACE2-IgG1Fc protein was produced using Maxcyte transfection in CHO-S cells that were cultured for 14 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cell neutralization assay: All aspects of the assay utilizing virus were performed in a BSL3 containment facility according to the ISMMS Conventional Biocontainment Facility SOPs for SARS-CoV-2 cell culture studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination of CD-1 mice with the hAd5 S-Fusion + N-ETSD vaccine candidate: CD-1 female mice (Charles River Laboratories) 7 weeks of age were used for immunological studies performed at the vivarium facilities of Omeros Inc. (Seattle, WA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: RRID:MGI:2686808)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were harvested 1, 2, 3, and 7 days post transfection by gently pipetting cells into medium and labeled with an anti-RBD monoclonal antibody (clone D003 Sino Biological Catalog # 40150-D003) and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Catalog</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent-conjugated antibodies against mouse CD8β antibody (clone H35-17.2, ThermoFisher), CD4 (clone RM4-5, BD), IFN-γ (clone XMG1.2, BD), and TNF-α (clone MP6-XT22, BD) and staining was performed in the presence of unlabeled anti-CD16/CD32 antibody (clone 2.4G2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry was performed using a Beckman-Coulter Cytoflex S flow cytometer and analyzed using Flowjo Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 14. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.01.31.929042: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After an incubation period of 1 h at 37 °C, the inoculum was removed and cells were washed with PBS before medium supplemented with anti-VSV-G antibody (I1, mouse hybridoma supernatant from CRL-2700; ATCC) was added (no antibody was added to cells expressing VSV-G).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies were used: Mouse anti-HA tag (Sigma-Aldrich, H3663, 1:2,500), mouse anti-ß-actin (Sigma-Aldrich, A5441, 1:2,000), mouse anti-VSV matrix protein (Kerafast, EB0011, 1:2,500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Sigma-Aldrich Cat# H3663, RRID:AB_262051)</div></div><div style="margin-bottom:8px"><div>anti-ß-actin</div><div>suggested: (RayBiotech Cat# 168-10656, RRID:AB_2885189)</div></div><div style="margin-bottom:8px"><div>A5441</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>anti-VSV matrix protein (Kerafast, EB0011</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibody we used a peroxidase-coupled goat anti-mouse antibody (Dianova, 115-035-003, 1:10000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (MBL International Cat# D292-3, RRID:AB_10795278)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T (human, kidney), BHK-21 (Syrian hamster, kidney cells), Huh-7 (human, liver), LLC-PK1 (pig, kidney), MRC-5 (human, lung), MyDauLu/47.1 (Daubenton’s bat [Myotis daubentonii], lung), NIH/3T3 (Mouse, embryo), RhiLu/1.1 (Halcyon horseshoe bat [Rhinolophus alcyone], lung), Vero (African green monkey, kidney) cells were incubated in Dulbecco’s’ modified Eagle medium (PAN-Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (human, lung), Caco-2 (human, colon), MDBK (cattle, kidney) and MDCK II (Dog, kidney) cells were incubated in Minimum Essential Medium (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 (human, lung), BEAS-2B (human, bronchus) and NCI-H1299 (human, lung) cells were incubated in DMEM/F-12 Medium with Nutrient Mix (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BEAS-2B</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NCI-H1299</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of 2019-nCoV-S expression and particle incorporation by SDS-PAGE and immunoblot: Preparation of whole cell lysates: 293T cells were transfected with expression vectors for HA-tagged 2019-nCoV-S or SARS-S, or empty expression vector (negative control).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: Phylogenetic analysis (neighbor-joining trees) was performed using the MEGA7.0.26 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA7.0.26</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all statistical analyses, the GraphPad Prism 7 software package was used (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.01.22.914952: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">And the virus were detected using SL-CoV Rp3 NP antibody followed by Cy3-conjugated mouse anti-rabbit IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rp3 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-Human IgG-HRP conjugated monoclonal antibody (Kyab Biotech Co., Ltd, Wuhan, China) was used at a dilution of 1:40000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was detected using mouse anti-S tag monoclonal antibody followed by FITC-labelled goat anti-mouse IgG H&L (Abcam, ab96879).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: (Abcam Cat# ab96879, RRID:AB_10687475)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab96879, RRID:AB_10687475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral replication was detected using rabbit antibody against the Rp3 NP protein (made in house, 1:100) followed by cyanin 3-conjugated goat anti-rabbit IgG (1:50, Abcam, ab6939).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rp3 NP protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Abcam Cat# ab6939, RRID:AB_955021)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following cells were used for virus isolation in this study: Vero, Vero E6, and Huh7 that were cultured in DMEM +10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells transiently expressing ACE2 were prepared by a lipofectamine 3000 system (Thermo Fisher Scientific) in 96-well plate, with mock-transfected cells as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">nCoV-2019 grown from Vero E6 cells was used for infection at multiplicity of infection 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following cells were used for virus isolation in this study: Vero, Vero E6, and Huh7 that were cultured in DMEM +10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw NGS reads were firstly processed by Cutadapt (v1.18) with minimum read length of 30bp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cutadapt</div><div>suggested: (cutadapt, RRID:SCR_011841)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BWA (v0.7.12-r1039) was utilized to align reads to local database with a filter hits parameter at 0.8 FMM value and minimum alignment score at 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NGS reads were assembled into genomes using Geneious (v11.0.3) and MEGAHIT (v1.2.9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignment and editing were conducted using ClustalW and GeneDoc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum Likelihood phylogenetic trees based on nucleotide sequences of full-length ORF1b and S genes were constructed using the Jukes-Cantor model with bootstrap values determined by 1000 replicates in the MEGA6 software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA6</div><div>suggested: (MEGA Software, RRID:SCR_000667)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.26.222026: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">29 Antibodies and reagents: Rabbit anti-DYKDDDDK Tag (D6W5B), rabbit anti-IRF3 (D83B9), rabbit anti-pIRF3 (4D46), rabbit anti-TBK1 (3031S), rabbit anti-pTBK1 (D52C2), and rabbit anti-TRAF3 were from Cell Signaling Technology (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DYKDDDDK</div><div>suggested: (Cell Signaling Technology Cat# 14793, RRID:AB_2572291)</div></div><div style="margin-bottom:8px"><div>anti-IRF3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-pIRF3 ( 4D46)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TBK1</div><div>suggested: (Cell Signaling Technology Cat# 14590, RRID:AB_2798527)</div></div><div style="margin-bottom:8px"><div>anti-pTBK1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TRAF3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor 488 goat anti-rabbit IgG secondary antibody, Alexa Fluor 568 goat anti-mouse IgG secondary antibody, Alexa Fluor 488 goat anti-mouse IgG secondary antibody, and Alexa Fluor 568 goat anti-rabbit IgG secondary antibody were from Thermo Fisher Scientific (USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Alexa Fluor 488 goat anti-rabbit IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coimmunoprecipitation and immunoblotting: For coimmunoprecipitation assays, HEK293T cells were collected 24 hours after transfection and lysed in lysis buffer [1.0% (v/v) NP-40, 50 mM Tris-HCl, pH 7.4, 50 mM EDTA, 0.15 M NaCl] supplemented with a protease inhibitor cocktail (Sigma, USA) and a phosphatase inhibitor cocktail (Sigma, USA) as described in our previous publications.30,31 After centrifugation for 10 min at 14,000 g, the supernatants were collected and incubated with the indicated antibodies, followed by the addition of protein A/G beads (Santa Cruz, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NP-40</div><div>suggested: (Covance Cat# MMS-503P-100, RRID:AB_291448)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: HEK293, HEK293T, HeLa, and Vero-E6 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) with 10% heat-inactivated fetal bovine serum (FBS, Gibco, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">32,35 Briefly, approximately 0.5 x 105 HEK293T cells were seeded in 48-well plates and transfected 12 hours later with the luciferase reporter plasmid and the expression vector plasmids of RIG-I, RIG-IN, MDA-5, MAVS, TBK1, IKKε, IRF3-5D, TRIF, and STING, alone or together with the plasmid expressing the SARS-CoV-2 M protein, as indicated in the experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and infection: VSV-enhanced green fluorescent protein (eGFP) and SeV were used to infect HeLa, HEK293, or HEK293T cells as described in our previous publications.30–32 Briefly, before infection, prewarmed serum-free DMEM medium at 37°C was used to wash the target cells, after which the virus was diluted to the desired multiplicity of infection (MOI) in serum-free DMEM and incubated with the target cells for 1-2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Confocal immunofluorescence microscopy: Confocal immunofluorescence microscopy studies were performed as described in our previous publications.30,31 Briefly, HeLa cells were grown on 12-well slides one day before transfection with the indicated plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">32 Briefly, Vero cells were seeded on 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For statistical analysis, two-tailed unpaired Student’s t-tests were performed by GraphPad Prism 8.0 and Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.08.13.248872: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were previously tested for mycoplasma contamination and incubated in Dulbecco’s modified Eagle’s medium at 37 °C under a humidified atmosphere with 5% CO2.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reagents and antibodies: His-tagged SARS-2-S (S1+S2 ECD; YP_009724390.1;Val16-Pro1213; 40589-V08B1), SARS-2-S1 (YP_009724390.1;Val16-Arg685; 40591-V08H), and SARS-2-S2 (ECD; YP_009724390.1; Ser686-Pro1213; 40591-V08B) proteins were from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1+S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ECD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>YP_009724390.1;Val16-Pro1213</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>40589-V08B1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-2-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>YP_009724390.1;Val16-Arg685</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>40591-V08H</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-2-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An antibody against ACE2 for FACS (21115-1-AP; 1:100 dilution) was from Proteintech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>21115-1-AP</div><div>suggested: (Proteintech Cat# 21115-1-AP, RRID:AB_10732845)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A PE anti-His antibody (362603, clone J095G46; 1;100 dilution) and an antibody against SR-B1 for FACS (363208, clone m1B9; dilution 1:100) were from Biolegend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (BioLegend Cat# 362603, RRID:AB_2563634)</div></div><div style="margin-bottom:8px"><div>SR-B1 for FACS ( 363208</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S1 antibody (40150-R007) for confocal microscopy was from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, anti-rabbit or anti-mouse HRP-conjugated antibodies were applied after 3 washes and the antigen-antibody complexes were visualized using chemilumines cence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP-conjugated</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry for surface SR-B1 or ACE2 expression analysis: Cells were washed with PBS 2 times and incubated with APC-conjugated (APC anti-SR-B1) antibody (1:100) or anti-ACE2 antibody (1:100) followed by a secondary incubation with donkey-anti-rabbit antibody (1:200) conjugated to Alexa Flour 488.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubating at RT for 30 min, the cells were washed two times with PBS containing 2% FBS and then incubated for 30 min at RT with a PE-conjugated antibody (PE anti-His tag).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking in 1% normal goat serum, the sections were incubated with ACE2 or SR-B1 monoclonal antibodies at 4□°C overnight in a humidified chamber, which was followed by an incubation with HRP-labeled goat anti-mouse IgG secondary antibody (Beijing ZSGB Biotechnology, ZDR-5307).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SR-B1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the sections were incubated with a goat anti-rabbit IgG secondary antibody (HRP) (Beijing ZSGB Biotechnology, PV9001) for 60 min and then visualized with 3,30-diaminobenzidine tetrahydrochloride (DAB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (ZSGB-Bio Cat# PV-9001, RRID:AB_2868452)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Vero E6 (CRL-1568), MDCK (CCL-34) and Hepa 1-6 (CRL-1830</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production: All pseudoparticles were generated in 293T cells transfected with the HIV backbone vector pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For chemicals and antibodies, Vero E6 or Huh-7 cells (1.6 ×105 cells/mL) were cultured in a 96-well plate at 37 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For SR-B1 expression, Vero cells (1.6 ×105 cells/mL) were transfected with a plasmid encoding SR-B1, while Huh-7 cells (1.6 ×105 cells/mL) were transfected with siRNA oligos for SR-B1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were fitted to saturation binding equations using GraphPad Prism 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acoustic Focusing cytometer using Flowjo V10.0.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical methods: In the present study, GraphPad Prism 8.0 was used for statistical calculations and data plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.08.15.252437: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were approved by the Institutional Animal Ethics committee (IAEC) No. RR/IAEC/72-2019, Invivo/GP/084.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Guinea Pig Immunizations: Groups of four, female, Hartley strain guinea pigs, (6-8 weeks old, approximately weighing 300 g) were immunized with 20 μg of purified antigen protein diluted in 50 μl PBS, (pH 7.4), and mixed with 50 μl of AddaVax™ adjuvant (vac-adx-10) (1:1 v/v Antigen: AddaVax™ ratio per animal/dose) (InvivoGen, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes for the heavy and light chain of the CR3022 antibody were obtained from Genscript (USA) and cloned into the pcDNA3.4 vector Purification of recombinant proteins expressed in Expi293F cells: Transfections were performed according to the manufacturer’s guidelines (Gibco, Thermofisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression levels were monitored by dot blot analysis with anti-His tag antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag antibodies .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this blot was washed and incubated with α-guinea pig ALP conjugated antibody (Sigma) at 1:5000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-guinea pig ALP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this, Rabbit ALP enzyme conjugated to anti-Guinea Pig IgG secondary antibody (diluted 1:5000 in blocking buffer) (50 μL/well) was added and incubated for 1 hour at 25 °C, 300 rpm (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Guinea Pig IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C56297-5000, RRID:AB_10379625)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, rabbit ALP enzyme conjugated to anti-Human IgG secondary antibody (diluted 1:5000 in blocking buffer) (50 μl/well) was added and samples incubated for 1 hour at 25°C, 300 rpm (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were incubated with anti-His Antibody (1:10000 dilution) conjugated with Horseradish peroxidase (HRP) enzyme for 1 hr at RT following which the reaction was visualized by adding 50μL of the chromogenic substrate, TMB (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (LSBio (LifeSpan Cat# LS-C67878-100, RRID:AB_1815148)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the plasmids pCAGGS-SARS2-S and pCAGGS-SARS-S were transiently expressed on HEK 293T cells using Polyethylenimine (PEI) (Polysciences, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the viruses were titrated in Vero E6 cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The unbound tag-free protein was collected and protein concentration was determined by absorbance (A280) using NanoDrop™2000c with the theoretical molar extinction coefficient calculated using the ProtParam tool (ExPASy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference-free 2D classification using single-particle analysis: The evaluation of micrographs was done with EMAN 2.1 (56).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMAN</div><div>suggested: (EMAN, RRID:SCR_016867)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference free 2D classification of different projections of particle were performed using simple_prime2D of SIMPLE 2.1 software (57</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SIMPLE</div><div>suggested: (SIMPLE, RRID:SCR_009389)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of Pseudotyped SARS-CoV-2 and pseudovirus neutralisation assay: The full-length synthetic construct of Spike glycoprotein of SARS-CoV-2 (GenBank: MN908947) was synthesized from Genewiz, UK.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.08.15.252395: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animal care and experimentation under protocol #4390, approved by the Institutional Animal Care and Use Committee (IACUC) at Kansas State University on April 8, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Following embedding, tissue sections were cut and stained with hematoxylin and eosin and evaluated by a board-certified veterinary pathologist who was blinded to the treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eighteen pigs (mix of males and females, five weeks of age) were used in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: To detect SARS-CoV-2 antibodies in sera, indirect ELISAs were performed using recombinant SARS-CoV-2 Receptor Binding Domain (RBD) expressed in HEK cells with a C-terminal Strep-Tag and the Nucleocapsid (N) protein expressed in E.coli with a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 μL anti-pig-IgG or IgM secondary antibodies, conjugated with peroxidase, were diluted 1:2,500 in blocking buffer and then incubated at room temperature for 1 hour, protected from light.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-pig-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optical density (OD) value was measured at 450 nm within 5 minutes of adding the stop solution to quantify the amount of antigenbinding antibody present in the sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigenbinding</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum from pigs infected with African Swine Fever Virus (ASFV) and the baculovirus-expressed ASFV-p54 antigen were used as a positive control for anti-pig-IgG or IgM secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was passaged three times in VeroE6 cells (ATCC® CRL-1586™), before being passaged two times in swine testicle (ST; ATCC CRL-1746™) and four times in porcine kidney (PK-15; ATCC® CCL-33™) cell lines to investigate suitability of these swine cell lines for propagation of SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: To detect SARS-CoV-2 antibodies in sera, indirect ELISAs were performed using recombinant SARS-CoV-2 Receptor Binding Domain (RBD) expressed in HEK cells with a C-terminal Strep-Tag and the Nucleocapsid (N) protein expressed in E.coli with a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.08.16.252973: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-Myc-tag (71D10), rabbit anti-IRF3 (D83B9), rabbit anti-pIRF3 (4D46), rabbit anti-TBK1 (3031S), rabbit anti-pTBK1 (D52C2) were purchased from Cell Signaling Technology; Mouse anti-MAVS was purchased from Santa Cruz; Mouse anti-actin, mouse anti-V5-tag, and rabbit anti-calnexin were purchased from proteintech; Mouse anti-Flag M2 was purchased from Sigma Aldrich; Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam; Rabbit anti-Tom20 antibody was purchased from Abclonal; Mouse anti-HA was purchased from MDL biotech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: (Cell Signaling Technology Cat# 2278, RRID:AB_490778)</div></div><div style="margin-bottom:8px"><div>anti-IRF3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-pIRF3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TBK1</div><div>suggested: (Cell Signaling Technology Cat# 14590, RRID:AB_2798527)</div></div><div style="margin-bottom:8px"><div>anti-pTBK1 (D52C2)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAVS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-V5-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-calnexin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GM130</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Tom20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatants were transferred into new tubes after centrifugation for 10 min at 14,000g and further incubated with the indicated antibodies for 3 hours at 4 □ followed by the addition of protein A/G beads (Santa Cruz), or with Anti-Flag magnetic beads (Bimake), anti-Myc magnetic beads (Bimake).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Constructs and plasmids: Plasmids expressing RIG-I, RIG-IN, MDA-5, MAVS, TBK1, IKKε, IRF3-5D, TRIF, and STING were cloned into mammalian expression vectors and the luciferase reporter plasmids including pGL3-IFN-β-Luc (IFN-β luciferase reporter) and pGL3-IFN-λ1-Luc (IFN-λ1 luciferase reporter) were constructed by inserting the promoter region into pGL3-Basic (Promega, USA) by standard molecular cloning methods as described in our previous publications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK-293, HEK-293T, HeLa, and Vero E6 cells were obtained from the American Type Culture Collection (ATCC), and cultured according to the culture method provide by ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The luciferase reporter plasmids and the gene expression plasmids were co-transfected into HEK-293T cells as indicated in each figure legend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral infection: VSV-enhanced green fluorescent protein (eGFP) and SeV were used to infect HeLa, HEK293, or HEK293T cells as described in our previous publications.30-32 Briefly, before infection, prewarmed serum-free DMEM medium at 37°C was used to wash the target cells, after which the virus was diluted to the desired multiplicity of infection (MOI) in serum-free DMEM and incubated with the target cells for 1-2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoblot analysis and immunoprecipitation: For Co-IP assay, HEK293T cells were first transfected with the indicated plasmids for 24 h and further lysed in lysis buffer [1.0% (v/v) NP-40, 50 mM Tris-HCl, pH 7.4, 50 mM EDTA, 0.15 M NaCl] complemented with a protease inhibitor cocktail (Sigma), and a phosphatase inhibitor cocktail (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays: Vero-E6 cells were used to perform plaque assays to determine the titer of VSV-eGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simply, Vero cells at approximately 100% confluency cultured in 24-well plates were infected with serial dilutions of VSV-eGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">34 Statistical analysis: Statistical analysis was performed using two-tailed unpaired Student’s t-tests by GraphPad Prism 8.0 and Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.08.14.251207: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Matrix processing and substrate scoring: The matrices were normalized by the sum of the 17 randomized amino acids (all amino acids expect for serine, threonine and cysteine), to yield a position specific scoring matrix.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of SRPK1, membranes were incubated with primary antibody (BD cat. no. 611072) at 0.025 µg/mL in PBST containing 5% milk overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SRPK1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of GAPDH, membranes were incubated with primary antibody (Cell Signaling, cat. no. 2118S) at a dilution of 1:10,000 in PBST containing 5% milk overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse (Invitrogen cat. no. A16072) and anti-rabbit (Thermo Scientific cat. no. A16104) secondary antibodies were used at 1:20,000 and 1:10,000 dilutions, respectively, in PBST containing 5% milk for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with either an anti-dsRNA antibody (J2, Sigma MABE1134) at a 1:125 dilution, or an anti-SARS-CoV-2 Spike RBD protein (ProSci #9087) at a 1:150 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (Millipore Cat# MABE1134, RRID:AB_2819101)</div></div><div style="margin-bottom:8px"><div>J2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike RBD protein ( ProSci #9087</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reactions were run phos-tag gel and blotted with monoclonal anti-N protein antibody (GeneTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were incubated with primary antibodies: Prosurfactant protein C (1:500, Milipore, cat# AB3786) and SARS-CoV-2 (1:500, Genetex cat# GTX632604) in blocking buffer at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture (Duke): All cells were obtained from ATCC and grown at 37°C in 5% CO2. 293T and A549 and Huh7 cells were grown in DMEM with 10% FBS, Glutamax, and Penicillin/Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were grown in EMEM with 10% FBS and Penicillin/Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-229E infections and titering: A stock of isolate HCoV-229E VR-740 (ATCC) was grown on Huh7 cells in complete media (DMEM supplemented with 10% FBS, 1% Pen/Strep, Glutamax).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For phosphoproteomic analysis, 6×107 Vero E6 or 6×107 A549-ACE2 cells were treated with 5 µM Alectinib or DMSO in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviruses were packaged as per standard protocols with a VSV-G envelope protein, A549 or A549-Cas9 cells were transduced and selected with puromycin at 2μg/mL. siRNA treatment of cells: A549-ACE2 cells were treated with 30μM siRNA (SRPK1: Horizon M-003982-02-0010; Non-targeting: Thermo 4390843) following the HiPerfect (Qiagen) Fast-Forward protocol and plated in 6 well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-Cas9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis: Differential expression analysis of proteins and phosphorylation sites was done using Limma v3.42 package in R (81).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A BLAST search was performed over each proteome using the SARS-CoV-2 nucleocapsid protein as the query; the top hit of each virus was taken to be the nucleocapsid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each designated nucleocapsid was then individually aligned to the SARS- CoV-2 nucleocapsid using MUSCLE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bacterial colonies were then selected and plasmid DNA isolated using the Genejet Plasmid Miniprep kit (Thermo Fisher Cat# K0503).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Cat#</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV2 primer/probe set were synthesized using IDT DNA based on the sequences provided by the CDC “Research Use Only 2019-Novel Coronavirus (2019-nCov) Real-time RT-PCR Primers and Probes” set N1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Probes”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reactions were cycled on the Applied Biosystems QuantStudio 3 Real-Time PCR System and analyzed using QuantStudio software version v1.4.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantStudio</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SRPIN340 and SPHINX were suspended in DMSO at 1000X the final concentration indicated, Alectinib at 500X.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPHINX</div><div>suggested: (SPHINX, RRID:SCR_000534)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.04.282558: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, wells were treated with goat-α-human HRP secondary antibody for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With rigorous washing steps in between the proteins were detected with mouse anti-strep-tag-antibodies (IBA) and goat anti-mouse IgG antibodies (Life Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantifying and plotting fluorescent image data: Image quantification was performed by measuring the intensity of gray pixels of the stained ferret and Syrian hamster lung tissue slides with ImageJ version 1.52p. For stained tissues, background correction was performed by subtracting the average signal intensity of the antibody control from the images stained with ACE2 antibody, SARS-CoV1, and SARS-CoV2 recombinant proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The adapted pCD5 expression vector with an N-terminal HA leader (MKTIIALSYIFCLVFA) peptide, ACE2, and Twin-Strep (WSHPQFEKGGGSGGGSWSHPQFEK); IBA, Germany) was purified from HEK293T cell culture supernatant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescent cell staining: Vero-E6, A549, and MDCK cells grown on coverslips were analyzed by immunofluorescent staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Micrographs were collected using Leginon [37] and then uploaded to Appion [38].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2D processing was undertaken using Relion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LAS Application Suite X was used as well as ImageJ for the addition of the scale bars.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plotting means ± standard deviation values were performed in GraphPad Prism v8.0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.08.284737: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (293T, ATCC, CRL-3216) and VERO-E6 cells (ATCC, CRL-1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS), 2.0 mM L-Glutamine, 110 mg/L sodium pyruvate, and 4.5 g/L D-glucose. l1-Hybridoma (CRL-2700) secreting a monoclonal antibody targeting against VSV glycoprotein was cultured in Minimum Essential Medium with Earle’s salts and 2.0 mM L-Glutamine (MEM; Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CRL-3216</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>l1-Hybridoma</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next they were incubated with the mouse monoclonal antibody targeting Flag tag (9A3, #8146S,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody targeting Flag tag ( 9A3</div><div>suggested: (Cell Signaling Technology Cat# 8146, RRID:AB_10950495)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three rounds of PBS washing, cells were subsequently incubated with 2 μg/ml of the secondary goat anti-rabbit antibody conjugated with Alexa Fluor 594 (A11032, Thermo Fisher Scientific, United States) diluted in 1% BSA /PBS at room temperature for 30 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A11032</div><div>suggested: (Molecular Probes Cat# A-11032, RRID:AB_2534091)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently incubated with a mouse monoclonal antibody SARS-CoV/SARS-CoV-2 Nucleocapsid Antibody (40143-MM05, Sino Biological, China) at 1:500 at 37°C for 1 hour, and then incubated with 2μg/ml of goat anti-mouse secondary antibody, Alexa Fluor 594 (A-11032, Thermo Fisher Scientific) at 37°C for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-11032, RRID:AB_2534091)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (293T, ATCC, CRL-3216) and VERO-E6 cells (ATCC, CRL-1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS), 2.0 mM L-Glutamine, 110 mg/L sodium pyruvate, and 4.5 g/L D-glucose. l1-Hybridoma (CRL-2700) secreting a monoclonal antibody targeting against VSV glycoprotein was cultured in Minimum Essential Medium with Earle’s salts and 2.0 mM L-Glutamine (MEM; Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coronavirus RBD-hFc binding assay: Recombinant SARS-CoV-RBD-hFc and SARS-CoV-2-RBD-hFc proteins were produced by transient transfection of 293T cells with Lipofectamine 3000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was amplified on Vero-E6 cells and stored at −150°C, and the titer was determined on Vero-E6 cells through a plaque assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, we aligned the deduced ACE2 protein sequences using the MUSCLE program (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence logo was generated with WebLogo (https://weblogo.berkeley.edu/logo.cgi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed selective pressure analysis on bat ACE2 using CodeML implemented in PAML (24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PAML</div><div>suggested: (PAML, RRID:SCR_014932)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homology-based structural modeling: Molecular models of different bat ACE2 were predicted by I-TASSER (Iterative Threading ASSEmbly Refinement) version 5.1 (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>I-TASSER</div><div>suggested: (I-TASSER, RRID:SCR_014627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structural alignment and visualization were implemented in PyMOL (33).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.14.295956: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: Recombinant SARS-CoV-2 S-RBD fused with Fc/His tag (S-RBD-His) was produced in 293T cells and purified with Protein A Agarose (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was transferred to 293T expressing human ACE2 stable cell line cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.04.29.068098: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of HCoV-19 spike ectodomain and hACE2: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extracellular domain of hACE2 (Gln18-Ser740, NP_068576.1) with C-terminal Fc tag was expressed in HEK 293 cells were purified by protein A sepharose beads (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MS and MS/MS spectra were recorded using the Xcalibur software 2.3 (Thermo Scientific, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics: The acquired MS raw files from deglycosylated peptides were searched by MaxQuant (version 1.6.10.43) against the human ACE2 sequence from UniProtKB and HCoV-19 S sequence (YP_009724390.1_3) from NCBI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The modified residues within each model were generated with Coot (Emsley et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All structural figures were performed by PyMOL (Schrödinger Inc. U.S.A.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.18.302901: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Equal portions of the cell lysate were run on a 15% SDS-PAGE gel and blotted onto a PVDF membrane, which was subsequently probed with HRP Anti-Strep tag antibody (Abcam) and developed with an ECL substrate (Amersham Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Strep tag antibody ( Abcam )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T, Expi293F and HeLa cells were purchased from the American Type Culture Collection (ATCC), and cultured in Dulbecco’s Modified Eagle medium (DMEM) or Expi293 Expression Medium (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco) at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were motion-corrected and dose-weighted using MotionCor2 (Zheng et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patch contrast transfer function (CTF) estimation was performed using cryoSPARC (Punjani et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inspection, model building, and manual adjustment were carried out in Coot (Emsley and Cowtan, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real-space refinement was performed using PHENIX (Adams et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All representations of densities and structural models were generated using Chimera, ChimeraX (Goddard et al., 2018), and Pymol (DeLano, 2002).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image data were analyzed and quantified using Image J (NIH) or MetaXpress software (Molecular Devices).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>MetaXpress</div><div>suggested: (MetaXpress, RRID:SCR_016654)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All graphs were plotted and analyzed with GraphPad Prism 5 software. p > 0.05 was considered statistically not significant, and the following denotations were used: **p < 0.001 and *p < 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 12 and 13. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.29.318196: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection: Adherent HEK293 cells were grown to ∼90% confluence in a 9 cm diameter cell culture dish at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The DNA coding for the IFNα2-eYFP-FLAGtag-PreScission_site-S_RBD-8xHis-tag-StopStop fusion protein was ordered from Genewiz, cloned into the HindIII and XbaI sites of pcDNA 4/TO (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.22.308965: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CR3022, a SARS-CoV-1 and SARS-CoV-2 spike binding antibody, and dengue antibody, DEN3, were used as positive and negative controls for the assay, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DEN3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA binding: 96-well half-area plates (Corning cat. #3690, Thermo Fisher Scientific) were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat. #MA1-21315-1MG</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the washes, a secondary antibody conjugated with alkaline phosphatase (AffiniPure goat anti-human IgG Fc fragment specific, Jackson ImmunoResearch Laboratories cat. #109-055-008) diluted 1:1000 in 1% BSA/PBS-T, was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AffiniPure goat anti-human IgG Fc fragment specific</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-005-008, RRID:AB_2337534)</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-008, RRID:AB_2337601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A mixture of fluorescently labeled antibodies to cell surface markers was prepared, including antibodies specific for the T cell markers CD3(APC Cy7, BD Pharmingen #557757), CD4(APC-Cy7, Biolegend #317418) and CD8(APC-Cy7, BD Pharmingen</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Fitzgerald Industries International Cat# 61R-CD3gHUCY5, RRID:AB_1283253)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 317418, RRID:AB_571947)</div></div><div style="margin-bottom:8px"><div>APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with plasmids encoding full-length coronavirus spikes including SARS-CoV-1, SARS-CoV-2, MERS-CoV, HCoV-HKU1, HCoV-OC43, HCoV-NL63 and HCoV-229E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay: Under BSL2/3 conditions, MLV-gag/pol and MLV-CMV plasmids were co-transfected into HEK293T cells along with full-length or variously truncated SARS-CoV1 and SARS-COV2 spike plasmids using Lipofectamine 2000 to produce single-round of infection competent pseudo-viruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 293T cells were plated in advance overnight with DMEM medium +10% FBS + 1% Pen/Strep + 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following the infection, HeLa-hACE2 cells were lysed using 1x luciferase lysis buffer (25mM Gly-Gly pH 7.8, 15mM MgSO4, 4mM EGTA, 1% Triton X-100)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">20µL of the supernatant was transferred to a 384-well plate seeded with 2E3 HeLa-ACE2 cells and incubated for an additional 24 hours at 34°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extend of biotinylation was evaluated by BioLayer Interferometry binding value using streptavidin biosensors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLayer</div><div>suggested: (Harvard Medical School Center for Macromolecular Interactions Core Facility, RRID:SCR_018270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After another two washes, stained cells were analyzed using flow cytometry (BD Lyrics cytometers), and the binding data were generated by calculating the percent (%) PE-positive cells for antigen binding using FlowJo 10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absorbance was measured after 8, 20, and 30 minutes, and was recorded at an optical density of 405 nm (OD405) using a VersaMax microplate reader (Molecular Devices), where data were collected using SoftMax software version 5.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SoftMax</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gibson assembly products were finally transformed into competent E.coli cells and single colonies were picked for sequencing and analysis on IMGT V-Quest online tool (http://www.imgt.org) as well as downstream plasmid production for antibody expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10µL of human polyclonal sera diluted 1:500 in Perm/Wash Buffer (BD Biosciences)was added to the plate and incubated at RT for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences)was</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PFU/mL of the monocyte plate supernatant was calculated and graphed using Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Leginon software 37 was used to automate data collection on a FEI Tecnai Spirit (120keV), paired a FEI Eagle 4k x 4k camera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RELION 3.0 40 was used to generate the 2D class averages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.29.175844: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal experiments are performed according to Swedish Animal Welfare Act SFS 1988:534 and were approved by the Animal Ethics Committee of Malmö/Lund, Sweden.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against the His-tag (1:2000, Invitrogen) were followed by secondary HRP conjugated antibody (1:2000, Dako, Denmark), for detection of S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In another set of experiments, 2 μg of SARS-Cov-2 S protein were incubated with 0.25 mg/ml of LPS and Lipid A from E. coli, LPS from P. aeruginosa, LTA and PGN from S. aureus, and zymosan from S. cerevisiae.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>P . aeruginosa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The image was obtained using a Gel Doc Imager (Bio-Rad Laboratories,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of the spectra was performed with Xcalibur v 2.0.7. software (from Thermo Fisher Scientific, San José, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis, as indicated in each figure legend, were performed using GraphPad Prism software v8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.07.09.195263: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-His-tag antibodies were loaded to a SA sensor chip by NHS to capture the His-tag labeled S trimer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>His-tag labeled S trimer.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies were in vitro expressed using HEK293 cells, and the binding specificities were quantity by ELISA against the Spike protein and the RBD protein, as described previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-mixed Huh-7 cells were added to all wells and incubated for 24 h at 37 °C and supplied with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Fabs of BD-236, BD-604, and BD-629 were obtained by transient transfection in HEK293F cells using polyethylenimine (Polysciences) when the cell density reached 1 million cells/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 and IC80 were determined by a four-parameter logistic regression using GraphPad Prism 8.0 (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All structures were solved by the molecular replacement method using the Phaser program (McCoy et al., 2007) in Phenix (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structural models were then manually adjusted in Coot (Emsley et al., 2010) and refined using Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were recorded on a K2 Summit direct electron detector (Gatan) using the SerialEM software (Mastronarde, 2005), in the super-resolution mode at a nominal magnification of 130,000, with an exposure rate of 7.1875 e-/Å2 per second.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw movie frames were aligned and averaged into motion-corrected summed images with a pixel size of 1.055 Å by MotionCor2 (Zheng et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using Pymol (Schrödinger) and UCSF Chimera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.15.340612: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were stained using primary antibodies against β-actin (1:10,000, AC-15, Sigma), strep II-tag (1:1,000, NBP2-43735, Novus), strep II-tag (1:2,000, ab76949, abcam), GAPDH (1:1,000, 607902, Biolegend), pSTAT1 (1:1,000, Y701, Cell Signaling Technology), STAT1 (1:1,000, 9172S, Cell Signaling Technology), pSTAT2 (1:1,000, Y690, Cell Signaling Technology), STAT2 (1:1,000, 4594S, Cell Signaling Technology), IFNAR1 (1:1,000, ab45172, abcam), p62 (1:1,000, GP62-N, ProGen), LC3a/β (1:200</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (BioLegend Cat# 607902, RRID:AB_2734503)</div></div><div style="margin-bottom:8px"><div>pSTAT1</div><div>suggested: (Fluidigm Cat# 3153003, RRID:AB_2661824)</div></div><div style="margin-bottom:8px"><div>Y701 , Cell Signaling Technology) , STAT1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>9172S , Cell Signaling Technology) , pSTAT2 ( 1:1,000 , Y690 , Cell Signaling Technology) , STAT2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFNAR1</div><div>suggested: (Abcam Cat# ab45172, RRID:AB_775764)</div></div><div style="margin-bottom:8px"><div>p62</div><div>suggested: (Progen Cat# GP62-N, RRID:AB_2801426)</div></div><div style="margin-bottom:8px"><div>GP62-N</div><div>suggested: (Progen Cat# GP62-N, RRID:AB_2801426)</div></div><div style="margin-bottom:8px"><div>LC3a/β</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, M2, Sigma), V5-tag (1:1,000, D3H8Q, Cell Signaling Technology), SARS-CoV-2 (COVID-19) spike antibody (1:1000, 1A9, Biozol), SARS-CoV/SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-tag</div><div>suggested: (Cell Signaling Technology Cat# 13202, RRID:AB_2687461)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were stained using primary antibodies against strep II-tag (1:200, NBP2-43735, Novus) and TGN46 (1:400, AHP500GT, Bio Rad), secondary antibodies fluorescently labelled with AlexaFluor568 targeting rabbit-IgGs (1:400, A10042, Invitrogen) and AlexaFluor647 targeting sheep-IgG (1:400, A21448, Invitrogen), and DAPI (1:1,000) to stain nuclei.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NBP2-43735</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TGN46</div><div>suggested: (Bio-Rad Cat# AHP500GT, RRID:AB_2203291)</div></div><div style="margin-bottom:8px"><div>A10042</div><div>suggested: (Thermo Fisher Scientific Cat# A10042, RRID:AB_2534017)</div></div><div style="margin-bottom:8px"><div>AlexaFluor647 targeting sheep-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A21448</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and cell culture and viruses: HEK293T cells were purchased from American type culture collection (ATCC: #CRL3216).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of stable THP-1 cells: THP-1 cell liens were generated by transduction with lentivirus generated with the indicated pLVX-EF1alpha vectors (kind gift from Nevan Krogan), as well as packaging vectors psPax2 and pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: CLS Cat# 300356/p804_THP-1, RRID:CVCL_0006)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence: HeLa GL cells were transfected using TransIT-LT1 and grown on coverslips in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa GL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inhibition of SARS-CoV-2 by immune modulation: 300,000 Calu-3 cells were seeded in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viruses were propagated by infecting 70% confluent Vero E6 in 75 cm2 cell culture flasks at a MOI of 0.003 in 3.5 ml serum-free medium containing 1 μg/ml trypsin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteome analysis: For the proteome analysis of infected cells, 0.6×106 Caco-2 cells were infected with SARS-CoV-2 BetaCoV/Netherlands/01/NL/2020 at an MOI of 0.5 and harvested 24 h and 48 h post infection with TM lysis buffer supplemented with 1:500 protease inhibitor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired using a Zeiss LSM710 and analyzed with Fiji ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD021899.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MaxQuant 1.6.15.0 was used to identify proteins and quantify by LFQ with the following parameters: Database, Uniprot_AUP000005640_Hsapiens_20200120.fasta supplemented with the sequences of NSP1_V5, NSP7_V5, NSP15_V5, NSP16_V5, E_V5, M_V5, N_V5, S_V5, ORF3_V5, ORF6_V5, ORF7_V5 and Spike protein from SARSCoV239; MS tol, 10ppm; MS/MS tol, 20ppm</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO Analysis: From the proteome of the respective samples, proteins regulated more than 4-fold compared to the vector control were extracted and submitted to PANTHER (cellular component analysis).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PANTHER</div><div>suggested: (PANTHER, RRID:SCR_004869)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used MATLAB 2019b for the half-life analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad PRISM 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.19.344713: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used in this study were the following: rabbit anti-RBD polyclonal antibody (Sino Biological, #40592-T62), mouse anti-Actin monoclonal antibody (ProteinTech, 60008-1-Ig)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mouse anti-his tag monoclonal antibody (Abmart, M20001S), mouse anti-DDK/Flag tag monoclonal antibody (Abmart, M20008L), HRP Goat Anti-Rabbit IgG (ZSBIO, ZB-5301), HRP Goat anti-mouse IgG (ZSBIO, ZB-5305).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-DDK/Flag tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After treatment with 1% triton-100 for 15 min and blocking with unimmunized goat serum for 1 h, cells were incubated with the anti-his tag antibody overnight at 4°C, and then detected with donkey anti-mouse secondary antibody conjugated with alexa fluor plus 488nm (Invitrogen, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A32766, RRID:AB_2762823)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and transfection: Human kidney cell line HEK-293 and lung cancer cell line A549 were purchased from the Cell Bank of Type Culture Collection Committee of the Chinese Academy of Sciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to evaluate the effect of polydatin and lonidamine on virus replication, 2×105 A549 cells were seeded into 12-wells plates and infected with Ad11 virus (MOI=0.5) in serum-free medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Potential TFs on the promoter (upstream 1000bp) of TRL-TAA-4-1 were predicted with JASPAR software (relative profile score threshold was 80%) and Venny 2.1 software was used to performed the gene overlap analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JASPAR</div><div>suggested: (JASPAR, RRID:SCR_003030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The signalling pathway and functional enrichment analysis of related genes were performed with Metascape.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.22.349951: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals and in vivo procedures: Animal husbandry and all experimental procedures were approved by the local animal ethics council and were performed in accordance with national and international laws and policies on the protection of animals used for scientific purposes (UE Directive 2010/63/UE; Italian Legislative Decree 26/2014).<br>Consent: SARS-CoV2 microneutralization assay: Human sera derived from post-convalescent COVID-19 patients after signing of an informed consent, in the frame of a project aimed at following up patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HA tag, derived from the human influenza hemagglutinin protein, and composed of a 9-amino acid peptide sequence, Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala, was fused downstream of the last SARS-CoV2 S aa (Thr1273) flanked at its 5’ and 3’ side by a Gly and a Ser, respectively, to facilitate antigen expression detection by the widely commercially available HA antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human influenza hemagglutinin protein ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cells were blocked at the indicated time points with ice-cold methanol, incubated with Anti-Hexon primary antibody (Abcam) followed by detection with secondary anti-Mouse IgG Peroxidase (Sigma) and Vector NovaRED substrate kit for peroxidase (Vectorlabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Hexon</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG Peroxidase ( Sigma )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50ug of clarified lysates were loaded onto 4-12% acrylamide gel (Thermo Fisher), transferred onto iBlot 2 NC Mini Stacks membranes (Invitrogen) and incubated with the anti-HA (Abcam) or anti-RBD (Sino Biological) primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of the SARS CoV-2 spike protein was achieved by incubation with an anti-rabbit (Sigma) secondary antibody, followed by ECL (Invitrogen) incubation, and images were taken using a Chemidoc (Biorad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with Live/Dead fixable dye (Invitrogen); recombinant human His-tagged ACE-2 protein (RayBiotech) was incubated on cells before adding any antibodies, then detected with anti-His antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was detected with goat anti-mouse IgG mAb conjugated with AlexaFluor 647 fluorochrome (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief: optimized amount of proteins in 100μl volume were bound to Ni-NTA plates/strips for 1h at 25°C in shaking (1 μg/ml for full length Spike, 2 μg/ml for R121, 0.5 μg/ml for RBD); plates were then incubated with serial dilutions of sera for 2h at 25°C in shaking, then binding was detected with specific alkaline phosphatase-conjugated secondary antibodies (anti-mouse total IgG and anti-monkey total IgG from Sigma and anti-mouse IgG1 and IgG2a from BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse total IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-monkey total IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot: For ELISpot assays, MSIP 96 well plates were from Millipore (Multiscreen filter plates) and anti-mouse or anti-monkey IFNγ or IL4 capture and detection antibodies were all from U-CyTech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-monkey IFNγ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were plated at 1×106 per well in a 96-well round bottom plate and stimulated with either SARS-CoV-2 peptide pool S1 or S2, or with DMSO as negative control, all in presence of anti-CD28 antibody, for 18h (mouse cells) or 5h (monkey cells) in the presence of Brefeldin-A (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD28</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse Antibodies: CD3 AlexaFluor647, CD4 BV421, CD8 BUV395, IL-17a PerCP-Cy 5.5, IFNγ BV650, IL2 APC-R700 (from BD Biosciences), IL-4 PE, IL-13 PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (BD Biosciences Cat# 563795, RRID:AB_2722501)</div></div><div style="margin-bottom:8px"><div>IL-17a</div><div>suggested: (BioLegend Cat# 506930, RRID:AB_2686975)</div></div><div style="margin-bottom:8px"><div>PerCP-Cy</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-13 PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NPH Antibodies: CD3 AF700, CD4 PerCP-Cy 5.5, CD8 PE (from BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (SouthernBiotech Cat# 8200-27, RRID:AB_2796424)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered material was inoculated into monolayers of A549 cultivated in DMEM completed with 10</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 8×104 HEK293 cells per well were seeded in 96 well plates the day before the assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells infection and S2/ACE2 staining: HeLa cells were plated at 5×105 cells/well in 6-well plates two days prior infection to allow adhesion, then infected with GRAd vectors at multiplicity of infection (MOI) of 150 for 48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA assay on mouse sera were performed with His-tagged SARS-CoV-2 full length Spike protein (produced in baculovirus, SinoBiological), while ELISA with monkey sera were performed with a trimeric his-tagged stabilized SARS-CoV-2 Spike protein produced in-house in Expi293 cells or with a commercial RBD (ACROBiosystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 1.5 × 106 HEK293T cells were seeded overnight in a 10 cm diameter Primaria-coated dish (Corning).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infectivity and neutralization assays, either 1.5×104 HuH7 cells or 2×104 VeroE6 cells/well were plated in white 96-well tissue culture plates (Corning) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuH7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum from naïve BALB/c animals are routinely tested at 1:100 dilution as negative control in ELISA, and the resulting OD is nearly at the level of secondary Ab alone, therefore for mouse experiments baseline titers cannot be detected, calculated and plotted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Group C adenovirus assignment for GRAd32 was based on a phylogenetic analysis of aligned adenoviral polymerase sequences using a bootstrap-confirmed Maximum Likelihood tree (500 replicates) calculated with MEGA 10.1.7 (21)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polymerase sequences were aligned with MUSCLE (23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample acquisition was performed on a LSR Fortessa-X20 cytofluorimeter (BD biosciences) and sample analysis was performed with FlowJo (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV2 microneutralization assay: Human sera derived from post-convalescent COVID-19 patients after signing of an informed consent, in the frame of a project aimed at following up patients.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">: GraphPad Prism version 8 for Windows (GraphPad Software, San Diego, California, USA) was used for graphs and statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04528641</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">GRAd-COV2 Vaccine Against COVID-19</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.28.359836: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was reviewed and accepted by the animal study review committee (SRC) and conducted in accordance with IACUC guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster challenge experiments: Female Syrian golden hamsters were obtained from Charles River Laboratories at 6 weeks of age.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multi-Array 96-well plates (cat# L15XA-3, Meso Scale Discovery (MSD)) were coated with mouse anti-human IgG antibody (CH2 domain, cat# MA5-16929, ThermoFisher Scientific) at 2 μg/mL in 1X PBS (50μL/well), sealed, and incubated overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-16929, RRID:AB_2538406)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed 3X with 1X washing solution and 50 μL of Sulfo-Tag anti-human/NHP IgG antibody (cat no# D20JL-6, lot no# W0019029S, MSD), at 1/1,000 dilution in Blocker™ Casein in PBS was added to each well and plates were then incubated for 1-1.5 hours at room temperature on an orbital shaker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human/NHP IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody treatments were administered IV with monoclonal antibodies (mAbs) against SARS-CoV-2 Spike, or isotype control mAb in up to 350 μL of formulation buffer to anesthetized animals at 12 hours-post inoculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pharmacokinetic Study: Female CD-1-IGS (strain code #022) were obtained from Charles River Laboratories at 6-8 weeks of age.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1-IGS</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pharmacokinetic analysis of the collected ELISA data was performed with the Phoenix WiNnonlin suite of software (version 6.4, Certara) using a non-compartmental approach consistent with an IN bolus route of administration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phoenix</div><div>suggested: (Phoenix, RRID:SCR_003163)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.20.346916: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The use of human materials was approved by the local medical ethical committee (MEC approval: 2014-414).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Order of these peptides was randomized, when synthesized on mini-cards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the peptide arrays were incubated with a 1/1000 dilution of an appropriate antibody peroxidase conjugate (goat anti-human HRP conjugate, Southern Biotech, cat. no.: 2010-05 or goat anti-lama HRP conjugate, Abcore, cat. no. AC15-0354) for 1 h at 25°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human HRP</div><div>suggested: (SouthernBiotech Cat# 2010-05, RRID:AB_2795564)</div></div><div style="margin-bottom:8px"><div>anti-lama</div><div>suggested: (Acris Antibodies GmbH Cat# AM39052SU-N, RRID:AB_11216596)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding to the peptides was determined using a goat anti-human IgG HRP conjugate (ITK Southern Biotech) for 1 h at RT and tetramethylbenzidine substrate (BioFX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The potent neutralizing anti-MERS-S1 control antibody 7.7G6 43 and an isotype matched negative control mAb were taken along as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MERS-S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike ectodomains were stably produced in Drosophila S2 cell line, as previously described 28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antibodies were purified using Protein A sepharose (IBA) according to the manufacturer’s instruction. mAb 1.6C7 and 7.7G6 used in the animal experiments were produced in Chinese hamster ovary (CHO) cells as previously described 61.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chinese hamster ovary ( CHO )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, HEK-293T cells at 70~80% confluency were transfected with the pCAGGS expression vectors encoding full-length MERS-S, SARS-S, SARS2-S or OC43-S with a C-terminal cytoplasmic tail truncation to increase cell surface expression levels.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped VSV virus were titrated on monolayer African green monkey kidney VeroCCL81 cells (MERS-S pseudotyped VSV)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroCCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the virus neutralization assay, serially diluted mAbs were pre-incubated with an equal volume of virus at RT for 1 h, and then inoculated on Vero/HRT-18 cells, and further incubated at 37℃.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero/HRT-18</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was then added to Huh-7 cells (MERS-CoV) or VeroE6 cells (SARS-CoV and SARS-CoV-2) and incubated for 1 hr, after which the cells were washed and further incubated in medium for 8 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 cells were seeded one day before reaching a confluency of 70-80%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a second experiment, the prophylactic efficacy of mAb 28D9 was tested against MERS-CoV and SARS-CoV infection in the K18 TghDpp4 mouse model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TghDpp4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">proteins: Coronavirus spike ectodomains of MERS-CoV (residues 19–1262; strain EMC; GenBank accession number (GB): YP_009047204.1), SARS-CoV (residues 15–1182; strain Urbani; GB: AY278741.1), MHV (residues 15–1231; strain A59; UniProt accession number: P11224) and the S2 ectodomain of MHV (residues 718–1252; strain A59; UniProt accession number: P11224) fused with a C-terminal T4/GCN4 trimerization motif, a thrombin cleavage site and a Strep-tag purification tag were cloned in-frame into pMT\Bip\V5\His expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximum effective concentration (EC50) binding values were calculated by 4-parameter logistic regression on the binding curves using GraphPad Prism version 7.04.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were analysed by FlowJo (version 10) and percentage of GFP+Alexa Fluor 594+ cells over GFP+ cells were calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentrations (IC50) were determined using 4-parameter logistic regression (GraphPad Prism v7.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.30.177097: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD polyclonal antibody and monoclonal antibody (MAb) 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the corresponding secondary antibodies, horseradish peroxidase (HRP)-conjugated anti-human IgG1 (Abcam, USA) or HRP-conjugated anti-mouse IgG (Sigma, USA), were added and incubated at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vectors were transiently transfected into HEK293F cells using polyethylenimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD polyclonal antibody and monoclonal antibody (MAb) 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The movies were recorded on a K2 Summit direct electron detector (Gatan) operated in the super-resolution mode (yielding a pixel size of 1.02 Å after 2 times binning), under low-dose condition in an automatic manner using SerialEM (Mastronarde, 2005).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All images were aligned and summed using MotionCor2 software (Zheng et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For class 1, after further 2D classification, we refined the 24,502 cleaned up particles into a S-open map at 6.0 Å resolution using non-uniform refinement in CryoSparc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSparc</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 associated with the up RBD was subtracted and refined in Relion to obtain a more 8.4 Å map with better connectivity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the missing loop regions in S1 subunit, we either built the homology model based on SARS-CoV S structure (PDB: 6CRW) (Kirchdoerfer et al., 2018) through SWISS-MODEL webserver (Waterhouse et al., 2018), or built the loop manually according to the density in COOT (Emsley and Cowtan, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the FP region, we first built the homology model by Modeller tool within Chimera by using MERS-CoV S structure (PDB: 6NB3) as template (Pettersen et al.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then refined the combined model against our 3.8 Å resolution SARS-CoV-2 S-ACE2 map using Rosetta and Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interaction surface analysis was conducted by PISA server (Krissinel and Henrick, 2007).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.26.356048: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work relating to SCoV2 live virus and SCoV2-RNA was conducted in the BSL-3 facility of the Cleveland Clinic Florida Research and Innovation Center in accordance with institutional biosafety committee (IBC) regulations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and other reagents: Primary antibodies used in this study include anti-GST (1:5,000; Sigma-Aldrich), anti-V5 (1:5,000, R960-25; Novex), anti-FLAG (M2, 1:2,000; Sigma-Aldrich), anti-HA (1:3,000, HA-7; Sigma-Aldrich), anti-Phospho-IRF-3 (Ser396) (1:1,000, D6O1M; CST), anti-IRF3 (1:1,000, D6I4C; CST), anti-Phospho-STAT1 (Tyr701) (1:1,000, 58D6; CST), anti-IFIT1 (1:1,000, PA3-848; Invitrogen and 1:1,000, D2X9Z; CST), anti-IFIT2 (1:1,000; Proteintech), anti-ISG15 (1:500, F-9; Santa Cruz), anti-MAVS (1:1,000; CST), anti-RIG-I (1:2,000, Alme-1; Adipogen), anti-MDA5 (1:1,000, D74E4; CST), anti-Phospho-MDA5 (Ser88)7, anti-PP1α (1:2,000; Bethyl laboratories), anti-PP1γ (1:2,000; Bethyl laboratories), anti-USP18 (1:1000, D4E7; CST), anti-RSAD2 (1:1,000, D5T2X; CST), anti-PKR (1:1,000, D7F7; CST), anti-MX1 (1:1,000, D3W7I; CST), anti-IFITM3 (1:1,000, D8E8G; CST), anti-ISG20 (1:1,000, PA5-30073; Invitrogen), anti-ubiquitin (1:1,000, P4D1; Santa Cruz), anti-NS36, anti-PLpro (Nsp3) (1:1,000, GTX135589; GeneTex), anti-β-tubulin (1:1,000; CST), and anti-β-Actin (1:1,000, C4; Santa Cruz)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GST</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Phospho-IRF-3 ( Ser396 )</div><div>suggested: (Cell Signaling Technology Cat# 29047, RRID:AB_2773013)</div></div><div style="margin-bottom:8px"><div>anti-IRF3</div><div>suggested: (Cell Signaling Technology Cat# 11904, RRID:AB_2722521)</div></div><div style="margin-bottom:8px"><div>anti-Phospho-STAT1 ( Tyr701 )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFIT1</div><div>suggested: (Antibodies-Online Cat# ABIN485037, RRID:AB_10847629)</div></div><div style="margin-bottom:8px"><div>anti-IFIT2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ISG15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAVS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RIG-I</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Phospho-MDA5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PP1α</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PP1γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-USP18</div><div>suggested: (Cell Signaling Technology Cat# 4813, RRID:AB_10614342)</div></div><div style="margin-bottom:8px"><div>anti-RSAD2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PKR</div><div>suggested: (Cell Signaling Technology Cat# 12297, RRID:AB_2665515)</div></div><div style="margin-bottom:8px"><div>anti-MX1</div><div>suggested: (Cell Signaling Technology Cat# 37849, RRID:AB_2799122)</div></div><div style="margin-bottom:8px"><div>anti-IFITM3</div><div>suggested: (Cell Signaling Technology Cat# 59212, RRID:AB_2799561)</div></div><div style="margin-bottom:8px"><div>anti-ISG20</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-30073, RRID:AB_2547547)</div></div><div style="margin-bottom:8px"><div>anti-ubiquitin</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-8017, RRID:AB_628423)</div></div><div style="margin-bottom:8px"><div>anti-NS36</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PLpro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Nsp3</div><div>suggested: (GeneTex Cat# GTX135589, RRID:AB_2887501)</div></div><div style="margin-bottom:8px"><div>anti-β-tubulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-Actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-IFNAR2 neutralizing antibody (1:250, MMHAR-2) was obtained from PBL Assay Science.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFNAR2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-flavivirus E antibody (4G2) was purified from the mouse hybridoma cell line D1-4G2-4-15 (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Monoclonal anti-flavivirus E antibody</div><div>suggested: (Absolute Antibody Cat# Ab00230-2.0, RRID:AB_2715504)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse and anti-rabbit HRP-conjugated secondary antibodies (1:2,000) were purchased from CST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit HRP-conjugated secondary antibodies ( 1:2,000 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lysates were precleared with Protein G Dynabeads (Invitrogen) at 4°C for 2 h and then incubated with Protein G Dynabeads conjugated with the anti-MDA5 antibody or an IgG1 isotype control (G3A1; CST) at 4°C for 4 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MDA5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>an IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently permeabilized with 1× BD Perm/Wash buffer (BD Biosciences) for 15 min and incubated with an anti-flavivirus E antibody (4G2; 1:100 in 1× BD Perm/Wash buffer) at 4°C for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flavivirus E</div><div>suggested: (Absolute Antibody Cat# Ab00230-2.0, RRID:AB_2715504)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were further washed three times with 1× BD Perm/Wash buffer and incubated with a goat anti-mouse Alexa Fluor 488-conjugated secondary antibody (#A10667, 1:500 in 1× BD Perm/Wash buffer; Invitrogen) at 4°C for 30 min in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-10667, RRID:AB_2534057)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-hACE2 and Vero-E6-hACE2 were a gift from Jae U.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-hACE2 were kindly provided by Benjamin R. tenOever (Icahn School of Medicine at Mount Sinai)4. HEK293T, HEK293, HeLa, MEFs, NHLFs, Vero, A549-hACE2, and BHK-21 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-hACE2 and Vero-E6-hACE2 were maintained in DMEM containing 200 μg/mL hygromycin B and 2 μg/mL puromycin respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SVGA and HAP-1 cells were cultured in Eagle’s Minimum Essential Medium (MEM, Gibco) and Iscove’s Modified Dulbecco’s Medium (IMDM, Gibco), respectively, supplemented with 10% FBS and 100 U/mL penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HAP-1</div><div>suggested: RRID:CVCL_5G07)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C6/36 cells were cultured in MEM with 10% FBS and 100 U/mL penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C6/36</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jung (Cleveland Clinic Lerner Research Center) and was propagated in Vero E6-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, MDA5-2CARD and its K23R/K43R mutant were subcloned into pcDNA3.1(-) harboring an N-terminal 3×FLAG tag between NheI and NotI. pCR3-FLAG-MV-V (strain Schwarz) was a gift from Karl-Klaus Conzelmann (LMU, Munich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5-2CARD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-flavivirus E antibody (4G2) was purified from the mouse hybridoma cell line D1-4G2-4-15 (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>D1-4G2-4-15</div><div>suggested: BCRJ Cat# 0268, RRID:CVCL_J890)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transfected with GST or GST-MDA5-2CARD, and the cells were collected at 48 h post-transfection and lysed in Nonidet P-40 (NP-40) buffer [50 mM HEPES (pH 7.4), 150 mM NaCl, 1% (v/v) NP-40, 1 mM EDTA, and 1× protease inhibitor cocktail (Sigma)]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay (ELISA): Human or mouse IFN-β in the culture supernatants of NHLFs, HeLa, and MEFs was determined by ELISA using the VeriKine Human Interferon Beta ELISA Kit or VeriKine Mouse Interferon Beta ELISA Kit (PBL Assay Science) as previously described7. siRNA- and shRNA-mediated knockdown: Transient knockdown in NHLFs, HeLa, HAP-1, HEK293T, and HEK293 cells was performed using non-targeting or gene-specific siGENOME SMARTpool siRNAs (Dharmacon).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T or MDA5 KO HEK293 cells were transfected with IFN-β luciferase reporter construct and β-galactosidase (β-gal) expressing pGK-β-gal, along with GST-MDA5-2CARD (WT or mutants) or FLAG-MDA5 (WT or mutants).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5 KO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mock-RNA and SCoV2-RNA were produced by isolating total RNA from uninfected or SCoV2-infected (MOI 1 for 24 h) Vero-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The titers of ZIKV were determined by plaque assay on Vero cells as previously described6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: To quantify the percentage of DENV-infected cells, reconstituted HEK293 MDA5 KO cells were washed with PBS (Gibco) and fixed with 4% (v/v) formaldehyde in PBS at room temperature for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus protection assay: The culture supernatants from mutant or WT EMCV-infected NHLFs or RIG-I KO HEK293 cells were UV-inactivated in a biosafety cabinet under a UV-C lamp (30W) at a dose of 5,000 μJ/cm2 for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Complete inactivation of EMCV was confirmed by plaque assay on BHK-21 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transfected with GST or GST-MDA5-2CARD, and the cells were collected at 48 h post-transfection and lysed in Nonidet P-40 (NP-40) buffer [50 mM HEPES (pH 7.4), 150 mM NaCl, 1% (v/v) NP-40, 1 mM EDTA, and 1× protease inhibitor cocktail (Sigma)]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigma</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.31.363044: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Photoconjugation: Cardiac Troponin I antibodies 19C7 (4T21) and 4C2 (4T21), and C-reactive protein antibodies C6 (4C28cc) and C135 (4C28) were obtained from Hytest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C-reactive protein antibodies C6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C135</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-adalimumab/TNFα monoclonal antibody (HCA207) and anti-infliximab (HCA213) were obtained from BioRad.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-adalimumab/TNFα</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-infliximab (HCA213</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-COV-2 antibodies 47D11 and 49F1 were produced in HEK-293T cells and purified using Protein-A affinity chromatography as described previously44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-COV-2 spike trimer protein was expressed in HEK-293T cells with a C-terminal trimerization motif and Strep-tag using the pCAGGS expression plasmid, and purified from the culture supernatant by Strep-Tactin chromatography as described previously44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For lentiviral production of the two vectors, encoding either the RBD-LB or RBD-SB transgene, HEK293T cells (ATCC® CRL-3216™) were transiently co-transfected with the abovementioned transfer vectors, as well as the VSV-G envelope (pMD2.G) and packaging plasmids (pCMVR8.74), as previously described58.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.29.361287: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">CDR2 was randomized in stage one, PCR templates at this stage were equal molar mixtures of plasmids carrying DNA encoding frames, including three frame1 versions, one frame2, three frame3 versions and one frame4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) with anti-Flag antibody (Sigma-Aldrich, F1804), then incubating antibody-coated beads with cell lysate or cell media containing 3xFlag tagged target proteins at 4°C for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For anti-Myc selection, magnetic beads were coated by anti-Myc antibody (ThermoFisher Scientific, 13-2500) only.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with wash buffer, HRP conjugated anti-His tag secondary antibody (BioLegend, 652503) diluted 1:2000 in blocking buffer was then added to the plates and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag secondary antibody ( BioLegend , 652503</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T ACE2 were a kind gift of Michael Farzan.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed once with PBST (PBS, ThermoFisher Scientific, with 0.02% TritonX-100), a 1:1 mixture of HEK293T cell culture media containing secreted RBD-3xFlag and blocking buffer (PBST with 1% nonfat dry milk) was added to the plates and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medium was then removed from HEK293T ACE2/TMPRSS2 cells and replaced with 150 μl of the VHH + pseudotyped lentivirus solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">psPAX2 and pCMV-VSV-G were previously described 20. pTRIP-SFFV-EGFP-NLS was previously described 21 (a gift from Nicolas Manel; Addgene plasmid # 86677; http://n2t.net/addgene:86677; RRID:Addgene_86677). cDNA for human TMPRSS2 and Hygromycin resistance gene was obtained by synthesis (IDT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_86677)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CDR-directed clustering analysis: Computational analysis for CDR-directed clustering was performed using custom python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage GFP was quantified on a Cytoflex LX (Beckman Coulter) and data were analyzed with FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.11.09.374603: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Lung tissue samples from eight different healthy donors and nasal tissue samples from one healthy donor and one patient with chronic rhinosinusitis with nasal polyps were obtained under the approval of the ethical committee from the University Hospital Leuven (UZ Leuven Biobanking S51577 and S59864).<br>Consent: All patients were adult and provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies were mouse anti-V5 tag [Invitrogen, R960-25, 1:2000 (SARS-1-S, MERS-S and SARS-2-S) or 1:5000 (229E-S)] and mouse anti-β-actin (Sigma-Aldrich, A5447, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>SARS-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>229E-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A5447</div><div>suggested: (ABclonal Cat# A5447, RRID:AB_2766249)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibody, we used a peroxidase-coupled goat anti-mouse antibody (Dako, P0447, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Agilent Cat# P0447, RRID:AB_2617137)</div></div><div style="margin-bottom:8px"><div>P0447</div><div>suggested: (Agilent Cat# P0447, RRID:AB_2617137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were heated for 5 min at 95°C and subjected to SDS-PAGE and immunoblotting, as above, with mouse anti-V5 tag (Invitrogen, R960-25) and mouse anti-MLV p30 antibody (Abcam, ab130757) as primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R960-25</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>anti-MLV p30</div><div>suggested: (Creative Diagnostics Cat# DCABH-2412, RRID:AB_2476319)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, media and compounds: Calu-3 (ATCC HTB-55) cells were grown in minimum essential medium (MEM) supplemented with 10% fetal calf serum (FCS), 0.1 mM non-essential amino acids, 2 mM L-glutamine, and 10 mM HEPES.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells (HCL4517; Thermo Fisher Scientific) and Vero E6 (ATCC CRL-1586) were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FCS, 1 mM sodium pyruvate, 0.075% sodium bicarbonate and (only for Vero E6) 0.1 mM non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were then transduced into receptor- and TMPRSS2-transfected HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using GraphPad Prism (version 8.4.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04455815</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial Looking at the Use of Camostat to Reduce Progression…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04321096</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Impact of Camostat Mesilate on COVID-19 Infection</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04353284</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Camostat Mesylate in COVID-19 Outpatients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04355052</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Open Label Study to Compare Efficacy, Safety and Tolerabilit…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04374019</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Novel Agents for Treatment of High-risk COVID-19 Positive Pa…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.25.115618: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: Human ACE2 (his tag) (10108-H08H), ACE2 rabbit Antibody (10108-RP01), goat anti-Rabbit/HRP secondary antibody (SSA004, and SARS-CoV-2 (2019-nCoV) and RBD of spike glycoprotein (mFC tag)(40592-V05H) were purchased from Sino Biological (Beijing,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Rabbit/HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SSA004</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>2019-nCoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>40592-V05H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody/HRP (1:5000 dilution) in 5% BSA was incubated 37°C for 0.5 h followed by washing for three times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody/HRP</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.11.13.381533: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Donors: This study was approved by the Harvard Medical School Office of Human Research Administration Institutional Review Board (IRB20-0365) as was the use of healthy donor control blood (IRB19-0786).<br>Consent: We received informed, written consent from a healthy adult male participant (C1) who recovered from confirmed SARS2-CoV-2 infection, with mild illness not requiring hospitalization, five weeks before blood donation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We received informed, written consent from a healthy adult male participant (C1) who recovered from confirmed SARS2-CoV-2 infection, with mild illness not requiring hospitalization, five weeks before blood donation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times and resuspending the cells, we added anti-IgG-APC antibody (BD Biosciences), anti-CD19-FITC antibody (BD Biosciences), and streptavidin-PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-093-194, RRID:AB_1036183)</div></div><div style="margin-bottom:8px"><div>anti-CD19-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We detected bound antibody with horseradish peroxidase (HRP)-coupled anti-human (Fc) antibody (Sigma Aldrich catalog number A0170).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human (Fc)</div><div>suggested: (Sigma-Aldrich Cat# A0170, RRID:AB_257868)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: We maintained HEK293T cells (ATCC CRL-11268) in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A HEK293T-hACE2 stable cell line was a gift from Huihui Mou and Michael Farzan and an Expi293F-His6-tagged SARS-CoV-2 S2P stable cell line that expresses a gift from Bing Chen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2P</div><div>suggested: RRID:CVCL_2H49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A T225 flask of VeroE6 cells was inoculated with 90 μl starting material in 15 ml DMEM containing 2% (v/v) of heat inactivated FBS (HI-FBS) and incubated in a humidified incubator at 37 °C with periodic rocking for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For crystallography, we produced the protein by PEI transfection of GnTI-/- HEK293S cells grown in suspension or HEK293T cells grown in suspension and also in presence of kifunensine (5 μM), purified by nickel affinity purification, and removed the His6-tag by TEV digestion followed by reverse nickel affinity purification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times and resuspending the cells, we added anti-IgG-APC antibody (BD Biosciences), anti-CD19-FITC antibody (BD Biosciences), and streptavidin-PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used IMGT/V-QUEST31 (http://www.imgt.org) to analyze IgG gene usage and the extent of variable segment somatic hypermutation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diffraction data were indexed and integrated using XDS (build 202 00131)36 and merged using AIMLESS (v0.5.32)37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIMLESS</div><div>suggested: (AIMLESS, RRID:SCR_015747)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structure of C1A-B12 Fab:RBD (space group P212121) was determined by molecular replacement using Phaser (v2.8.3)38, with coordinates for the B38 Fab variable domain, constant domain and RBD (PDB ID: 7BZ5) (Wu et al., 2020) used as search models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed iterative model using O39 and refinement in Phenix (v1.18.2-3874)40 and Buster (v2.10.3)41, during which we also built alternative conformations where density was apparent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During refinements, we updated TLS groups calculated using Phenix40 and a python script, as well as occupancy restraints calculated in Buster.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural Analysis: We analyzed the structures and generated figures using PyMOL (Schrödinger)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.11.06.370676: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five fields for microscopic analysis were randomly selected in each treated group, the numbers of fused and unfused EGFP positive cells were counted.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of recombinant SARS-CoV-2 spike RBD, human ACE2 and antibodies: The DNA sequences of codon-optimized SARS-CoV-2 spike Receptor Binding Domain (S-RBD) and human ACE2 extracellular domain (hACE2-ECD) were cloned into a pFuse-Fc expression vector (Invivogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human ACE2 extracellular domain ( hACE2-ECD )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA sequences for the variable regions of the combinatorial antibodies were cloned into a full-length human IgG4 mutant construct (S228P) and expressed in HEK293F cells for 4 days and further purified by Mabselect chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S228P</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A solution containing the secondary antibody, anti-M13 bacteriophage antibody conjugated with HRP (dilution factor 1 : 5000; Sino Biological, #11973-MM05T-H), was added into the above plates (150 μL/well) and incubated at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M13</div><div>suggested: (LSBio (LifeSpan Cat# LS-C71922-5000, RRID:AB_10636908)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant hACE2-ECD was coated in PBS buffer at 2 ng/μL, 100 μL per well at 4 °C overnight, washed with PBS once, then blocked with 3% BSA in PBS. Biotinylated S-RBD (hFc tag removed by thrombin digestion) at a final concentration of 50 nM was incubated with 2-fold serial diluted S-B8, S-D4, and S-E6 antibodies (from 1 - 133 nM) at 4 °C for 30 min, in which an IgG4e1 isotype antibody was used as the negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-D4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interaction of antibodies with cell surface expressed spike by FACS: In a flow-cytometry binding experiment, the spike protein of either full-length SARS-CoV-2 or SARS, which was conjugated with P2A-EGFP, was transiently transfected into a HEK293T cell.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P2A-EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike protein expressing cells (50000 cells per tube) were then incubated with different anti-S-RBD antibodies for 20 min at 4 °C, and washed with 1 mL ice-cold FACS buffer, spun, and re-suspended in a 100 μL ice-cold FACS buffer containing the Alexa555 conjugated secondary antibody that recognizes human Fc (1 : 800 v/v dilution, Life technology, # A21433).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The co-cultures of cells were cultivated in a DMEM medium with 10% FBS, and treated with or without anti-SARS-CoV-2 spike antibodies at indicated concentrations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Autoreactivity assay: The autoreactivity assay was performed using a HEp-2 anti-nuclear antibodies (ANA) kit (Medical & Biological Laboratories Co., Ltd, #4220-12CN) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nuclear</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>#4220-12CN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing twice (5 min each), the FITC-conjugated secondary anti-human antibody was incubated with the cells for 20 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: The Vero cell line (ATCC® CCL-81™) was maintained in a DMEM/F-12k media (Gibco, #C11330500CP) containing 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For establishing the HEK293T/hACE2 stable cell line, HEK293T cells (ATCC® ACS-4500™) were transiently transfected with hACE2 fusion BFP encoding PB510 plasmid using PiggyBac Transposon System (System Biosciences, PB210PA-1), followed by addition of 2 μg/mL puromycin 6 h post-transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# ACS-4500, RRID:CVCL_4V93)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S-RBD-hFc and hACE2-ECD-mFc proteins were heterologously expressed in HEK293F cells by transient transfection and cultured for 4 days, then purified by Mabselect columns (Cytiva, #17-5199-01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HEK293T/hACE2 cells were first seeded into 96-well white bottom plates at a density of 1×104/well, and cultivated overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 35 μL of 0.1 mg/mL antibodies were loaded to the wells in a slide pre-seeded with fixed and permeabilized HEp-2 cells and incubated for 20 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEp-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">http://www.imgt.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org/</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using four-parameter logistic regression (Hill equation) in GraphPad Prism 8.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (47) and PHENIX (48), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epitope and paratope residues, as well as their interactions, were identified by using PISA program (49) with buried surface area (BSA >0 Å2) as the criterion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.11.21.392753: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines: VeroE6 and A549 cells were obtained from American Type Culture Collection (ATCC) and tested at regular intervals for mycoplasma contamination.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three times washing with PBS, bound primary antibody was detected with a secondary antibody (anti-mouse IgG), conjugated to horseradish peroxidase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This Heidelberg strain was passaged in VeroE6 cells, aliquoted and stored at −80° C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: VeroE6 and A549 cells were obtained from American Type Culture Collection (ATCC) and tested at regular intervals for mycoplasma contamination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus stocks were produced by transfection of HEK293T cells with a pWPI plasmid encoding for TMPRSS2 and the pCMV-Gag-Pol and pMD2-VSV-G packaging plasmids (kind gifts from D. Trono, Geneva).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all other assays, A549+ACE2 cells were cultured in Roswell Park Memorial Institute (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549+ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PLpro expression and purification: For cloning of PLpro with an N-terminal 6xHis-SUMO1 tag, synthetic fragments of the Nsp3 coding sequence derived from the original Wuhan strain were purchased from BioCat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analyzed using GraphPad Prism (v8.4)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Densitometric analysis of protein bands on gels was performed using ImageJ (v1.52p)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The LC-MS systems used was either a Thermo Fisher Finnigan Surveyor Plus equipped with an Agilent Zorbax 300SB-C18 column (3.5 μm, 3.0 × 150 mm) coupled to a Finnigan LTQ mass spectrometer or an Agilent 1100 Series HPLC equipped with a Luna 4251-E0 C18 column (3 μm, 4.6 x 150 mm) coupled to a PE SCIEX API 150EX mass spectrometer (wavelengths monitored = 220, 254 and 646 nm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Finnigan Surveyor Plus</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04535167</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">First-In-Human Study To Evaluate Safety, Tolerability, And P…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.01.406934: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Donors & Ethics: Donors were recruited in accordance with the laws of Switzerland and under ethics approval BASEC-2016-01260 of the Cantonal Ethics Commission of Zurich.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were weighed prior to the start of the study and randomly distributed in the different cohorts.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In Vivo experiments (hamster): A total of 56 Golden Syrian hamsters, 36 male and 20 female, weighing between 80g and 130g were used in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of antibodies was detected using a fluorescence labeled anti human IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound ACE2 was then detected using a fluorescence labeled anti His Tag antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti His Tag antibody.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative control/isotype control antibody (mAb24C3) is a human-derived antibody specific for tetanus toxoid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mAb24C3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This sort yielded RBD-specific-antibody-expressing HEK cell clones.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of SARS-CoPsV-2: HEK293T cells stably expressing full length huACE2 (aa1-805) were seeded and left to adhere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of wild type SARS-CoV-2: At day 0, Vero E6 cells were seeded with a concentration of 1*105 cells/well in 300 μl medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As control cells non-transfected HEK293T and Raji B cells were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Raji B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were expressed in HEK293 cells after gene synthesis of the variable regions and linkage to the same constant region derived from human IgG1 (Trastuzumab) as COVAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed and IC50 values were determined using the “log [Inhibitor] vs. normalized response -- Variable slope” fitting model of GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A caveat for this is the fact that the target cells we used were stably transfected cells that may or may not mimic the in vivo situation in an infected individual. The only experimental evidence for ADCC against corona virus infected cells that we could identify is described in Holmes et al. Br. J. exp. Path. I986. Comparison to benchmark antibodies currently in the clinic: In an attempt to benchmark the virus neutralizing activity of MTX-COVAB to one of its peers, we compared it side-by-side with the two antibodies that form Regeneron’s cocktail (Hansen et al. Science 2020) using our pseudovirus assay. As shown in Figure 5, MTX-COVAB shows a neutralization capacity that is on par with that obtained with the better of the two antibodies as well as with the cocktail.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.13.420406: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For quantification of cell-cell fusion, three fields were randomly selected in each well to count the fused and unfused cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigens and antibodies: The RBD domain of SARS-CoV-2 S protein (His-tag) were synthesized by Prof. Xuefei Cai at Key Laboratory of Molecular Biology for Infectious Diseases (Ministry of Education), Chongqing Medical University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigens</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were incubated with mouse anti-RBD monoclonal antibody (1:1000 dilution) for 1 hour at 37°C, and then washed with PBST five times and incubated with Horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (Abmart, Shanghai, China) for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and cell culture: HEK 293T, A549, and Calu3 cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were co-transfected with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-cell fusion assay: HEK 293T effector cells were transfected with plasmid pAdTrack-TO4-GFP encoding green fluorescent protein (GFP) or pS-G614 encoding the corresponding SARS-CoV-2 S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional analysis of Ca2+ in pseudovirus infectivity: 293T-ACE2 cells were seeded in 96-well plate (2×104 cells/well) and incubated at 37 °C for 8h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In short, HEK 293T-ACE2 cells were assigned to 96-well plates (4×104 cells/well) and cultured for 24 hours at 37 °C with 5 μM compounds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytopathic effect (CPE) assay and quantification of SARS-CoV-2 infection: Vero E6 cells were dispensed into 96-well plate (4.0×104 cells/well), pre-treated with medium containing compounds or DMSO for 1 hour at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Data were analyzed using GraphPad Prism version 6.0 software and were presented as means ± SD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.18.423418: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a parallel experiment, the wells were washed and then incubated with polyclonal rabbit anti-human SP-D primary antibody (0.5 μg/ml) (1:5000) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human SP-D</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next day, the wells were washed and then incubated with anti-sheep IgG-HRP antibodies or anti-His antibodies (Genetex, GTX628914, 0.5 μg/ml) (1:2000) for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-sheep IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of RBD binding, the wells were further incubated with anti-mouse IgG antibody (Abcam, ab6728, 0.5 μg/ml) (1:2000) for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab6728, RRID:AB_955440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following PBS washes, the cells were probed with goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody linked to Alexa Fluor 647 (Thermo Fisher Scientific) (0.6 μl/100 μl per tube) for 1 h at room temperature in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For binding experiments using rfhSP-D, SARS-CoV-2 S1 protein containing a C-terminal His-tag (Acro; S1N-C52H3) (5 μg/ml) was tagged with anti-His antibody (Genetex; GT395) (1:100) at 4°C for 1h and followed by pre-incubation with a series of two-fold dilutions of rfhSP-D (10 μg/ml) or mock (cells only) at 4°C for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, coverslips were blocked with 2% w/v BSA for 1h and incubated with ACE2 antibody [SN0754] (1:250) (GeneTex, GTX01160), followed by Goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody (1:500) (Thermo Fisher Scientific) for 1 h at room temperature in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-32307, RRID:AB_2809589)</div></div><div style="margin-bottom:8px"><div>GTX01160</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and treatments: Human embryonic kidney (HEK) 293T or HEK293T cells overexpressing ACE2 receptor (HEK293T-ACE2) were cultured in complete Gibco Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% v/v fetal bovine serum (FBS), 100 U/ml penicillin (Sigma-Aldrich) and 100 μg/ml streptomycin (Sigma-Aldrich), and left to grow at 37°C in the presence of 5% v/v CO2 for approximately 48 h before passaging.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were seeded one day before, and then transfected with the indicated plasmids using TransIT®-LT1 transfection reagent (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2 cells (HEK293T cells overexpressing ACE2 receptor) (0.5×105 cells) were preincubated with rfhSP-D (0, 5, 10 and 20 μg/ml) for 24 h and then washed twice with PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: GraphPad Prism 6.0 software was used to generate all the graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.21.423721: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human myocardial samples (right ventricle or atrium) were discarded material from surgical repair of congenital heart defects (ethical approval number 15/LO/1064 from the North Somerset and South Bristol Research Ethics Committee).<br>Consent: Adult patients and paediatric patients’ custodians gave informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies (ACE2, dilution 1:100; CD147, 1:500, 6x-HIS-tag (Invitrogen MA1-21315), 1:1000) were incubated for 16 hrs at 4°C. β-Actin was used as a loading control (Sigma, A5441, 1:10000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>6x-HIS-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>β-Actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>A5441</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where required, cells were incubated with the anti-CD147 neutralizing antibody (20 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD147</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCs were pre-incubated with anti-ACE2 (20 μg/mL, as described before5) or anti CD147 (20 μg/mL) antibodies for 1 hat 37 °C and then exposed to the S protein (500 ng/mL - 2·9 nM) for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti CD147</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot data were analyzed using the ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Data were analyzed using Prism version 8.0 and expressed as individual values and as means ± standard error of the mean.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.19.423584: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, endogenous human NPC1 and HSP90 were purified using immobilized Recombinant Protein G Resin (Generon) and 4 µg of specific antibodies against NPC1 (Abcam, ab108921) or HSP90 (Enzo Life Sciences, ADI-SPA-835) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSP90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After that, plates were washed with PBST (PBS 0.1%Tween20) and the binding of NPC1 to SARS-CoV-2 N protein was detected with a rabbit anti-NPC1 antibody (1:2000), revealed with an anti-rabbit-horseradish peroxidase (HRP) (1:2000) using a colorimetric substrate (OPD) and finally, quantified by absorbance at 492 nm in the EnSight multimode plate reader of PerkinElmer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NPC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit-horseradish peroxidase (HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and viruses: Human embryonic kidney cells 293T/17 (HEK 293T; ATCC-CRL-11268) were cultured in Dulbecco modified Eagle medium (DMEM) at 37 °C and 5% CO2 atmosphere, supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 1X GlutaMAX (Thermo Fisher) and 10% heat-inactivated fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 Lunet C3 cells, a gift from T. Pietschman (Twincore, Germany), were cultured at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 10mM HEPES, 1X NEAA and 10% of heat-inactivated fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lunet C3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of tagged-N protein and EGFP in HEK 293T cells: To transfect HEK 293T cells, four 60mm dishes were seeded with 2.5 ×106 cells each 24 hours prior to transfection in DMEM complete medium described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 cells were pre-treated with compounds at the indicated concentrations in growth medium for 1 h at 33 °C, followed by infection with 229E-GFP at a multiplicity of infection (MOI) of 1 pfu/cell for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the SARS-CoV-2 N with N-terminal EGFP tag (EGFP-N), a codon optimized cDNA sequence for the ORF of SARS-CoV-2 N (NCBI reference sequence number: NC_045512) was cloned into the pEGFP-C1 (by GeneArt-Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneArt-Thermo Fisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of SARS-CoV-2 N protein in the baculovirus system: The sequence of the N protein published in the NCBI database was selected (GenBank accession number: 43740575 / NCBI reference sequence number: NC_045512).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant SARS-CoV-2 N protein produced in pupae was measured by band densitometry with the ChemiDoc™ XRS Gel Imaging System using Image Lab™ software (Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Lab™</div><div>suggested: (Image Lab Software, RRID:SCR_014210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50s values and dose-response curves were estimated using GraphPad Prism v6.0 with a 99% confidence interval.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to determine the percentage of infected cells per condition, 8,000 cells/time point were scored using FACS Canto II flow cytometer (BD Sciences) and analyzed using the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.30.424801: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the cells were washed three times with PBS, incubated with serum free media with primary antibody anti-ACE2 (1:100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Enzo Life Sciences Cat# ALX-804-722-C100, RRID:AB_11180102)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CSNPs-binding, hACE2-overexpressed Hek293 cells were incubated with 10 uM peptide for 1 hour and then treated and incubated with 5 uM SARS-CoV-1 S1 protein-His Tag (AcroBiosystems, S1N-C52H3-100UG, USA) for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hek293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As g_mmpbsa tool is compatible with older versions of GROMACS (versions 5 or lower), the “tpr” files created by GROMACS 2019.6 were recreated through GROMACS 5.1 and used for binding energy calculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Computational tools used in this study: For simple visualization and collecting structural insights of the SARS-CoV-2 spike and ACE2 proteins, free available packages of VMD (61), Pymol (https://pymol.org), and Chimera (62) were utilized.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CSNPs-binding, hACE2-overexpressed Hek293 cells were incubated with 10 uM peptide for 1 hour and then treated and incubated with 5 uM SARS-CoV-1 S1 protein-His Tag (AcroBiosystems, S1N-C52H3-100UG, USA) for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:To overcome this limitation, two research groups have stabilized the α1 helix by increasing the helical bundles and designed peptide biologics that could effectively inhibit SARS-CoV-2 cell entry (44, 45). However, this modification increases the size of these peptides by ~3-4 folds, increasing the cost of synthesis and formulation. We and others have previously used peptide stapling to enhance the target specificity of therapeutic peptides (28, 51). In fact, Fiarlie and his co-workers found that the helical-constrained compounds hold comparatively similar biological potencies in PPI as their parent proteins. They constructed four such compounds and proposed that downsized-constrained peptides could be of great value in biological PPIs and medicine (52). Unfortunately, we could not synthesize the CSNP1 to compare its potency with CSNP2; however, CSNP3 (a relatively shorter version of CSNP1) was unable to bind SARS-CoV-2 S1 (Figure 5). This notion suggests that in addition to the structural integrity, optimum length and the featured pharmacophores are vital for CSNP to bind RBD. Together, we suggest that structure guided computational medicinal chemistry and click chemistry approaches might be useful in designing CSNPs to enhance tethering to their targets. Collectively, we suggest that CSNP2 and CSNP4 are stable peptide that deter the binding of ACE2 and S1 subunit of SARS-CoV-2 and could be potent antidote for COVID-19.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.24.20248821: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Human samples and ethical declaration: Anonymized samples from blood donors (n=100/sampling week) and pregnant women (n=100/sampling week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Human samples and ethical declaration: Anonymized samples from blood donors (n=100/sampling week) and pregnant women (n=100/sampling week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary HRP-conjugated anti-human antibodies were diluted in blocking buffer and incubated with samples for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (from Southern Biotech) and dilutions used: goat anti-human IgG (2014-05) at 1:10,000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2014-05, RRID:AB_2795580)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, we used a logistic regression over anti-RBD and -S training data (from n=595 historical blood donor controls and n=138 SARS-CoV-2 PCR+ individuals across the clinical spectrum) to model the relationship between the ELISA measurements and the probability that a sample is antibody-positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-positive</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD domain (RVQ – QFG) of SARS-CoV-2 was cloned upstream of a Sortase A recognition site (LPETG) and a 6xHIS tag, and expressed in 293F cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro virus neutralisation assay: Pseudotyped viruses were generated by the co-transfection of HEK293T cells with plasmids encoding the SARS-CoV-2 spike protein harboring an 18 amino acid truncation of the cytoplasmic tail2; a plasmid encoding firefly luciferase; a lentiviral packaging plasmid (Addgene 8455) using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped neutralisation assays were adapted from protocols validated to characterize the neutralization of HIV, but with the use of HEK293T-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.29.424482: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h, infected cells were washed four times with DMEM before medium supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant diluted 1 to 50, from CRL-2700, ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, all ectodomains were produced in HEK293F cells grown in suspension using FreeStyle 293 expression medium (Life Technologies) at 37 °C in a humidified 8% (v/v) CO2 incubator rotating at 130 r.p.m.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus was produced by transient transfection of HEK293T cells (ATCC) using linear 25 kDa polyethyleneimine (PEI; Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70∼80% confluency were transfected with the pCAGGS expression vectors encoding full-length OC43 S with a truncation of the 17 C-terminal residues (to increase cell surface expression levels) along with fusion to a flag tag and the Fc-tagged bovine coronavirus hemagglutinin esterase protein at molar ratios of 8:1. 48 h after transfection, cells were transduced with VSVΔG/Fluc (bearing the Photinus pyralis firefly luciferase) (Kaname et al., 2010) at a multiplicity of infection of 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral neutralization, Huh7 cells (for MERS-CoV S pseudotyped virus) or stable 293T cells expressing ACE2 (Crawford et al., 2020) (for SARS-CoV S and SARS-CoV-2 S pseudotyped viruses) in DMEM supplemented with 10% FBS, 1% PenStrep were seeded at 40,000 cells/well into clear bottom white walled 96-well plates and cultured overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_H376)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification of the B6 broadly neutralizing mAb: Ten-week-old CD-1 mice were injected twice with 50 µg of MERS-CoV S formulated with Adjuplex at weeks 0 and 2 and once with 50 µg of SARS-CoV S formulated with Adjuplex at week 8 at the Fred Hutchinson Cancer Research Center Antibody Technology Resource.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MERS-CoV S EM structure in complex with 5-N-acetyl neuraminic acid (PDB 6Q04, residue 18-1224) and the B6-MERS-CoV11 (residue 1230-1240) crystal structure were fit into the cryoEM map.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6-MERS-CoV11</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage of infectivity was calculated as the ratio of luciferase readout in the presence of mAbs normalized to luciferase readout in the absence of mAb, and half maximal inhibitory concentrations (IC50) were determined using 4-parameter logistic regression (GraphPad Prism v8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the high resolution map, particle images were subjected to Bayesian polishing (Zivanov et al., 2019) before performing non-uniform refinement, defocus refinement and non-uniform refinement again in cryoSPARC (Punjani et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CryoEM model building and analysis: UCSF Chimera (Pettersen et al., 2004) and Coot (Emsley et al., 2010) were used to fit atomic models into the cryoEM maps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were analyzed using MolProbity (Chen et al., 2010), EMringer (Barad et al., 2015), Phenix (Liebschner et al., 2019) and privateer (Agirre et al., 2015) to validate the stereochemistry of both the protein and glycan components.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.29.424711: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antigen and control antibodies: For expression of the RBD subdomain of the SARS-CoV-1 (residues Arg306 to Phe527) and SARS-CoV-2 (residues Arg319 to Phe541) spike protein and human ACE2, genes encoding the proteins were synthesised and cloned upstream of either an Fc tag or rCD4-Avi tag, both with an additional 6 × His tag in mammalian expression vectors (37).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phe527</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Phe541</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH and VL sequences of SARS-CoV-2 control antibodies (COV2-2196, COV2-2130, S309, B38, H4, and CR3022) were obtained from the CoV-AbDab database (25) and cloned into pINT3/pINT54 IgG expression vectors (4) as synthetic gene fragments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2-2130</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify unique combinations of heavy CDR3 and light CDR3, antibody frameworks and CDR regions were annotated and analysed using Geneious Biologics (Biomatters).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>light CDR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD-ACE2 blocking assay: Black 96-well immune plates (Thermo Scientific, 10030581) were coated with mouse anti-rCD4 antibody (Bio-Rad, MCA1022R) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rCD4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify antibodies that could block the interaction between RBD and ACE2, the anti-SARS-CoV-2 antibodies were pre-incubated with 2 nM of recombinant ACE2-Fc-His-Biotin for 30 minutes before transferring to the RBD-coated plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification for crystallography studies: The Fab fragments for anti-SARS-CoV-2 antibodies ION_300 and ION_360 and SARS-CoV-2 receptor binding domain (RBD) were expressed in Expi293F™ cells (Thermo Fisher, A14527).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 receptor binding domain ( RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody:RBD complexes were mixed and co-purified by size exclusion chromatography in 20 mM Tris-HCl (pH 7.5) and 50 mM NaCl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody:RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both complex crystal structures were solved by molecular replacement using Phaser (46) utilising the coordinates from the SARS-CoV-2 RBD domain (PDB: 7JMP) and using homology models for ION_300 and ION_360 antibodies generated using SWISSMODEL (47) to model the heavy and light chains.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ION_360</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detailed materials and methods for library construction, neutralisation assays and biophysical characterisation of anti-SARS-CoV-2 antibodies. Fig. S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Superposition of antibody and nanobody structures targeting the SARS-CoV-2 RBD. Fig. S7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH germline usage in convergent antibody response. Fig. S9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralisation assays and combination testing: Briefly, a lentiviral pseudotyped virus was used for the infection of HEK293T/17 cells transiently expressing human ACE2 and TMPRSS2 for the pseudoviral assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reagents cat. no. 100980) was used to infect VERO CCL-81 cells for the authentic virus neutralisation assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For single concentration pseudovirus assay, SPR, and cross-reactivity evaluation, the antibodies expressed in 96 well plates (Expi293 cells) were purified by protein-A affinity chromatography (Generon, PC-A100), using 96 well filter plates (Whatman Polystyrene Unifilter Microplates, GE Healthcare, 11313535)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Atomic models were built using Coot (48) and refined with Refmac (49).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.12.07.414706: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Intravenous viral administration in vivo: The animal protocol was approved by the University of South Carolina IACUC committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male wild type C57BL/6J mice (5-6 weeks old) were intravenously administered 100 μl of Spp or VSV-G lentivirus (8×108 of viral particles) via tail venous or retro-orbital injection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S1 subunit, anti-low density lipoprotein receptor (LDLR), anti-mannose receptor C-type 1 (MRC1), anti-CD68 and anti-human immunodeficiency viruses (HIV)-1 p24 antibodies were obtained from Novus Biologicals (Littleton, CO, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S1 subunit, anti-low density lipoprotein receptor (LDLR), anti-mannose receptor C-type 1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD68</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human immunodeficiency</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV)-1 p24</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-His tag antibodies were obtained from Proteintech (Rosemont, IL, USA) and Thermo Fisher (Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>The anti-His tag antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S1 subunit, anti-HIV-1 p24 antibody, or anti-His antibodies were used to detect the expression of viral proteins and followed by HRP-labeled secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S1 subunit,</div><div>suggested: (Active Motif Cat# 91345, RRID:AB_2847847)</div></div><div style="margin-bottom:8px"><div>anti-HIV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RAW264.7 cell culture, viral uptake and electroporation: Macrophage-like RAW264.7 (RAW) cells (ATCC® TIB-71™) were cultured in DMEM (10% FBS) medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW264.7</div><div>suggested: ATCC Cat# TIB-71, RRID:CVCL_0493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a parallel experiment, RAW cells (5×106) were electroporated with pcDNA3.1, EGFP-N2 or pcDNA-Spike plasmids (10 μg) using the following parameters: 2 mm gap cuvette, 250 ul sample volume and 120V (BTX Harvard Bioscience, Inc., Holliston, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild type C57BL/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired using ImageXpress Pico System (Molecular Device, San Jose, CA, USA) or confocal microscopy system (Carl Zeiss AG, Oberkochen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageXpress Pico System</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.06.20249035: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Data and samples were collected only from voluntary, non-remunerated, adult donors as described previously [27], and who provided written informed consent as part of routine donor selection and blood collection procedures, that were approved by the Ethics Advisory Council of Sanquin Blood Supply Foundation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For anti-RBD IgG1 and IgG3, the calibrator consisted of recombinantly expressed IgG1 and IgG3 monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 was produced in HEK cells with a HAVT20 leader peptide, 10xhis-tag and a BirA-tag as described by Dekkers et al., [28].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">African green monkey (Vero-E6) cells were added in a concentration of 2 × 104 cells per well and incubated for 3 days at 35°C in an incubator with 5% carbon dioxide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the remaining 676 samples collected between March 30 and August 14, the longitudinal changes in IgG antibody levels were analyzed by linear mixed effects modeling in R (v3.6.0) using the LmerTest package (v3.1.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LmerTest</div><div>suggested: (R package: lmerTest, RRID:SCR_015656)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis were carried out using Graphpad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A limitation is the substantial uncertainty in the individual half-life estimates especially at the low end, since the available data will sometimes only cover a fraction of a half-life. Long-term maintenance of antibody production is provided by a pool of long-lived plasma cells and memory B-cells that can last a lifetime [35]. Several time scales may be identified, of which the longest-lasting can have half-lifes in the order of many years, and thus beyond scope of the current study [36]. It will be interesting to continue following the decline of anti-RBD IgG in time and investigate whether the longevity of the antibody response is similar to other coronaviruses, such as SARS-CoV that can still be detected in most individuals 3-years after recovery [37]. The antibody titer required for protection against re-infection in humans is not yet known, and has to be evaluated also in the context of a recall response upon re-infection. Recent studies provide evidence that upon infection, individuals develop SARS-CoV-2 specific memory B and memory T cells that can be detected for up to 240 days, with numbers of IgG memory B cells increasing over time and plateauing after ca. 150 days [20, 38]. The relationship between long-lasting antibody production and the T and B cell memory compartments requires more investigation. We also quantitatively examined the IgG1 and IgG3 subclass response and found that in our study population IgG1 appeared to be by far the dominant IgG subtype. This i...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.13.426436: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals received free access to food and water and were handled according to the approved protocols of the Animal Committee of Osaka University (Suita, Osaka, Japan) as No.28-021-028, the Ethics Committee for Animal Experiments of the Safety Research Institute for Chemical Compounds Co. Ltd. (Sapporo, Hokkaido, Japan) as No. AN20200617-03 and the Animal Committee of KAC Co. Ltd. (Kusatsu, Shiga, Japan) as No. 20–0508.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: The rat study was performed using 7-week-old male Crl:CD (SD) rats (Charles River Laboratories Japan Inc., Kanagawa, Japan).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All wells were washed with PBST (200 μl/well) seven times, and incubated with 1:1000 diluted Amersham ECL anti-rat IgG horseradish peroxidase-linked species-specific whole antibody (NA935, GE Healthcare UK Limited, UK) or Amersham ECL anti-mouse IgG horseradish peroxidase-linked species-specific whole antibody (NA931, GE Healthcare UK Limited, UK) in the blocking buffer for 3 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat IgG</div><div>suggested: (GE Healthcare Cat# NA935, RRID:AB_772207)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (GE Healthcare Cat# NA931, RRID:AB_772210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After serum incubation, the serum samples were removed and IgG subtypes were detected using the following HRP-conjugated antibodies for 3 h at room temperature; anti-IgG1 H&L (ab106753; Abcam), anti-IgG2a H&L (ab106783; Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG1</div><div>suggested: (Abcam Cat# ab106753, RRID:AB_10859102)</div></div><div style="margin-bottom:8px"><div>anti-IgG2a</div><div>suggested: (Abcam Cat# ab106783, RRID:AB_10866498)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 binding inhibition assay: To analyze the binding inhibition of S1+S2 and ACE2 by neutralizing antibodies in the immunized rat and mouse serum, 96-well plates were coated with human ACE2 recombinant protein (1μg/ml, mFc tag; #83986, Cell Signaling Technology), and then blocked using PBS containing 5% skim milk for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed with PBST and then incubated with anti-His antibody conjugated with HRP (GTX21187, GeneTex, Inc., Irvine, CA) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sixteen weeks after the first administration, sera were collected from immunized mice and tested for antibody induction against 2019-nCoV spike protein (S1+S2) and the RBD region of the spike protein, as well as for the inhibition of binding to the recombinant hACE2 protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>2019-nCoV spike protein (S1+S2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells stably expressing TMPRSS2 were seeded on 96-well plates and incubated at 37 °C for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The homogenate solution was serially diluted 10 folds in DMEM containing 2% FBS and loaded on VeroE6/TMPRSS2 cells to determine the value.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mouse study was performed using 8-10 weeks old C57BL/6NCrSlc mice (C57BL/6N) (Japan SLC,Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6NCrSlc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6N</div><div>suggested: RRID:MGI:5651595)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: Precisely 1 μg/ml of recombinant 2019-nCoV spike protein (S1+S2) (ECD, His tag) (BLPSN-0986P, BETA Life Sciences, Fairfield, NJ, USA) was immobilized on a 96-well plate (442404, MAXISORP F96 NUNC Immuno-plate, Thermo Fisher Scientific, Roskilde, Denmark) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BETA</div><div>suggested: (BETA, RRID:SCR_007556)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage inhibition of immunized blood serum at various time points was calculated and plotted using GraphPad Prism software, from which the neutralization titer at ID75 was derived.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.07.425806: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Yeast scFv display levels were evaluated prior to sorting (data not shown) by incubating the yeast with a 1:1000 dilution of Chicken anti C-MYC Epitope Tag Primary Antibody from Exalpha Biologicals Inc. (Catalog No. ACMYC), followed by incubation with a 1:1000 dilution of Goat anti-Chicken IgY (H+L) Cross Adsorbed Secondary Antibody, Alexa Fluor Plus 647 from Thermo Fisher Scientific (Catalog No. A32933) RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti C-MYC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Chicken IgY</div><div>suggested: (Thermo Fisher Scientific Cat# A32933, RRID:AB_2762845)</div></div><div style="margin-bottom:8px"><div>anti-His FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a baseline step in assay buffer, RBD-coated biosensors were dipped in a 300 nM solution of ACE2 or assay buffer for 5 min before being dipped in a 100 nM solution of a given antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant protein expression and purification: IgGs, ACE2-huFc-Avi, and coronavirus RBDs were expressed and purified from Expi293F cells cultured in 33% Expi293 Expression / 66% FreeStyle Expression medium (Thermo Fisher Scientific) and grown in baffled polycarbonate shaking flasks (Triforest) at 37 °C and 8% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 6 x 106 HEK293T cells cultured in D10 medium (DMEM, 10% fetal bovine serum (Gemini Bio-Products), 2 mM L-glutamine, 1% penicillin/streptomycin, and 10 mM HEPES [pH 7.0]) were transfected at ~50-70% confluency using calcium phosphate transfection20 with 5 lentiviral production plasmids: pHAGE_Luc packaging vector (10 μg), full-length SARS-CoV-2 spike (3.4 μg), HDM-Hgpm2 (2.2 μg), PRC-CMV-Rev1b (2.2 μg), and HDM-tat1b (2.2 μg)30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells overexpressing ACE219 were plated at 5,000 cells per well in clear-bottom white-walled 96-well plates 1 day prior to infection in D10 medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medium was removed from HeLa/ACE2 cells and replaced with virus/inhibitor mixtures which were then incubated for 48 h at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa/ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding curves were fit using the “association then dissociation” equation in GraphPad Prism 8.4.1 to calculate KD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.09.426032: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: For use of patient serum ethical approval was granted by the Ethics Committee at the Medical Faculty of LMU Munich (vote 20-225 KB) in accordance with the guidelines of the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Vaccination experiments in mice: Female BALB/c mice (6 to 10 week-old) were purchased from Charles River Laboratories (Sulzfeld, Germany).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blots were blocked in a phosphate buffered saline (PBS) buffer containing 5% Bovine Serum Albumin (BSA) (Sigma-Aldrich, Taufkirchen, Germany) and 0.1% Tween-20 (Sigma-Aldrich, Taufkirchen, Germany) and incubated for 60 min with primary antibody, monoclonal anti-HAtag antibody (1:8000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) or COVID-19 patient serum (1:200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HAtag</div><div>suggested: (InvivoGen Cat# ab-hatag, RRID:AB_391833)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Permeabilized cells were probed with a monoclonal antibody against the HA-tag epitope (1:1000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) to detect SARS-2-S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-tag epitope</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-permeabilized cells were stained with a mouse monoclonal antibody obtained against the S protein of SARS-CoV-1 (SARS-1-S; 1:200; GeneTex) before fixation with PFA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-1-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polyclonal goat anti-mouse secondary antibody (1:1000; Life Technologies, Darmstadt, Germany) was used to visualize S-specific staining by red fluorescence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surrogate virus neutralization assay (sVNT): To test for the presence of neutralizing anti-SARS-CoV-2-S serum antibodies we used surrogate virus neutralization test as described before with slight modifications (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were extensively washed with phosphate-buffered saline/0.05% Tween-20 (PBST), followed by incubation for 1h at 37°C with an HRP-conjugated anti-His-tag antibody (1.2 μg/ml; clone HIS 3D5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (MBL International Cat# M136-3, RRID:AB_11125943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To remove background effects, the mean percentage of inhibition from non-specific mouse serum (Invitrogen) was deducted from sample values and neutralizing anti-SARS-CoV2-S antibodies titres were determined as serum dilution that still had binding reduction > mean + 2 SD of values from sera of vehicle-treated mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, we fixed the cells with 4% formaldehyde/phosphate-buffered saline (PBS) and stained the cells with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological, https://www.sinobiological.com) and a secondary peroxidase-labeled goat anti-rabbit IgG (Dako, https://www.agilent.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human A549 cells (ATCC® CCL-185™) (LGC standards) were maintained in DMEM with high glucose and 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The replicative capacity of recombinant MVA was tested in multi-step-growth experiments on monolayers of DF-1, HaCat, HeLa or A549 cells grown in 6-well-tissue-culture plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HaCat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blot analysis of recombinant protein: To monitor production of the recombinant SARS-2-S protein, DF-1 cells were infected at MOI 10 with recombinant or non-recombinant MVA or remained uninfected (mock).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DF-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining of recombinant SARS-2-S protein: Vero cells were infected with 0.05 MOI MVA-SARS-2-S or non-recombinant MVA and incubated at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then added 50 μL of virus suspension (400 plaque-forming units) to each well and incubated at 37°C for 1 h before placing the mixtures on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytopathic effects (CPE) on VeroE6 cells (ATCC CRL1586) were analyzed 4 days after infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination experiments in mice: Female BALB/c mice (6 to 10 week-old) were purchased from Charles River Laboratories (Sulzfeld, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, we fixed the cells with 4% formaldehyde/phosphate-buffered saline (PBS) and stained the cells with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological, https://www.sinobiological.com) and a secondary peroxidase-labeled goat anti-rabbit IgG (Dako, https://www.agilent.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.sinobiological.com</div><div>suggested: (Sino Biological, RRID:SCR_003697)</div></div><div style="margin-bottom:8px"><div>https://www.agilent.com</div><div>suggested: (Agilent Technologies, RRID:SCR_013575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, cells were permeabilized using Intracellular Staining Permeabilization Wash Buffer (Perm Wash buffer; Biolegend; dilution 1:10), and stained intracellularly in 100 μl/well of anti-mouse IFN-γ (clone XMG1.2, 1:200, Biolegend) plus anti-mouse TNF-α (clone MP6-XT22, 1:200, Biolegend) diluted in Perm Wash buffer for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biolegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each antibody, single colour controls were prepared using OneComp eBeads™ Compensation Beads (eBioscience, Thermo Fisher Scientific) and cells for the viability dye Zombie Aqua.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneComp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was acquired by the MACSQuant VYB Flow Analyser (Miltenyi Biotec) and analyzed using FlowJo (FlowJo LLC, BD Life Sciences, Ashland, OR, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were prepared using GraphPad Prism version 5 (GraphPad Software Inc., San Diego CA, USA) and expressed as mean ± standard error of the mean (SEM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.04.20248897: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Approval: This study was approved by the Ethics Committees of Centro Hospitalar e Universitário de Coimbra (CHUC-084-20).<br>Consent: Participants signed an informed consent form, according to the Helsinki principles, the Oviedo Convention and according to the General Data Protection Regulation – Regulation (EU) 2016/679.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The investigators were blinded to sample allocation during experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Among the negative subjects, the median cohort age was 37.5 years (21-60 years), 9/19 (47%) were male, and 10/19 (53%) were female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a washing step, 100 μL anti-human IgG antibody conjugated with horseradish peroxidase (Sigma-Aldrich) diluted at 1:5000 was added and the plates were incubated at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>100 μL anti-human IgG antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleocapsid-His recombinant Protein (YP_009724397.2(335Gly/Ala)) (Met1-Ala419) expressed in Baculovirus-Insect Cells with a polyhistidine tag at the C-terminus (Reference 40588-V08B); Spike protein S1 Subunit (YP_009724390.1) (Val16-Arg685) expressed in HEK293 Cells with a polyhistidine tag at the C-terminus (Reference 40591-V08H); Spike protein Receptor Binding Domain (RBD) (YP_009724390.1) (Arg319-Phe541) expressed in HEK293 Cells with a polyhistidine tag at the C-terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative SARS-CoV-2 group (n=19) included subjects with a negative qRT-PCR performed following risk-contact tracking and monitored by IgG serology (Alinity i, Abbott).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired in a LSRFortessa™ flow cytometer (BD Biosciences CA, USA) using the FACSDiva™ software v8.0 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsoft Excel v.14.1.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.13.426537: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) anti-mouse antibody was used to recognize VHH (4A12E6: Invitrogen Rockford, USA) followed by probing with anti-mouse IgG raised in goat (A3562: 1ml Sigma, USA) and conjugated with alkaline phosphatase for the development of the blot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Sigma-Aldrich Cat# A3562, RRID:AB_258091)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blocked PVDF membrane was probed with the sdAb (having both 6x(HIS)-tag and biotin-tag) and then monoclonal anti-6x(HIS)-tag antibody was probed followed by detection with anti-mouse IgG conjugated with alkaline phosphatase (A3562: 1ml Sigma, USA) was used for developing the blots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x(HIS)-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since the spike construct contains the Flag tag, immunoblotting was performed to detect the presence of spike protein in supernatant collected 24 hours post transduction as well as in cell lysate of 72 hours post transduced Vero E6 cells using anti-flag mouse antibody (F1804-50UG, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A secondary antibody anti-mouse IgG raised in goat and conjugated with alkaline phosphatase was used for the development of the blot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of sdAb, anti-6x(HIS) antibody was incubated for 1 hr at RT followed by washing and incubation with anti-mouse antibody conjugated with alkaline phosphatase for 1.5 hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x(HIS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biolayer interferometry (BLI): BLI was performed to determine the binding kinetics of anti-CS and anti-RBD antibody with the purified spike protein produced from transfected HEK293T cells (S construct with 3x FLAG-tag) using BLltz System.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Different concentrations of S protein were incubated for 5 minutes to measure the binding affinity with the immobilised anti-CS and anti-RBD antibodies, and their dissociation kinetics was measured in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TG1 cells were then infected with helper phage M13K07 under static conditions at 30°C for 40 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Above mixture was kept at RT for 15 minutes and co-transfected in HEK239T cells (Human Embryonic Kidney).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK239T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modified Vero cells (Vero E6) originated from kidney epithelial cells of African green monkey were used for measuring the internalization using concentrated pseudoviruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells infected with bald particles or the LV (VSV-G) pseudovirus particles served as a control for such experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: After 72 hrs of transduction, Vero-E6 cells were treated with 1mM PBS-EDTA for 15 minutes at 37°C in CO2 incubator and the cells were removed from 96 well (flat bottom) plates by reverse pipetting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biolayer interferometry (BLI): BLI was performed to determine the binding kinetics of anti-CS and anti-RBD antibody with the purified spike protein produced from transfected HEK293T cells (S construct with 3x FLAG-tag) using BLltz System.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prediction of B cell epitopes: Linear B cell epitopes were predicted by IEDB database using BepiPred 2.0 server.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BepiPred</div><div>suggested: (BepiPred-2.0, RRID:SCR_018499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The available data was analysed using flowJo X software (TreeStar)44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>flowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis and scaling of all the taken images were done using ImageJ software44</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Scanning electron microscopy: Field Emission Scanning Electron Microscope (FESEM) was used to measure the surface topography of LV(CoV2-S) and LV(VSV-G).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Field Emission Scanning</div><div>suggested: (Hitachi S4700 Field Emission Scanning Electron Microscope, RRID:SCR_020019)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis were done using Graphpad prism 8.0.2(263).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.13.21249429: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from the patient, or next of kin if the patient was unable to give consent.<br>IACUC: All animal experiments were approved by the Uppsala Committee of Ethics of Animal Experiments (approved permit 5.8.18-04862-2020), in accordance with the Swedish Animal Protection Act (SFS 1988:534), and were conducted according to guidelines established by the Swedish Board of Agriculture.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All experiments were performed in both female and male mice.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lung lysates were immunoprecipitated with a rabbit anti-mouse thrombomodulin antibody (ab230010, Abcam) attached to protein G conjugated Dynabeads (10004D, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse thrombomodulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were blocked with 5% BSA for 1 h and incubated overnight with mouse anti-6X His tag antibody (27E8, 2366, Cell Signaling).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6X</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing and incubating with anti-mouse HRP conjugated secondary antibody (NA931, Sigma), proteins were visualized using ECL plus detection reagents (GERPN2232, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GERPN2232</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were stripped with Re-Blot Plus Strong solution (2504, Millipore), blocked, and probed with anti-thrombomodulin antibody followed by anti-rabbit HRP conjugated secondary antibody (711-035-152, Jackson Immuno Research).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-thrombomodulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 711-035-152, RRID:AB_10015282)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total thrombomodulin in lung lysates was done as above and correlated to loading control, anti-Gapdh HRP conjugated antibody (ab9482, Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Gapdh HRP</div><div>suggested: (Abcam Cat# ab9482, RRID:AB_307272)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice for other experiment came from in house breeding on a C57BL6/J background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL6/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band density was quantified with ImageJ (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was done in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:One limitation of our assay is that the measured APC levels were close to the detection limit, hence, possible differences between groups would not be detected. In contrast, a recent study did not find changes in APC in critically ill COVID-19 patients (36). However, reduced levels of APC are found in a majority of patients in sepsis and are associated with increased risk of death (42-45). APC formation may be impaired because of down-regulation or shedding of thrombomodulin induced by inflammatory cytokines (46), and, as we hypothesize herein, by ANGPT2 binding to thrombomodulin. Recent data show that circulating thrombomodulin was elevated in critically ill COVID-19 patients, suggesting shedding of thrombomodulin from the endothelium (15, 36). Furthermore, Goshua et al, reported that soluble thrombomodulin correlates with mortality in critically ill COVID-19 patients (36). In the current study, we noted that injection of ANGPT2 in mice resulted in the loss of thrombomodulin in lung tissue (Fig. 3). Further studies are needed to investigate if this is a direct or indirect effect of ANGPT2. To investigate if ANGPT2 can directly affect coagulation in vivo, we performed several experiments in mice. One simple but highly relevant experiment to evaluate coagulation is tail bleeding time (47). In these experiments, recombinant ANGPT2 and ANGPT1 fragments corresponding to the thrombomodulin and TIE2 binding region were injected before the measurement of tail bleeding time. These ex...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.19.427256: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike S1 antibody (40150-R007), SARS-CoV-2 (2019-nCoV) Spike S1-His Recombinant Protein (40591-V08B1), MERS-CoV Spike/S1 Protein (S1 Subunit, aa 1-725, His Tag) (40069-V08H) were purchased from Sino Biological (China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>40069-V08H</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 5 and 7. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.19.427324: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase (HRP) (Southern Biotech, cat. 2040-05, lot B3919-XD29, 1:5,000 dilution) and a 3,3′,5,5′-tetramethylbenzidine (TMB) substrate (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were incubated sequentially with 1 μg/mL of rCR3022 anti-S antibody or an murine anti-SARS-COV-2 mAb, SARS2-16 (hybridoma supernatant diluted 1:6,000 to a final concentration of ∼20 ng/mL) and then HRP-conjugated goat anti-human IgG (Sigma-Aldrich, A6029) in PBS supplemented with 0.1% (w/v) saponin (Sigma) and 0.1% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant human ACE2 with a C-terminal Flag tag peptide was added to wells at 2 μg/mL in a 5 μL per well volume (final 0.4 μg/mL concentration of human ACE2) without washing of antibody and then incubated for 40 min at ambient temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and bound human ACE2 was detected using HRP-conjugated anti-Flag antibody (Sigma-Aldrich, cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To verify escape from antibody selection, isolated viruses were assessed in a subsequent RTCA experiment in the presence of 10 μg/mL (COV2-2676) and 100 µg/mL (COV2-2489) of mAb as used for the escape virus selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2-2676</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero-E6 cells in 50 μL of cell culture medium was seeded in each well, and the plate was placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate wells containing virus only (maximal CPE in the absence of mAb) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was added to pre-chilled Vero or Vero+ACE2+TMPRSS2 cells at an MOI of 0.005 and incubated at 4°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero+ACE2+TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding cDNA for each spike protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero E6 cells in 50 μL of cell culture medium was seeded per each well, and plates were placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then analyzed by Eve Technologies Corporation (Calgary, AB, Canada).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values for binding were determined using Prism v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50 μL of cell culture medium (DMEM supplemented with 2% FBS) was added to each well of a 96-well E-plate using a ViaFlo384 liquid handler (Integra Biosciences) to obtain background reading.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integra Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed using the cryoSPARC software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed twice and fixed with 4% PFA prior to detection of fluorescence signal by flow cytometry (MacsQuant) and analysis using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific primers and probe were used: Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACTGCCGCCTCTGCTC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of mouse studies, the comparison of weight-change curves was performed using a one-way ANOVA with Dunnett’s post hoc test using Prism v.9.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.15.426463: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polyclonal rabbit anti-S1 antibody (Sinobiological, Cat: 40592-T62) and anti-S2 antibody (Abcam, Cat: ab272504) were used as primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed 3 × with PBS-BSA-0.5% then incubated for 1h at RT with secondary antibodies conjugated with Alexafluor488 diluted at 1:1000 in PBS-BSA 0.5% (for ChAdOx1 nCov-19 serum staining Goat Anti mouse AlexaFluor 488 (Life Tech A11029)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11029, RRID:AB_2534088)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolation of human monoclonal antibodies from peripheral B cells by spike-specific single B cells sorting: To isolate Spike-specific B cells, PBMCs were labelled with recombinant trimeric spike-twin-Strep and stained with antibody cocktail consisting of CD3-FITC, CD14-FITC, CD56-FITC, CD16-FITC, IgM-FITC, IgA-FITC, IgD-FITC, IgG-BV786, CD19-BUV395 and Strep-MAB-DY549 (iba) to probe the Strep tag of spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG-BV786</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19-BUV395</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot analysis: Protein pellets from the HEK293F cell lysates were loaded onto an SDS-PAGE gel, then transferred to a PVDF membrane.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FACS analysis for cell surface spike expression: Hela S3 cells at 4 ×105 cell/ml were infected with 10 MOI ChAdOx1 nCoV-19 and incubated at 37°C for 40-48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela S3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding heavy and light chains were then co-transfected into the 293T cell line by the polyethylenimine method (408727; Sigma), and antibody were harvested for further study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.6×105 of U2OS or HeLa cells resuspended in 2 ml of DMEM 10% FBS, Pen/Strep were seeded on top of the grids in, in 6 well plate wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo v9 (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tilt series were acquired using SerialEM (44) at a pixel size of 2.13 Å.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were subsequently gain normalised during motion correction and Fourier cropped back to physical pixel size with MotionCor2 (46).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A representative glycoform presented at each site was modelled on to the N-linked carbohydrate attachment sites in Coot (50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometry raw files have been deposited in the MassIVE proteomics database (DOI: XXX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassIVE</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.04.21.053017: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis was performed on 8% SDS-PAGE and PA antibody GTX125932 (GeneTex) FluPol in vitro activity assays: The subunits of the A/WSN/33 (H1N1) influenza virus FluPol with a Tandem Affinity Purification (TAP)-tag at the C-terminus of PB2 (pcDNA3-PB1, pcDNA3-PB2-TAP, pcDNA3-PA) were expressed in HEK 293T cells and purified as heterotrimeric complex using IgG sepharose chromatography as described previously(29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PA</div><div>suggested: (GeneTex Cat# GTX125932, RRID:AB_11175740)</div></div><div style="margin-bottom:8px"><div>H1N1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-PB1 , pcDNA3-PB2-TAP , pcDNA3-PA </div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-PB2-TAP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays were performed on MDCK cells in MEM containing 0.5% FCS with a 1% agarose overlay and grown for 2 days at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis was performed on 8% SDS-PAGE and PA antibody GTX125932 (GeneTex) FluPol in vitro activity assays: The subunits of the A/WSN/33 (H1N1) influenza virus FluPol with a Tandem Affinity Purification (TAP)-tag at the C-terminus of PB2 (pcDNA3-PB1, pcDNA3-PB2-TAP, pcDNA3-PA) were expressed in HEK 293T cells and purified as heterotrimeric complex using IgG sepharose chromatography as described previously(29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FAV00A-treated A549 cell extracts: Approximately 106 A549 cells treated with FAV00A in DMEM containing 10% FCS were lysed through sonication in 40 μl buffer A (10 mM HEPES-NaOH, pH 7.5, 0.1% NP-40, 150 mM NaCl, 5% glycerol, and 1 mM DTT) for 10 seconds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using ImageJ and Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.18.20038059: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation, the cells were fixed and stained with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibodies were detected using peroxidase-labeled rabbit anti– human IgG (Dako, https://www.agilent.com) and TMB as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum Samples: Protein expression: The spike ectodomains of SARS-CoV-2 (residues 1–1,213; strain Wuhan-Hu-1; GenBank: QHD43416.1), SARS-CoV (residues 1–1,182; strain CUHK-W1; GenBank: AAP13567.1) and MERS-CoV (residues 1-1262; strain EMC; GenBank: YP_009047204.1) were expressed in HEK-293T cells with a C-terminal trimerization motif and Strep-tag using the pCAGGS expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Likewise, the SARS-CoV-2 S1 subunit or its subdomains (S;S1, residues 1-682; S1A, residues 1-294; RBD, residues 329-538; GenBank: QHD43416.1) were expressed in 293T cells as described in (Chunyan Wang et al., submitted manuscript;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, the mixtures were added on Vero-E6 cells and incubated at 37°C for 1 more hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PRNT for the German sera was done as described previously using Vero E6 cells (Wölfel et al submitted manuscript, doi:https://doi.org/10.1101/2020.03.05.20030502) (10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibodies were detected using peroxidase-labeled rabbit anti– human IgG (Dako, https://www.agilent.com) and TMB as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.agilent.com</div><div>suggested: (Agilent Technologies, RRID:SCR_013575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The correlations between antibody responses detected by different ELISAs were and those detected by PRNT, as the gold standard for CoV serology, were analyzed using GraphPad Prism version 8 (https://www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.17.302232: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To calculate the technical variance, we normalized the UMI count by converting it to UMIs per million, then randomly chose 400 cells from each fixation method and used the 1,000 most highly expressed non-mitochondrial genes to calculate the mean and squared coefficient of variation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing and blocking the cells in PBS supplemented with 4% BSA, staining was performed with an anti-KSHV K8.1 antibody (sc-65446, Santa Cruz, 1:50 dilution) and an Alexa Fluor 488-conjugated goat-anti-mouse secondary antibody (A10667, Life Technologies, 1:4000 dilution) in PBS/1% BSA supplemented with RNase inhibitor, murine (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-KSHV K8.1</div><div>suggested: (Advanced Biotechnologies Cat# 13-213-100, RRID:AB_1929220)</div></div><div style="margin-bottom:8px"><div>goat-anti-mouse</div><div>suggested: (Electron Microscopy Sciences Cat# 815.022, RRID:AB_2629849)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T (ATCC) cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T.rKSHV.219 cells were generated by infecting HEK293T cells with rKSHV.21924, and selecting with 1 μg/mL puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T.rKSHV.219</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The KSHV-positive human PEL cell line BC3 was cultured in Roswell Park Memorial Institute (RPMI) supplemented with 20% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BC3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of A549 cells: OC43 (ATCC) were grown and titrated on A549 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T.rKSHV219 cells were reverse transfected with 0.8 μg plasmid DNA using Lipofectamine2000 (Life Technologies) following the manufacturer’s instructions and seeded in 12 or 24-well plates for analysis by live-cell imaging or qRT-PCR as indicated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T.rKSHV219</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 3T3 cells (p65−/− 3T3 mouse embryonic fibroblast cells expressing p65-DsRed and H2B-GFP nucleus marker32) were cultured in DMEM supplemented with 10% (v/v) fetal bovine calf serum (HyClone), 1% (v/v) GlutaMAX and 1x P/S. Optimization of RNA extraction condition for fixed and permeabilized cells: BC3 cells were harvested, centrifuged at 300g for 3 min to remove the cell media, and washed once with PBS and 1% BSA (molecular biology grade, Gemini Bio-Products).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p65−/− 3T3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment was performed using STAR aligner (version 2.7.3a) and counted using featureCounts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_015899)</div></div><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read subsampling and read mapping: In the FD-seq and methanol fixation comparison experiment, we used samtools view command34 to subsample the output BAM file from Drop-seq tools version 2.3 DetectBeadSynthesisErrors command.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate the proportion of reads mapped to different genomic regions, we used Picard CollectRnaSeqMetrics command on the output BAM file directly from the STAR aligner.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To find the enriched KEGG pathways, we uploaded the list of genes that were upregulated in TMEM119 overexpression versus GFP overexpression (log2 fold change > 1, FDR < 0.05) to g:Profiler26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA velocity analysis: The output files of Drop-seq tools DetectBeadSynthesisErrors function were processed with the dropEst pipeline40 to tag spliced and unspliced transcripts, and the results were analyzed with Python velocyto package33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dropEst</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data availability: The raw data, metadata and count data are deposited in NBCI’s Gene Expression Omnibus (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.26.20042184: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Serum samples for assay: The protocols were approved by the institutional ethical committee of Beijing You An Hospital, Capital Medical University.<br>Consent: Informed consent was obtained from all the human subjects who participated in the study after the nature and possible consequences of this study had been fully explained and the protocols were approved by the institutional ethical committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293F cells and CHO cells and culture media were provided by Zhenge Biotech.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293F</div><div>suggested: RRID:CVCL_6642)</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: The full length SRARS-CoV-2 S1 gene (GenBank: QIC53204.1) with C terminal were synthesized by GENEWIZ, China, and inserted into mammalian cell expression vectors with either 6* His tag or fused with human IgG Fc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.21.990770: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: This study received approval from the Research Ethics Committee of Shenzhen Third People’s Hospital, China (approval number: 2020-084).<br>Consent: The Research Ethics Committee waived the requirement informed consent before the study started because of the urgent need to collect epidemiological and clinical data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA analysis of plasma and antibody binding to RBD, trimeric Spike, and NP proteins: The recombinant RBDs and trimeric Spike derived from SARS-CoV-2, SARS-CoV and MERS-CoV and the SARS-CoV-2 NP protein (Sino Biological, Beijing) were diluted to final concentrations of 0.5 μg/ml or 2μg/ml, then coated onto 96-well plates and incubated at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 NP protein (Sino Biological, Beijing)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The third staining at 4 °C for 30min involved either: Streptavidin-APC (eBioscience) and/or Streptavidin-PE (BD Biosciences) to target the Strep tag of RBD, or anti-his-APC and anti-his-PE antibodies (Abcam) to target the His tag of RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-101-322, RRID:AB_2800415)</div></div><div style="margin-bottom:8px"><div>anti-his-PE</div><div>suggested: (Miltenyi Biotec Cat# 130-092-691, RRID:AB_1103227)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single B cell PCR, cloning and expression of mAbs: The IgG heavy and light chain variable genes were amplified by nested PCR and cloned into linear expression cassettes or expression vectors to produce full IgG1 antibodies as previously described 29,41.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>full IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR products were purified and cloned into the backbone of antibody expression vectors containing the constant regions of human IgG1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV antibodies (S230 and m396) previously isolated by others 42 were synthesized and sequences verified before expression in 293T cells and purification by protein A chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HIV-1 antibody VRC01 was a broadly neutralizing antibody directly isolated from a patient targeting the CD4 binding site of envelope glycoprotein 40.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4 binding site of envelope glycoprotein 40</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then stained with PE labeled anti-human IgG Fc secondary antibody (Biolegend) at a 1:20 dilution in 50 μl staining buffer at room temperature for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV antibodies (S230 and m396) previously isolated by others 42 were synthesized and sequences verified before expression in 293T cells and purification by protein A chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T cells without transfection were also stained as background control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7 cells (ATCC) (approximately 1.5 × 104 per well) were added in duplicate to the virus-antibody mixture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isolate was amplified in Vero cell lines to make working stocks of the virus (1 × 105 PFU/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To analyze the mAb neutralizing activities, Vero E6 cells were seeded at 104/well in 96-well culture plates and cultured at 37 °C to form a monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genes encoding the heavy and light chains of isolated antibodies were separately cloned into expression vectors containing IgG1 constant regions and the vectors were transiently transfected into HEK293T or 293F cells using polyethylenimine (PEI) (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the cells were re-suspended and analyzed with FACS Calibur instrument (BD Biosciences, USA) and FlowJo 10 software (FlowJo, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentrations (IC50) of the evaluated mAbs were determined by luciferase activity 48h after exposure to virus-antibody mixture using GraphPad Prism 6 (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG heavy and light chain variable genes were aligned using Clustal W in the BioEdit sequence analysis package (https://bioedit.software.informer.com/7.2/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioEdit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analyses were performed by the Maximum Likelihood method using MEGA X (Molecular Evolutionary Genetics Analysis across computing platforms).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.04.29.20085068: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study Approval and Informed Consent Process: The study was conducted under the ethical principles that have their origins in the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was incubated with the secondary antibody (1:2000 dilution of Goat Anti-Human IgG HRP and Goat Anti-Human IgM HRP and Goat Anti-Human IgA HRP individually) for 15 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant antigens were expressed in HEK293 cell lines using full length cDNA coding for the respective antigens fused with a hexa histidine purification tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:When it comes to serological tests the main limitations that make them suboptimal tools for diagnosing those who are sick is that it takes time for the development of antibodies after infection. Thus, they may produce a false negative result in individuals who are acutely infected. On the other hand, they can be useful to indicate exposure in individuals who are asymptomatic or were symptomatic but PCR negative or were never tested. Nevertheless, it is important to note that the serological testing should not be used as the sole basis for diagnosis of an acute COVID19 infection. Technology developments truly enable testing for multiple antibodies from small volumes of collected blood. The potential convenience and cost savings that it would bring to laboratory testing cannot be understated. Remote sampling such as with DBS cards, along with telemedicine would help providers to order tests not only in pandemic settings but also can be a great enabler in bringing healthcare costs down. Immediate application of such a platform to do multiplex testing would be in the monitoring of exposure to upper respiratory tract infections. A subset of the NP swab positive individuals are being monitored for antibody levels and symptoms at regular intervals from the time they tested positive. Initial results show that the seroconversion from IgM to IgG which is marked by a reduction in IgM titer might be co-related with recovery since it is accompanied by a negative result in the subsequent N...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.20.213249: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Serum Samples: Serum samples for sensitivity analyses were obtained from Great Ormond Street Children’s Hospital NHS Foundation Trust (GOSH) and came from three sources; (i) healthcare workers who tested SARS-CoV-2 RT-PCR positive following signs or symptoms of COVID-19 and who gave written consent for participation in the service evaluation of SARS-CoV-2 serological assays, (ii) staff enrolling in a prospective longitudinal cohort study of SARS-CoV-Serology (COSTARS, IRAS 282713, ClinicalTrials.gov Identifier: NCT04380896) who tested positive in a commercial screening assay for anti-Nucleocapsid IgG (Epitope Diagnostics Inc, San Diego, USA) (iii) a small number of RT-PCR positive sera from hospitalised children (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This serum was calibrated against research reagents NIBSC 20/130 and NIBSC 20/124 distributed by the National Institute for Standards and Biological Control (NIBSC, Potters Bar, UK, https://www.nibsc.org/) for the purpose of development and evaluation of serological assays for the detection of antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation for 2 hours with shaking at 700rpm, the plates were washed three times and detection antibody was added at 2 µg/mL (MSD SULFO-TAG™ Anti-Human IgG Antibody).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using MSD Discovery Workbench and GraphPad Prism version 8.0 (GraphPad, San Diego, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04380896</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Staff Testing of Antibody Responses Study (Co-Stars…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.15.992883: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess antibody competition, either 240CD or CR3022 or a non-specific control antibody CR1-07 was incubated with the SARS-CoV-2 RBD prior to assessment of binding to CR3022 or 240CD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid, and protein was expressed by transient transfection in 293F cells for six days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.15.991844: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100μl of HRP anti-His Tag Antibody (BioLegend, USA) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These two constructs were transfected into HEK293 cells using polyethyleneimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells, at about 70-90% confluence, were co-transfected with 9 ug of the transfer vector (pLv-CMV), 6 ug packaging plasmid (psPAX-lentiviral), and 6 ug envelope plasmid (pCB-spike or pCB-spikeV367F).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">spike-mediated pseudovirus entry assay: To detect S variants mediated viral entry, VERO E6 and Caco2 cells (5×104) grown in 24-well plates were respectively infected with either 20 MOI of S-V367 or S-F367-bearing pseudovirus (1×107</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of S protein sequences from different sources and comparison of ACE2 proteins among different species were performed using MAFFT version 7, with default parameters (https://mafft.cbrc.jp/alignmeloadnt/server/) and Bioedit[33,34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular dynamics simulation was performed using GROMACS 2019 with the following options and parameters: explicit solvent model, system temperature 37°C, OPLS/AA all-atoms force field, and LINCS restraints.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.13.093658: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was detected using mouse anti-S-tag monoclonal antibody (Kyab Biotech Co. Ltd., Wuhan, China), followed by FITC-labelled goat anti-mouse IgG H&L (Abcam, Cambridge Biomedical Campus, Cambridge, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6, HeLa, and HEK 293T/17 cells (ATCC) were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers of all viruses used in this study were determined by plaque assays on Vero E6 cells, as previously described (17).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells were transfected with the same amount of human or R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were built by the maximum likelihood method implemented in RAxML program in CIPRES Science Gateway (https://www.phylo.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.09.01.278630: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics Statement: Animal studies and related experimental procedures were approved by the University of Melbourne Animal Ethics Committee (#1714193, #1914874).<br>IRB: Human clinical study protocols were approved by the University of Melbourne Human Research Ethics Committee (#2056689), and all associated procedures were carried out in accordance with approved guidelines.<br>Consent: All participants provided written informed consent in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eight male macaques (Macaca nemestrina) (6-15 years old) were vaccinated with 100μg of SARS-CoV-2 spike or RBD immunogens formulated with 200μg of Monophosphoryl Lipid A (MPLA) liposomes (Polymun) (Baldrick et al., 2002) intramuscularly in the right quadriceps.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolated cells were stained with Aqua viability dye (Thermofisher) and Fc-blocked with a CD16/32 antibody (93; Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then surface stained with S/RBD probes and the following antibodies: B220 BUV737 (RA3-6B2), IgD BUV395 (11-26c.2a), CD45 Cy7APC (30-F11), SA BV786 (BD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45</div><div>suggested: (BD Biosciences Cat# 564225, RRID:AB_2716861)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then surface stained with S/RBD probes and the following antibodies: IgD AF488 (polyclonal; Southern Biotech), IgM BUV395 (G20-127), IgG BV786 (G18-145) (BD), CD14 BV510 (M5E2), CD3 BV510 (OKT3), CD8a BV510 (RPA-T8), CD16 BV510 (3G8), CD10 BV510 (HI10a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD10</div><div>suggested: (BioLegend Cat# 312220, RRID:AB_2563835)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For intracellular transcription factor staining, cells were first stained with Aqua viability dye (Life Technologies), followed by S/RBD probes and surface antibodies: IgD AF488 (polyclonal; Southern Biotech), IgG BV786 (G18-145) (BD), CD14 BV510 (M5E2), CD3 BV510 (OKT3), CD8a BV510 (RPA-T8), CD16 BV510 (3G8), CD10 BV510 (HI10a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OKT3</div><div>suggested: (BD Biosciences Cat# 566779, RRID:AB_2869862)</div></div><div style="margin-bottom:8px"><div>CD8a</div><div>suggested: (Meridian Life Science Cat# MAL10-078, RRID:AB_1070001)</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric detection of ex vivo and antigen-specific TFH: For ex vivo TFH quantification from mice, freshly isolated LN single cell suspensions were stained with the following antibodies: Live/dead Red (Life Technologies), CD3 BV510 (145-2C11; Biolegend), PD-1 BV786 (29F.1A12; Biolegend), CXCR5 BV421 (L138D7; Biolegend), CD4 BUV737 (RM4-5; BD), B220 BV605 (RA3-6B2; BD), and F4/80 PE-Dazzle 594 (T45-2342; BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific TFH</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PD-1 BV786</div><div>suggested: (BD Biosciences Cat# 563789, RRID:AB_2738425)</div></div><div style="margin-bottom:8px"><div>B220</div><div>suggested: (BD Biosciences Cat# 563708, RRID:AB_2738383)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-human primate LN suspensions and PBMC were stained with the same protocol, using the following antibodies: Live/dead Aqua (Life Technologies), CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7; Biolegend), CXCR5 PE (MU5UBEE; ThermoFisher), CD4 BV605 (L200; BD), CD20 BV510 (2H7; BD), CD8 BV650 (RPA-T8; Biolegend), CD95 BUV737 (DX2; BD), ICOS PerCP-Cy5.5 (C398.4A; Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: (BD Biosciences Cat# 563105, RRID:AB_2738008)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (Leinco Technologies Cat# C666, RRID:AB_2829809)</div></div><div style="margin-bottom:8px"><div>CD95</div><div>suggested: (BD Biosciences Cat# 564710, RRID:AB_2738907)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NHP cells were stained with the following antibodies: CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7; Biolegend), CXCR5 PE (MU5UBEE; ThermoFisher), CD4 BV605 (L200; BD), CD20 BV510 (2H7; BD), CD8 BV650 (RPA-T8; Biolegend), CD95 BUV737 (DX2; BD), CCR6 BV785 (G034E3; Biolegend), CXCR3 Pe-Dazzle594 (G02H57; Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BioLegend Cat# 302356, RRID:AB_2566316)</div></div><div style="margin-bottom:8px"><div>CCR6</div><div>suggested: (BioLegend Cat# 353422, RRID:AB_2563660)</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed prior to incubation with HRP-conjugated secondary antibodies for mouse (1:10000; anti-mouse IgG; KPL), macaque (1:10000; anti-macaque IgG; Rockland) or human (1:20000; anti-human IgG; Sigma) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG; KPL</div><div>suggested: (SeraCare KPL Cat# 5450-0011, RRID:AB_2687537)</div></div><div style="margin-bottom:8px"><div>anti-macaque IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-RBD inhibition ELISA: An ELISA to measure the ability of plasma antibodies to block interaction between recombinant human ACE2 (kindly provided by Merlin Thomas) and SARS-CoV-2 RBD was performed as previously described (Juno et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-75453, RRID:AB_2719181)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the ectodomain of SARS-CoV-2 (isolate WHU1; residues 1 – 1208) with furin cleavage site removed and P986/987 stabilisation mutations36, a C-terminal T4 trimerisation domain, Avitag and His-tag, was expressed in Expi293 cells and purified by Ni-NTA size-exclusion chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">%Inhibition was plotted against plasma dilutions and the area under curve (AUC) was calculated using Graphpad Prism. Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/2020 (Caly et al., 2020) was passaged in Vero cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 or BALB/c mice were anesthetised by isoflurane inhalation prior to intramuscular injection of 50 μL vaccine in each hind quadriceps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B cell receptor sequencing and analysis: B cell receptor sequences were recovered from GC B cells (B220+IgD-GL7+) in the draining iliac lymph node of C57BL/6 mice (n=3) 14 days after a single immunisation with S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">%Inhibition was plotted against plasma dilutions and the area under curve (AUC) was calculated using Graphpad Prism. Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/2020 (Caly et al., 2020) was passaged in Vero cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Prism (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data was analysed in FlowJo v9 or v10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.19.104117: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The overall study was reviewed and approved by the SHAPHC Ethics Committee (approval no.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescently labeled S1 bait was previously prepared by incubating 5 μg of His tag-S1 protein with Anti His tag antibody-PE for at least 1 hr at 4 °C in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti His tag antibody-PE for at least 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR products were then purified using DNA FragSelect XP Magnetic Beads (SMART-Lifesciences) and cloned into human IgG1, lambda or kappa expression plasmids for antibody expression by seamless cloning method (see below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated anti-human IgG Fab antibody (Sigma) was added at the dilution of 1:10,000 in PBST containing 3% BSA (Sangon Biotech) and incubated at 37 C for 0.5 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated anti-human IgG Fab antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 10 thousand cells in 100 μl were incubated with indicated antibodies for 30 min at room temperature, after twice washes then PE-labeled goat anti-human IgG-Fc antibody was added (1:5,000; Abcam) for 30 min, followed by flow cytometry analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Figure S3, to test S protein expression on cell membrane, recombinant ACE2-Cter-6XHis labeled by rabbit anti-His-PE antibody in 1.2:1 (n:n) ratio was added to 10 thousand cells expressing S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-PE</div><div>suggested: (Miltenyi Biotec Cat# 130-092-691, RRID:AB_1103227)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and Viruses: Vero E6, A549-Spike (A549 expressing SARS-CoV-2 S protein), and A549-ACE2 (A549 expressing human ACE2) cell lines were supplied by Shanghai Public Health Clinical Center, Fudan University</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293E cells were transfected using polyethylenimine (PEI, Sigma), after 4-5 days of cell culture, antibodies purification was processed from supernatants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293E</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry assays: For Figure 4, flow cytometry analyses were performed to detect the binding abilities of antibodies to Spike protein in HEK293T cells freshly expressing of SARS-CoV-2, SARS-CoV and MERS-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudovirus were generated by co-transfection of 293T cells with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were analyzed using IMGT/ V-QUEST (http://www.imgt.org/IMGT_vquest) and IgBlast (IgBLAST, http://www.ncbi.nlm.nih.gov/igblast).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of human monoclonal antibodies: The antibody VH/VL and constant region genes were then amplified and cloned into expression vector pcDNA3.4 using SMART Assembly Cloning Kit (SMART-Lifesciences), subsequently antibodies plasmids were amplified in competent cells (SMART-Lifesciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SMART</div><div>suggested: (SMART, RRID:SCR_005026)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The curves and EC50 were analyzed by GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 28 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.25.006569: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ModelTest-NG [6] was used to select the best-fit evolutionary model of nucleotide substitution, that is, GTR + G + I.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ModelTest-NG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The complete coding genomic sequences of 30 coronaviruses were downloaded from the National Center for Biotechnological Information (NCBI) (available at https://www.ncbi.nlm.nih.gov/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/</div><div>suggested: (GENSAT at NCBI - Gene Expression Nervous System Atlas, RRID:SCR_003923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate these values we use an in-house Python script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this case, the three stop codons (TAA, TAG, or TGA) and the three codons for isoleucine (ATT, ATC, and ATA) were excluded in calculation of GC3, and two single codons for methionine (ATG) and tryptophan (TGG) were excluded in all three (GC1, GC2, GC3) (Sueoka 1988).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein sequences were aligned using Biopython.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting multiple sequence alignment was used to build a phylogenetic tree by employing a maximum-likelihood (ML) method implemented in the software package MEGA version 10. 1 [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.11.147363: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Samples analyzed in this study received ethical clearance for immunological evaluation and/or inclusion as controls in immunoassays, and the protocols and informed consent forms were approved by the Institutional Review Board (IRB) at HCB (Refs.<br>IRB: Samples analyzed in this study received ethical clearance for immunological evaluation and/or inclusion as controls in immunoassays, and the protocols and informed consent forms were approved by the Institutional Review Board (IRB) at HCB (Refs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-coupled beads were validated by incubating them with serial dilutions of anti-histidine-Biotin antibody for antigens with a histidine-tag (Abcam, ab27025).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-histidine-Biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the first option, 100 µL of biotinylated secondary antibody diluted in PBS-BN (anti-human IgG, B1140,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Sigma-Aldrich Cat# B1140, RRID:AB_258513)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Seropositivity threshold (cutoff) for optimization tests was calculated as 10 to the mean plus 3 standard deviations of log10-transformed MFIs of the negative controls for each antibody isotype and antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen.</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.16.099317: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot: Western blot was performed either using an anti-strep tag antibody or anti-SARA-COV-2 S antibody following a protocol described previously50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARA-COV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked with 5% skimmed milk in PBS for 1 hour and incubated either with anti-strep tag antibody (IBA Lifesciences) or anti-SARS-COV-2 polyclone antibody (Sino Biological Inc.) for another hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-strep tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alkaline phosphatase conjugated anti-Rabbit IgG (1:5000) (Sigma) was used as a secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Varying amount of the full-length SARS-CoV2 S protein expression construct (0.1-10 µg) and the α fragment of β-galactosidase construct (10 µg), or the full-length ACE2 expression construct (10 µg) together with the ω fragment of β-galactosidase construct (10 µg), were mixed with DMEM medium (Gibco) containing PEI (80 µg) and added to HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated data collection was carried out using SerialEM version65 at a magnification of 105,000× and the K3 detector in counting mode (pixel size, 0.825 Å) at a dose rate of ∼1.1 electrons per physical pixels per second.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the S1 fragment data set, CrYOLO53 was used for particle picking, RELION 3.0.8 was used for 2D classification, 3D classification and refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural biology applications used in this project were compiled and configured by SBGrid56 Model building: The initial templates for model building used the stabilized SARS-CoV-2 S ectodomain trimer structure (PDB ID 6vxx) for the prefusion conformation, and a homology model, calculated by I-TASSER, of S2 postfusion trimer structure from mouse hepatitis virus (MHV) (PDB ID: 6b3o) for the postfusion confirmation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>I-TASSER</div><div>suggested: (I-TASSER, RRID:SCR_014627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several rounds of manual building were performed in Coot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 26 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.24.169334: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: K18-hACE2 mouse experiments: Mouse experiments are approved by the QIMR Berghofer MRI Biosafety Committee and Animal Ethics Committee (project P3600), and are conducted in accordance with the “Australian Code for the care and use of animals for scientific purposes” as defined by the National Health and Medical Research Council of Australia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pixatimod was randomly placed in the box.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female 6-8 week old K18 hACE2 mice (n=4 per group) were treated once with 16 mg/kg of pixatimod in 200 µl saline i.p. on the day before infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of His-tagged S1-RBD was detected with Alexa Fluor 488 anti-his tag antibody (clone J095G46, Biolegend, UK) 1:5000 in 25 μL PBST + 0.1% BSA per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 100 mL of HEK293-6E cells were seeded at a cell density of 0.5 × 106 cells/ml 24hr before transfection with polyethyleneimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-6E</div><div>suggested: RRID:CVCL_HF20)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-compound mixture was transferred onto the wells of a washed 24-well plate that had been seeded with Vero E6 cells [ECACC 85020206] the previous day at 1.5 × 105 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A cytopathic effect assay was performed with the SARS-CoV-2 DE-Gbg20 isolate and Vero cells (ATCC) plated at 2 × 104 per well in 96-well plates the day prior to the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_ZW93)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCi-NS1.1 cells were grown at an Air Liquid Interface (ALI) in PneumaCult-ALI Basal Medium supplemented with Pneumacult ALI supplement hydrocortisone, PneumaCult ALI maintenance supplement, heparin, nystatin and penicillin–streptomycin (all from Stemcell Technologies) at 37°C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BCi-NS1.1</div><div>suggested: RRID:CVCL_T029)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Age and gender matched C57BL/6J mice (n=4) were included as a drug toxicity control and received 16 mg/kg of pixatimod in 200 µl saline i.p., but were not infected with virus. hCoV-19/Australia/QLD02/2020 (QLD02) (GISAID Accession ID; EPI_ISL_407896) virus was used to inoculate K18 hACE2 mice (n=4 per group) intranasally with 104 CCID50 of virus in 50 μl medium while under light anaesthesia; 3% isoflurane (Piramal Enterprises Ltd., Andhra Pradesh, India) delivered using The Stinger, Rodent Anesthesia System (Advanced Anaesthesia Specialists/Darvall, Gladesville, NSW, Australia).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Collected data were analysed with Spectral Manager II software prior to processing with GraphPad Prism 7, using second order polynomial smoothing through 21 neighbours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tm values were calculated using MatLab softaware (R20018a, MathWorks) and ΔTm values determined from the difference between the Tm of RBD alone or in the presence of heparin or pixatimod.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MatLab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were maintained at 50-75% confluence in DMEM supplemented with 10% foetal bovine serum, 20 mM L-glutamine, 100 U/mL penicillin-G and 100 U/mL streptomycin sulfate (all purchased from Gibco/ThermoFisher, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco/ThermoFisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using analysis of a two-tailed Student’s t test with GraphPad Prism (GraphPad Software) unless otherwise noted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis for the K18-hACE2 mouse work was performed using IBM SPSS Statistics for Windows, Version 19.0 (IBM Corp., Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02042781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Safety and Tolerability of IV Infused PG545 in …</td></tr></table>
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 28 and 5. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.15.152157: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were performed using sex- and age-matched controls and approved by the Institutional Animal Care and Use Committee of Tulane University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with IgG-HRP-conjugated anti-human antibody, membranes were washed and incubated with SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Production: Pseudoviruses for antibody screening were generated using the following plasmids: S-Tag of SARS (pcDNA3.1(+)-SARS-S), S-Tag of SARS2 (pcDNA3.1(+)-SARS2-S), vesicular stomatitis virus (pcDNA3.1(+)-VSV-G), and the HIV-1 pro-viral vector pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-Tag of SARS (pcDNA3.1(+)-SARS-S), S-Tag of SARS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used purified anti-human IgG Fc antibody (Biolegend) as a capture antibody and anti-Human IgG Fc, Multi-Species SP ads-HRP (SouthrenBiotech) as a detection antibody and the other procedure is same as mentioned above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissues were blocked with 10% normal goat serum (NGS) for 40 minutes, followed by a 60 minute incubation with polyclonal guinea pig anti-SARS-CoV1 antibodies (1:1000) (NR-10361, BEI Resoruces).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coated plates were washed with washing buffer (0.05% Tween 20 in PBS), blocked for 2 h at room temperature with blocking buffer (1% BSA and 0.1% Tween 20 in PBS), and washed before the addition of the supernatants or cell lysates from transfected 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human ACE2 neutralization of SARS-CoV2 by plaque assay: Vero E6 cells were plated in a 6 well plate at 8 × 105 cells per well and incubated overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female wild type C57BL/6J mice 6-10-week-old were used for in vivo studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this study, we utilized the murine model of SARS-CoV2 were C57Bl/6 mice were first inoculated with adenovirus encoding human ACE2 (Vector Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57Bl/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed with GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
doi.org doi.org
-
SciScore for 10.1101/2020.02.16.951723: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, transfection reagent Sinofection (Cat: STF02), mammalian expression plasmids of full length S or RBD protein of SARS-CoV-2 (Cat: VG40589-UT, Wuhan/IVDC-HB-01/2019) and SARS-CoV (Cat: VG40150-G-N, CUHK-W1), ACE2 (Cat: HG10108-UT), polyclonal antibodies against SARS-CoV RP01 (Cat: 40150-RP01) and T52 (Cat: 40150-T52) were purchased from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RP01</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T52</div><div>suggested: (Rockland Cat# 600-401-W94, RRID:AB_2614544)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV neutralizing antibodies were generated from mice (M103, M127) or rabbits (R314, R301, R325, R302, R258, R348) immunized with recombinant S1 protein of SARS-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R302</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing away the unbound proteins, cells were incubated withPE labelled anti-his-tag antibody for 20 min and went through flow cytometer for detection of cellular binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 100μL/well of the antibody-PSV mixture was added onto the 293T/ACE2 cell wells and incubated for 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-PSV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both 293T and 293T-ACE2 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production in 293T adherent cells: 6-8 hours before transfection, 293T cells were pre-plate on T75 flask in DMEM+10% FBS at 100,000 cells/cm2. 13μg of Luciferase-expressing HIV-1 lentiviral transfer genome (pWPXL-luc), 13μg of packaging plasmid (PSD) and 13μg of expression plasmid encoding either SARS-CoV-2-S protein (pCMV-whCoV-Spike) or SARS-S protein (pCMV-SARS-Spike) were co-transfected into pre-plated 293T cells using Sinofection transfection reagent according to the procedure recommended by manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 100μL/well of the antibody-PSV mixture was added onto the 293T/ACE2 cell wells and incubated for 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flowjo and Graphpad softwares were used for data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software PyMol was used for preparing structural figures39.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of 111 SARS-CoV RBD sequence, used for the generation of sequence conservation, was collected by BLAST via NCBI website34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.01.971499: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Bioethical Committee of the Medical University of Silesia in Katowice, Poland (approval no: KNW/0022/KB1/17/10 dated 16.02.2010).<br>Consent: Written consent was obtained from all patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A mouse monoclonal anti-TMPRSS2 antibody (clone P5H9-A3; 1:500 dilution; Sigma-Aldrich, Poland), followed by incubation with a horseradish peroxidase-labeled anti-mouse IgG (65 ng/ml; Dako, Denmark) diluted in 5% skimmed milk / TBS-Tween (0.1%).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-101847, RRID:AB_2205599)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A horseradish peroxidase-labeled anti-His tag antibody (1:25000 dilution; Sigma-Aldrich, Poland) diluted in 5% skimmed milk / TBS-Tween (0.1%) was used to detect the His-tagged HmuY proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag antibody</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A horseradish peroxidase-labeled anti-His tag antibody (1:25000 dilution; Sigma-Aldrich, Poland) diluted in 5% skimmed milk / TBS-Tween (0.1%) was used to detect the His-tagged HmuY proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag antibody</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RD cells grown in 90% confluency were infected with HCoV-HKU1 (108 RNA copies per ml) in Dulbecco’s MEM (Thermo Fisher Scientific, Poland</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus production and transduction: 293T cells were seeded on 10 cm2 dishes, cultured for 24 h at 37°C with 5% CO2 and transfected with psPAX, pMD2G and third transfer plasmid (pWPI/KLK13, pLKO.1-TRC/shrnaKLK13 or Lego-G2) using polyethyleneimine (Sigma-Aldrich, Poland). psPAX</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:As CleavEx technique is a convenient surrogate system allowing for precise mapping of the cleavage site, it has some limitations. To ensure the reliability of results, purified full-length HCoV-HKU1 S protein was subjected to the proteolytic cleavage. Also here we observed efficient cleavage of the HCoV-HKU1 S protein by KLK13. While the results presented here show that KLK13 is able to process the HCoV-HKU1 S protein, one may question whether the cleavage is sufficient for HCoV-HKU1 entry. It was previously presented for MERS-CoV that two consecutive enzymatic scissions are required for activation of the S protein. In this scenario, KLK13 would prime the HCoV-HKU1 S at S1-S2 site, enabling scission at S2-S2’ site by the TMPRSS2 or another host protease (38, 40, 93). This may be one of the factors limiting the HCoV-HKU1 replication in RD_KLK13 cells, as only minimal replication is observable. Summarizing, we show that KLK13 is a key determinant of HCoV-HKU1 tropism. This may explain why, since its first identification in 2004, all efforts to culture HCoV-HKU1 in standard cell lines have failed. We believe that this study increases our knowledge of HCoV-HKU1 and may promote the future in-depth investigation of coronaviruses. Considering the increasing number and diversity of coronaviruses, and the proven propensity of coronaviruses to cross the species barrier and cause severe diseases in humans, further research on the role of different proteases in coronaviral infections is ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.28.013920: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Crystals of the His-tag samples grew with rectangular morphology in space group P4122, however if the His-tag was removed the crystals grew in space group P6122 form with hexagonal morphology.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequent rounds of manual building and refinement were performed in Coot (Casanal et al., 2019) and PHENIX (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amax and KD were used as fitting parameters and nonlinear regression was performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.24.20112300: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided verbal and / or written informed consent and provided saliva and blood specimens for analysis.<br>IRB: Participation in these studies was voluntary and the study protocols have been approved by the respective Institutional Review Boards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coupling of antigens to beads was confirmed using antibody against the antigen or against the tag (e.g. anti-His(6) tag antibody), if present (Table 1), followed by a species-specific R-phycoerythrin (PE)-labelled antibody and was considered successful if the median fluorescence intensity (MFI [a.u.]) was >10,000 at 1 μg/mL of antigen-specific antibody (except the BSA-conjugated bead set).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against the antigen or against the tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His(6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the MFI of each bead set was measured on a Bio-Plex® immunoassay instrument (Bio-Rad Laboratories, Hercules, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has several limitations. First, our collection of saliva and serum samples was predominantly obtained from independent cohorts, and it contained 28 matched saliva and serum samples collected from the same participants at the same time. In future studies, the performance of this assay should be compared between saliva and serum in a large sample of matched saliva and serum samples. Second, all saliva data was cross sectional and we were not able to evaluate the temporal kinetics of saliva SARS-CoV-2 antibody responses using repeated measures within the same individual. Longitudinal analysis would allow us to evaluate the temporal kinetics and magnitude of SARS-CoV-2 IgG, IgA, and IgM responses, resolve synchronous vs. classical isotype responses (IgM followed by IgA followed by IgG) following SARS-CoV-2 infection.42 Additional investigation with convalescent phase saliva and sera are needed to determine the stability of SARS-CoV-2-specific IgG responses. Third, we did not have information on severity of SARS-CoV-2 disease from each participant in this study, and thus were not able to determine the impact of severity of infection on antibody responses.29 Prior studies suggest that antibody responses are slightly elevated among individuals with severe infection.29,30,42 Future analysis should determine how severity of infection, and infectious dose, modifies antibody responses. Fourth, we did not determine receiver operating characteristic (ROC)-optimized MFI cut offs...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.03.074781: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Although values greater than 100% were observed in the experimental binding assay (and are valid)10, the assay is bounded above by an unknown quantity that in our estimation should correspond to the inverse of the ratio of immunoprecipitated ACE2 by the C-terminal tag antibody to the total amount of ACE2 in the sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C-terminal tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average overlap per residue was pulled into Jalview as features from Chimera with the Fetch Chimera attributes function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative results were extracted from figures in Li et al.10 with WebPlotDigitizer 4.240.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebPlotDigitizer</div><div>suggested: (WebPlotDigitizer, RRID:SCR_013996)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We transcribed data for additional mutants from Li et al.10 that were not reported in UniProt.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wild-type and mutant models were downloaded from the server as PyMol sessions and detailed structural comparisons were conducted with PyMol20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enumerating possible ACE2 missense SNPs: The ACE2 gene (ENSG00000130234) was retrieved from Ensembl in Jalview14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biopython was used to process sequence data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses were coded in Python in Jupyter Notebooks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Numpy, Pandas and Scipy were used for data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>Scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matplotlib and Seaborn were used to plot data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04287686</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recombinant Human Angiotensin-converting Enzyme 2 (rhACE2) a…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.07.14.202028: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were routinely tested for mycoplasma and found negative.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Mouse monoclonal antibodies (mAb): IFITM1 (#60074-1-Ig, Proteintech) 1:250 for FACS, and IF; IFITM2/3 (#66081-1-Ig, Proteintech) 1:250 for FACS, and IF; ACE2 (AC18F) (#AG-20A-0032-C100 – adipogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFITM1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IF</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit polyclonal antibodies: FLAG-Tag DYKDDDDK (D6W5B) (#14793, Cell Signaling) 1:800 for FACS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG-Tag DYKDDDDK</div><div>suggested: (Acris Antibodies GmbH Cat# AP08111PU-N, RRID:AB_1616157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat polyclonal antibodies: ACE2 (AF933 – R&D).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS_Ssd3 702 antibody was used at 0.5 μg/ml for FACS and IF. Human Mab: Anti-SARS-CoV2 monoclonal antibodies 48 and 71 recognize the S1 and S2 domains of the S protein, respectively (Planchais et al, manuscript in preparation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were diluted in WB-buffer (PBS, 1% BSA, 0.05% Tween, 0.01% Na Azide): goat anti-human ACE2 (R&D cat#AF933, 1:2000), mouse anti-human ACE2 (Adipogen AC18F cat #AG-20A0032-C100, 1:1000), rabbit anti-human TMPRSS2 (Atlas antibodies cat# HPA035787, 1:1000), mouse anti-Flag tag (Sigma cat# F1804, 1:1000), rabbit anti-human actin (Sigma cat#A2066, 1:2000), mouse ascite anti-SARS S, (1:1000) (Siu, 2008 #4573).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: (Enzo Life Sciences Cat# ALX-804-715B-C050, RRID:AB_2050611)</div></div><div style="margin-bottom:8px"><div>anti-human TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Flag tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human actin</div><div>suggested: (AMSBIO Cat# MA1000, RRID:AB_10920236)</div></div><div style="margin-bottom:8px"><div>anti-SARS S,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral and Retroviral vectors: For lentiviral production, 293T cells were co-transfected with pLenti6 or pLV derived vectors, packaging plasmid R8-2 and VSV-G plasmid as previously described 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GFP-Split fusion assay: For fusion assays with S-expressing cells, 293T-GFP1-10 and 293T-GFP11 cells (6×104 cells/well cells mixed at a 1:1 ratio) in 96 well plates (μClear, #655090) were transfected in suspension using Lipofectamine2000 (Thermo) with 100 ng of DNA. 10 ng of phCMV-SARS-CoV2-S, 25 ng of pCDNA3.1-hACE2, 25 ng of pCSDest-TMPRSS2 and 40 ng of pQCXIP-Empty or pQCXIP-IFITM-N-FLAG were used and adjusted to 100 ng DNA with pQCXIP-Empty.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-GFP11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For donor cells, 293T-GFP1-10 cells were transfected with 10 ng of phCMV-SARS-CoV2-S, ±10 ng pCSDest-TMPRSS2, ±20 ng pQCXIP-IFITM-N-FLAG and adjusted to 50 ng with pQCXIP-Empty.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-GFP1-10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">U2OS viral mediated cell-cell fusion, video microscopy and immunofluorescence: U2OS-ACE2 GFP1-10 or GFP11 stably expressing TMPRSS2, IFITM1, 2, 3 or control cells were mixed (1:1 ratio) and plated at 8×103 cells per well in a 96 well plate (μClear, #655090), 24 h before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titration of viral stocks was performed on Vero E6, with a limiting dilution technique allowing a calculation of DCP50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: pQCXIP-Empty control plasmid and pQCXIP-IFITM1-N-FLAG, pQCXIP-IFITM2-N-FLAG, pQCXIP-IFITM3-N-FLAG plasmids were described 42. pQCXIP-BSR-GFP11 and pQCXIP-GFP1-10 were from Yutaka Hata 51 (Addgene plasmid #68716; http://n2t.net/addgene:68716; RRID:Addgene_68716 and Addgene plasmid #68715; http://n2t.net/addgene:68715; RRID:Addgene_68715).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68716)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68715)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.1-hACE2 was from Hyeryun Choe 52 (Addgene plasmid # 1786; http://n2t.net/addgene:1786; RRID:Addgene_1786).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_1786)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCSDest-TMPRSS2 was from RogerReeves 53 (Addgene plasmid # 53887; http://n2t.net/addgene:53887; RRID:Addgene_53887).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_53887)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pLenti6-H2B-mCherry was from Torsten Wittmann 54 (Addgene plasmid # 89766; http://n2t.net/addgene:89766; RRID:Addgene_89766).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_89766)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GFP area was quantified on ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were quantified and processed using ImageStudioLite software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageStudioLite</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Flow cytometry data were analyzed with FlowJo v10 software (TriStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were drawn on Prism 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was conducted using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 13, 14, 16, 22, 23 and 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
SciScore for 10.1101/2020.06.14.150607: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After obtaining informed consent, serum was obtained by venipuncture (BD Vacutainer, serum), centrifuged, aliquoted and stored at -80°C prior to use.<br>IRB: Protocol approval was obtained by the Institutional Review Board (protocol IRB# 2016-6137) of the Albert Einstein College of Medicine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVID-19 convalescence sera samples (2, 3, 5, 6, 7) were previously validated to be negative with RT-PCR for SARS-CoV-2 and positive ELISA for antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The arrays were rinsed with 5% milk-PBST briefly and incubated for 1 hour at room temperature with a fluorescently labeled secondary antibody (Alexa Fluor 647 labeled goat anti-human IgG (H+L) cross-adsorbed secondary antibody, Thermo Fisher Scientific, Cat # A21445) diluted 1:150 in 5% milk-PBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Molecular Probes Cat# A-21445, RRID:AB_2535862)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with a PE-labeled anti-6x His tag antibody (Abcam Cat # ab72467), to detect Spike protein binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x</div><div>suggested: (Abcam Cat# ab72467, RRID:AB_1267596)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 45 minutes, cells were pelleted and washed twice, and then incubated with an anti-HIS PE antibody, washed twice, and analyzed on a SONY Spectral Analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIS PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of hACE2, mACE2, CD147, CD26, Siglec9, Siglec10, Ceacam1, and Ceacam5 were confirmed by antibody staining of transfected HEK293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD147</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Siglec10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ceacam1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ceacam5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used: hACE2 and mACE2 (RND Cat # AF933-SP), CD147 (Biolegend Clone HIM6), CD26 (Biolegend Clone BA5b), Siglec9 (Biolegend Clone K8), Siglec10 (Biolegend Clone FG6), Ceacam1 and Ceacam5 (Biolegend Clone ASL-32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD26</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Siglec9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293F Transient Transfections and Culture: HEK 293 suspension cells were cultured in HEK Freestyle Media (Invitrogen) at 37 C in a humidified shaking platform incubator (Kuhner) with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-throughput Screening of Human Plasma Membrane Protein Library: The human plasma membrane protein library was transfected into HEK293F cells in 48-well format.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nickel eluates were concentrated by centrifugation in 100K concentrator (ThermoFisher Cat # 88533) by spinning at 1100 g for intervals of 8 minutes (if necessary) and further purified by gel filtration on a HiLoad™ 16/600 Superdex™ 200 column (GE) equilibrated with 50 mM TRIS, 100 mM ArgCl, 150 mM NaCl, 10% Glycerol, pH 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentration was determined using an extinction coefficient (1468500 M-1cm-1) estimated from amino acid sequence by Expasy online ProtParam tool[20]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentration was determined using an extinction coefficient (33350 M-1cm-1), estimated from amino acid sequence by Expasy online ProtParam, and was further analyzed by SDS-PAGE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expasy online ProtParam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting supernatant was purified on an AKTA FPLC (GE Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was exported in Excel, and then analyzed and graphed by GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The program Prism v8 was used to generate the AUC figures shown in the text and supplement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Absorption was measured at OD450 using a Synergy4 plate reader (Biotek), and data was analyzed using GraphPad Prism7.0 to calculate IC50 values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:It is important to note the limitations of the current platform. In particular, we stress that at present this is a qualitative approach, as a number of variables can impact the ability to detect antibody reactivity, including patient titers for specific antigens and the relative affinities of an antigen-specific pool. Furthermore, it should be appreciated that the current platform is programmed to detect the capture of IgG antibodies; thus, the resultant signal (or lack thereof) for a particular antigen could be the consequence of prevalences between different isotypes (IgA, IgD, IgE, IgG, IgM), which are known to evolve during the course of infection and subsequent resolution. Although currently focused on three antigens, this platform can be readily expanded to study differential antibody responses to different SARS-CoV-2 antigens and subdomains of those antigens amongst individuals, which are actively being investigated by others [52-55]. We are currently working to include not only other antigens from SARS-CoV-2 (E protein, M protein, etc.), but also antigens from other coronaviruses that may be cross reactive with SARS-CoV-2 antibodies. The analysis of antibody reactivity to multiple SARS-CoV-2 and related antigens will provide broad insight into the humoral immune response to SARS-CoV-2. Collectively, we provide standards and metrics for high quality protein reagents that can yield comparable clinical, biological and structural data as we continue to combat the global ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.09.141580: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The experiments were carried out using the protocols approved by the Scientific Ethics Committee of Huazhong Agricultural University (permit number: HZAUSW-2018-009).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal immunization: Female BALB/c mice aged 6 weeks were immunized with different proteins at 0 and 3 weeks.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, horseradish peroxidase (HRP)-conjugated goat anti-mouse/rabbit IgG (1:10,000 diluted in PBST with 1% BSA (w/v), Boster) was used as the secondary antibody, and 3,3’,5,5’-tetramethylbenzidine (TMB) (Beyotime) was used as the substrate for detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse/rabbit IgG</div><div>suggested: (Biorbyt Cat# orb27530, RRID:AB_10954533)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the mouse anti-Strep-tag II antibody (SAB, 1:3,000 diluted in PBST with 1% BSA (w/v)) and HRP-conjugated goat anti-mouse IgG (1:5,000 diluted in PBST with 1% BSA (w/v), Boster) was used for detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep-tag II</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three days after the last injection, spleen cells were collected and fused with SP2/0 cells with PEG1450 (Sigma-Aldrich, P7181) to generate hybridoma cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SP2/0</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production and entry assay of pseudoviruses: Pseudo-typed viruses were produced as previously described (50), 293T (ATCC, CRL-3216), Huh-7 and Vero (ATCC, CCL-81) cells were maintained in high glucose DMEM (Gibco, USA) supplemented with 10% FBS (FBS; Natocor, Argentina), penicillin (100 IU/ml) and streptomycin (100 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal immunization: Female BALB/c mice aged 6 weeks were immunized with different proteins at 0 and 3 weeks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, structure-based B-cell epitope prediction was performed by DiscoTope 2.0 with a positive cutoff greater than −3.7 (corresponding to a specificity greater than or equal to 0.75 and a sensitivity less than 0.47) using the following protein structures: the HCoV-229E S-trimer and RBD (PDB IDs: 6U7H and 6ATK, respectively), the SARS-CoV S-trimer and RBD (PDB IDs: 5X5B and 2AJF, respectively), the SARS-CoV-2 S-trimer and RBD (PDB IDs: 6VYB and 6M0J, respectively), the PEDV RBD (PDB ID: 6U7K), the FIPV RBD (PDB ID: 6JX7), the PRCoV RBD (PDB ID: 4F5C), and the transmissible gastroenteritis virus (TGEV) RBD (PDB ID: 4F2M).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DiscoTope</div><div>suggested: (DiscoTope, RRID:SCR_018530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the predicted residues were then labeled in corresponding structures using PyMOL (Schrödinger).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, the amino acid sequences of alpha-CoVs RBDs were aligned using ClustalW2 (52).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW2</div><div>suggested: (ClustalW2, RRID:SCR_002909)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.13.149930: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of S protein, the membrane was incubated with anti-HA tag mouse monoclonal antibody (bimake, USA, 1:2000), and the bound antibodies were detected by Horseradish Peroxidase (HRP)-conjugated goat anti-mouse IgG (Abbkine, China, 1:5,000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of HIV-1 p24 in supernatants, monoclonal antibody against HIV p24 (p24 MAb) was used as the primary antibody at a dilution of 1:8,000, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of 20 ACE2s in HeLa cells, Mouse anti-His tag monoclonal antibody (Bioworld, USA, 1:5000) was used as the first antibody, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and plasmids: HEK293T and HeLa cells were obtained from the American Tissue Culture Collection and cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) in a humidified 5% CO2 incubator at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of 20 ACE2s in HeLa cells, Mouse anti-His tag monoclonal antibody (Bioworld, USA, 1:5000) was used as the first antibody, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: Multiple sequence alignment was performed for the whole aa sequences of ACEs using MAFFT with a local alignment strategy FFT-NS-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The phylogenetic tree was constructed by MEGA7 using the neighbor-joining (NJ) method with 1,000 bootstrap replicates and visualized using FigTree.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.03.29.013490: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A primary anti-spike rabbit monoclonal antibody (40150-R007, Sino Biological, 1:100) and a goat anti-rabbit secondary antibody (Alexa Fluor 488, Invitrogen, Thermo Fisher Scientific) were employed to stain 2019-nCoV S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: (Sino Biological Cat# 40150-R007, RRID:AB_2827979)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A primary anti-His-tag mouse monoclonal antibody (AF5060, Beyotime, 1:1000) and a goat anti-mouse secondary antibody (A0216, Beyotime, 1:2000) were employed to detect S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (AnaSpec; EGT Group Cat# 29673-1000, RRID:AB_11232932)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Beyotime Cat# A0216, RRID:AB_2860575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">β-actin determined by a mouse monoclonal antibody (AA128, Beyotime, 1:1000) was used as a reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AA128</div><div>suggested: (Beyotime Cat# AA128, RRID:AB_2861213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence microscopy: Caco-2 and HK-2 obtained from the cell bank of Chinese Academy of Sciences (CAS, Shanghai) and cultured in Dulbecco’s modified Eagle medium (DMEM, Gibco, Thermo Fisher Scientific, Shanghai</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.23.165415: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Periplasmic extracts were transferred to a microtiter plates, previously coated with Protein A (Sigma), blocked in TBS-BSA buffer and subsequently incubated with anti-myc antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Suspension adapted HEK293-F cells were grown in 600-ml Bioreactors in 250 ml of serum free FreeStyle medium in an incubator at 37°C with humidified atmosphere at 8% CO2 on an orbital shaker platform rotating at 220 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization Assay: Pseudotyped neutralization assays were adapted from protocols previously validated to characterize the neutralization of HIV 38, but with the use of HEK293T-ACE2 cells as previously described 25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudotyped lentiviruses displaying the SARS-CoV-2 spike protein (harboring an 18 amino acid truncation of the cytoplasmic tail 39) and packaging a luciferase reporter gene were generated by the co-transfection of HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene for RBD expression comprises residues (319 − 566) of 2019-nCoV RBD-SD1 and was cloned into a pαH mammalian expression vector containing a secretion signal, a C-terminal Sortase recognition motif and a non-cleavable Histidine tag 25</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-SD1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biophysical methods: Small angle X-ray scattering measurements (SAXS): The SAXS data were collected at the EMBL P12 beamline of the storage ring PETRA III (DESY, Hamburg, Germany) using a robotic sample changer 41.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBL</div><div>suggested: (ChEMBL, RRID:SCR_014042)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The radial average was performed and solvent scattering was subtracted using the SASFLOW pipeline 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SASFLOW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The distance distributions were computed by GNOM 43 and the overall parameters were determined from the reduced data using relevant programs from the ATSAS suite 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATSAS</div><div>suggested: (ATSAS, RRID:SCR_015648)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hybrid models of the sybodies and of the RBD were constructed by CORAL 45 using the available high-resolution portions as rigid bodies and amending them by chains of dummy residues to represent the fragments not present in the crystal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CORAL</div><div>suggested: (Coral, RRID:SCR_011849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracted particles were imported into cryoSPARC v2.15.0 49 for 2D classification, heterogenous refinement and non-uniform 3D refinement 50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was extended and manually adjusted in COOT 51.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.29.20116004: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent under the Western IRB approved IRB protocol #20180015 to Enable Biosciences.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the testing, the eluent was assayed using a modified Antibody Detection by Agglutination-PCR (ADAP) protocol12–14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ADAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">If present, the SARS-CoV-2 antibodies in the specimen engage with S1-DNA conjugate to agglutinate into a dense immune complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: The SARS-CoV-2 spike protein (S1) containing amino acids 1–674 with an Fc-tag at the C-terminus (#31806), expressed in HEK293 cells, was purchased from the Native Antigen Company (Oxford, United</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.05.131748: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fiberglass pads, absorbent pads and plastic boards were purchased from Shanghai Kinbio Tech. Co. Ltd. Ab1, Ab2, TP52, RP01 antibodies against SARS-CoV-2 spike antigen were provided by Academy of Military Medical Sciences and Sino Biological Inc. (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TP52</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike antibodies were generated by sorting single memory B cells as previously reported19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, anti-CD19, anti-CD38, anti-CD27 and anti-His antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD38,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD27</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fabrication of nanozyme-based chemiluminescence test paper: Anti-S-RBD antibody pairs were screening using ELISA method and nanozyme-based colorimetric strips15.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The paired capture antibody of S-RBD (S-cAb) was immobilized on a nitrocellulose membrane at 1 mg/ml to form the test line (T-line), as well as the anti-human IgG antibody as the control line (C-line).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nanozyme probes uncombined with antigen bound with the control IgG antibody at C-line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>control IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A cDNA sequence encoding S-RBD was expressed containing both N-terminal natural signal peptide as well as a 6×His tag at the C-terminus, after transfection into HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rapid testing of pseudo-SARS-CoV-2: The pseudo-SARS-CoV-2 were packaged by transfecting 293T cells with a HIV-1-based retroviral vector coding SARS-CoV-2 spike S1 protein and luciferase reporter gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody binding affinity for S-RBD was evaluated by BIAcore 8K.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIAcore</div><div>suggested: (Biacore T100 System, RRID:SCR_019679)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.10.05.20206664: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: To minimize recruitment bias, all adults who responded to the invitation email and returned their signed consent form were enrolled sequentially and invited to give a blood sample, without triaging.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sulfo-tag-labelled anti-IgG detection antibody were added and the electrochemiluminescence signal was read using the MSD Sector 600 instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Commercial chemiluminescent (CLIA) antibody assay: Total antibody (IgA, IgG and IgM) against recombinant spike (S1) protein was determined using the VITROS 5600 analyser (Ortho-Clinical Diagnostics, Rochester, NY) according to manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA, IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted in R version 4.0.2, R Studio version 3.6.2 and GraphPad Prism version 8.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:This study has limitations. First, due to the lack of follow-up, findings from this study should not be used to predict whether the antibody reactivity to SARS-CoV-2 in unexposed individuals may confer any immune protection or harm. Second, infection with SARS-CoV-2 prior to 7 days may be underestimated by serology (21). However, this is unlikely to have had a significant effect on our estimates considering the low number of reported cases in BC. Third, the small sample size limited the power for correlation analyses and the precision of estimates of the overall prevalence from a direct SARS-CoV-2 exposure. In conclusion, this study reveals that pre-existing antibody reactivity against SARS-CoV-2 antigens in sera from unexposed adults and in young infants is common, although it has been largely overlooked in previous serology studies. These findings warrant urgent studies of the impact such pre-existing seroreactivity may have on seroconversion following an exposure to SARS-CoV-2, likelihood of acquiring the infection, COVID-19 severity or vaccine responses.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.21.107870: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fondaparinux was purchased from Merck, UK. Goat anti-human ACE2 antibody AF933 (Biotechne), goat control IgG AB-108-C (Biotechne), rabbit anti-human TMPRSS2 (MBS9215011, Gentaur), rabbit IgG control (Biolegend) were used as per manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488, (Invitrogen) for 30 min at 21°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse polyvalent Ig-FITC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The A549 cell line was obtained from the European Collection of Animal Cell Cultures (ECACC) and cultured in DMEM supplemented with 10% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293TACE2 cells were kindly provided by Paul Bieniasz (The Rockefeller University, USA), cultured as described for 293T cells including selection with 5ug/ml blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293TACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A human keratinocyte cell line, HaCaT (300493), was obtained from Cell Line Services (CLS GmbH, Germany) and routinely cultured in DMEM supplemented with 10% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HaCaT</div><div>suggested: CLS Cat# 300493/p800_HaCaT, RRID:CVCL_0038)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Caco2 cell line (ATCC® HTB-37), derived from a colorectal adenocarcinoma, was obtained from Dr. Michael Trikic (University of Sheffield, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: ATCC Cat# HTB-37, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real time quantitative PCR (RT-qPCR): HaCaT, RT4, A549, 293T, 293TACE2 and Caco2 cell lines were cultured for 48hrs under standard media conditions and harvested using trypsin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild-type S1S2 (wt S1S2; Val16-Pro1213; Stratech UK) with a His6 tag at the C-terminus was expressed in baculovirus-insect cells, while S1-Fc (Val16-Arg685; Stratech UK) with a mouse IgG1 Fc region at the C-terminus was expressed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.04.15.042085: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A monoclonal mouse antibody against the C-terminal Myc-tag was purchased from CellSignaling Technology (2276S)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Myc-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A monoclonal mouse anti-beta actin antibody was purchased from Abcam (ab6276)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A monoclonal mouse anti-beta actin antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-beta actin</div><div>suggested: (Abcam Cat# ab6276, RRID:AB_2223210)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 (ATCC® CRL-1586) and HEK293 (ATCC® CRL-1573) cells were maintained in DMEM supplemented with 10 % FCS, antibiotics and glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of multicycle replication kinetics Calu-3 cells were seeded in 12-well plates and grown to 90 % confluence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient expression of SARS CoV-2 S protein in HEK293 cells: For transient expression of SARS-CoV-2 S protein 60 % confluent HEK293 cells were co-transfected with 1.6 µg of pCAGGS-S-Myc-6xHis and either 15 ng of empty pCAGGS vector or pCAGGS-TMPRSS2 using Liopfectamine® 2000 (Invitrogen) according to the manufacturers protocol for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.04.02.021469: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Monoclonal antibody against FLAG tag (ANTI-FLAG M2) and β-Actin were purchased from Sigma (Cat.No. F1804 and A2228, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies</div><div>suggested: (Sigma-Aldrich Cat# A2228, RRID:AB_476697)</div></div><div style="margin-bottom:8px"><div>ANTI-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>β-Actin</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>A2228</div><div>suggested: (Sigma-Aldrich Cat# A2228, RRID:AB_476697)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibody against human IFITM1 (Cat.No. 60047-1), rabbit polyclonal antibody against human IFITM3 (Cat.No. 11714-1-AP), which also efficiently recognizes IFITM2 and weakly cross-reacts with IFITM1, were purchased from Proteintech Group, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IFITM1</div><div>suggested: (Novus Cat# NB 600-471, RRID:AB_535506)</div></div><div style="margin-bottom:8px"><div>human IFITM3</div><div>suggested: (Proteintech Cat# 11714-1-AP, RRID:AB_2295684)</div></div><div style="margin-bottom:8px"><div>IFITM1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse monoclonal antibody against HCoV-OC43 nucleocapsid (NP) protein was purchased from Millipore (Cat.No. MAB9012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-OC43 nucleocapsid (NP) protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HCoV-OC43 nucleocapsid (NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After permeabilization with 0.1% Triton X-100, the cells were stained with a monoclonal antibody (541-8F) recognizing HCoV-OC43 NP protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-OC43 NP protein.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bound antibodies were visualized by using Alexa Fluor 488-labeled (green) goat anti-mouse IgG or Alexa Fluor 555-labeled (red) goat anti-mouse IgG, Cell nuclei were counterstained with DAPI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Human hepatoma cell lines HepG2 and C3A, a sub-clone of HepG2 (ATCC HB-8065) were purchased from ATCC and cultured in DMEM/F12 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: ATCC Cat# HB-8065, RRID:CVCL_0027)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lung cancer cell line A549 were obtained from ATCC and maintained in DMEM supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GP2-293 and Lenti-X 293T cell Lines were purchased from Clontech and cultured in DMEM supplemented with 10% FBS and 1 mM Sodium pyruvate (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flp-In TREx 293 cells were purchased from Invitrogen and maintained in DMEM supplemented with 10% FBS, 10 μg/ml blasticidin (Invitrogen) and 100 µg/ml Zeocin (Invivogen) (64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In TREx 293</div><div>suggested: RRID:CVCL_U427)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flp-In TREx 293-derived cell lines expressing LY6E, GILT, ADAP2, or IFITM3 were cultured in DMEM supplemented with 10% FBS, 5 μg/ml blasticidin and 250 μg/ml hygromycin. Viruses: HCoV-OC43 (strain VR1558) were purchased from ATCC and amplified in HCT-8 cells according to the instruction from ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: ICLC Cat# HTL99005, RRID:CVCL_2478)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Establishment of cell lines stably expressing wild-type and mutant IFITM or LY6E proteins or shRNA: HepG2, C3A or A549 cells in each well of 6-well plates were incubated with 2 ml of Opti-MEM medium containing pseudotyped retroviruses and centrifuged at 20 °C for 30 minutes at 4,000×g.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C3A</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 33. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.28.20105692: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: These were sourced from discarded clinical laboratory specimens exempted from informed consent and IRB approval under condition of patient anonymity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In contrast, samples without neutralizing antibodies will benefit from the strong binding between S1 and ACE2 proteins to generate a large amount of DNA amplicons, thus a stronger qPCR signal (lower Ct).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: The SARS-CoV-2 spike protein (S1) containing amino acids 1-674 with an Fc-tag at the C-terminus (#31806) expressed in HEK293 cells was purchased from the Native Antigen Company (Oxford, United Kingdom).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.11.24.390039: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ipom-F and Antibodies: Ipom-F was synthesised as previously described (Zong et al., in press).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ipom-F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following transfer to a PVDF membrane in transfer buffer (0.06 M Tris, 0.60 M glycine, 20% MeOH) at 300 mA for 2.5 h, PVDF membranes were incubated in 1X Casein blocking buffer (10X stock from Sigma-Aldrich, B6429) made up in TBS, incubated with appropriate primary antibodies (1:500 or 1:1000 dilution) and processed for fluorescence-based detection as described by LI-COR Biosciences using appropriate secondary antibodies (IRDye 680RD Donkey anti-Goat, IRDye 680RD Donkey anti-Rabbit, IRDye 800CW Donkey anti-Mouse) at 1:10,000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6429</div><div>suggested: (LSBio (LifeSpan Cat# LS-B6429-50, RRID:AB_11134145)</div></div><div style="margin-bottom:8px"><div>anti-Goat</div><div>suggested: (LI-COR Biosciences Cat# 926-68074, RRID:AB_10956736)</div></div><div style="margin-bottom:8px"><div>anti-Rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ORF6-OPG2, ORF8-OPG2, M-OPG2 and S-OPG2 were generated by inserting the respective cDNAs in frame between NheI and AflII sites of a pcDNA5/FRT/V5-His vector (Invitrogen) containing a C-terminal OPG2 tag (MNGTEGPNFYVPFSNKTG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-OPG2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsomal translation reactions (20 μL) were performed for 30 min at 30°C whereas those using SP HeLa cells were performed on a 1.5X scale (30 μL translation reactions) for 1 h at 30°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.14.093054: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The animal study has complied with the guidelines of the Institutional Animal Care and Use Committee (IACUC) of the Shanghai Jiao Tong University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: 6-8 weeks old, male, specific-pathogen-free (SPF) C57BL/6 mice were inoculated with VSP, IDLV, or PBS by foot-pad injection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was blocked by 5% fat-free milk dissolved in TBS/0.05% Tween-20 for 1 hr then cut off according to the marker and incubated with anti-flag monoclonal antibody (Sigma) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membranes were incubated with anti-mouse secondary antibodies (Cell Signaling Technology) for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse secondary antibodies ( Cell Signaling Technology ) for 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained by anti-flag tag antibody (Proteintech) followed by Alexa Fluor 555 IgG incubation (Cell Signaling Technology) and nuclei staining with DAPI (Beyotime Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flag tag</div><div>suggested: (Cell Signaling Technology Cat# 3768, RRID:AB_1642183)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell cultures: 293T and Huh-7 cells were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin/streptomycin (P/S) (Thermo Fisher Scientific,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were differentiated into macrophage-like cells with 150 nM phorbol 12-myristate 13-acetate (PMA) (Sigma) before the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 cells were subsequently lysed with 50 μL lysis reagent (Promega), and 30 μL lysates were transferred to 96-well Costar flat-bottom luminometer plates (Corning Costar) for the detection of relative light units using the Firefly Luciferase Assay Kit (Promega) with an Ultra 384 luminometer (Tecan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: 6-8 weeks old, male, specific-pathogen-free (SPF) C57BL/6 mice were inoculated with VSP, IDLV, or PBS by foot-pad injection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A nonlinear regression analysis was performed on the resulting curves using Prism (GraphPad) to calculate half-maximal inhibitory concentration (EC50) values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.09.20127050: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples from negative controls ranged in age from 19 to 66 years of age (median 37) and 18/30 were female (60%).</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Successful coupling was confirmed by staining ∼0.5 μL coupled beads with PE-conjugated anti-HIS tag antibodies (Santa Cruz, CAT #8036, USA) and compared to positive and negative controls by flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIS tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Technical replicates were averaged and data were imported to Prism 8.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are several limitations to our study that should be noted. First, our cases were all relatively mild (none requiring hospitalization or ventilation), and predominantly middle-aged females. Future studies comparing the responses of older or more severely ill subjects would be informative. Secondly, our study focuses solely on binding of ACE2 to the spike protein and ignores other potential antigens or other immune mechanisms such as inhibition of protease cleavage that might prevent viral entry into the cell. The results of our bead-based assay should be confirmed using a pseudovirus assay, or ideally using live SARS-CoV-2 virus. Third, it is unclear what level of inhibition would correlate with functional resistance to re-infection. Follow-up studies tracking inhibition in our assay over time while simultaneously monitoring subjects for re-infection will be necessary, given the ethical impossibility of experimental human inoculation. Finally, our SARS-CoV-2 PCR+, antibody negative samples leave many questions. For example, did they clear the virus through mechanisms beyond our detection, such as antibodies targeted to alternative viral proteins or non-B-cell dependent mechanisms? Or were their rtPCR results false positives? Most importantly, are they susceptible to future infections? Follow-up with these or similar individuals will be important. In conclusion, the trimer inhibition assay presented here could be broadly useful in the settings of routine clinical evaluati...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
biorxiv.org biorxiv.org
-
SciScore for 10.1101/2020.06.27.174953: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal procedures were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, under protocols approved and strictly followed by the Institutional Animal Care and Use Committees (IACUC)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All image data shown are representative of at least three randomly selected fields.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male C57BL/6 mice were obtained from Shanghai SLAC Laboratory Animal Co., Ltd.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were probed with antibodies against HA-Tag (C29F4) (3724, CST, USA), GSDMD (L60) (93709, CST, USA),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-Tag</div><div>suggested: (Cell Signaling Technology Cat# 3724, RRID:AB_1549585)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and treatment: HEK293, MCF-7, Caco2, Vero E6, HeLa, HepG2, SH-SY5Y cells were grown in 90% DMEM basal medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA), 2 mM L-glutamine and 100 units /mL penicillin/streptomycin (Gibco, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCF-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SH-SY5Y</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1% NEAA (Gibco, USA) was added in above medium for A498 cells culture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A498</div><div>suggested: NCI-DTP Cat# A498, RRID:CVCL_1056)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Besides, HCT116 and HT-29 cells were grown in McCoy’s 5A basal medium (Gibco, USA), PC3 and A549 cells were grown in RPMI-1640 basal medium (Hyclone, USA) and CHO cells were grown in DMEM/F-12 basal medium (Gibco, USA) supplemented as above. 16HBE cells were grown in KM (ScienCell, USA) medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT116</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HT-29</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PC3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male C57BL/6 mice were obtained from Shanghai SLAC Laboratory Animal Co., Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The percentages of differently labeled cells were calculated by FlowJo 7.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MS raw data were analyzed with MaxQuant (http://maxquant.org/,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The currents were digitized using pClamp 10.2 software (Molecular Devices, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pClamp</div><div>suggested: (pClamp, RRID:SCR_011323)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:One limitation of our study is the lack of evidence in the context of SARS-CoV-2 infection in vivo, which can technically be achieved by generating of SARS-CoV-2 without 2-E using reverse genetics. However, the 2-E deleted SARS-CoV-2 may replicate more effectively and thus this experiment was not conducted. Although the in vivo antiviral activity of the newly identified channel inhibitors needs further studies, their potent antiviral activity in vitro and excellent protection effects against ARDS-like damage in vivo shed light on the drug development of 2-E channel inhibitors. Given that 2-E can function as ion channels in the viral membranes, similar to how they function in host cells, we propose that 2-E channels may represent a new class of dualfunction targets against SARS-CoV-2.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.04.10.036418: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Immunizations and sera collection: All rats used in these studies were handled and maintained in accordance with NIH guidelines and approved by Institutional Animal Care and Use Committee (IACUC) of Scripps Research (Protocol 18-025).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hACE2 expression was confirmed by SARS1-PV and SARS2-PV entry assays and by immunofluorescence staining using mouse monoclonal antibody recognizing c-Myc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were stained with anti-rabbit IgG-Alexa647 antibody for 45 minutes at 4°C, and mean fluorescence intensities were measured for each well by flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG-Alexa647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune plasma to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-ACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD64</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-hACE2 cells were selected and maintained with medium containing puromycin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein Production: Expi293 cells (Thermo-Fisher) were transiently transfected using FectoPRO (Polyplus) with plasmids encoding SARS-CoV2 RBD with a human or rabbit-Fc fusion or a C-terminal C-tag (-EPEA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One hour later, 104 ACE2-239T cells were added along with DEAE-Dextran (final concentration 5 µg/ml), and media was exchanged 6 hours later with fresh media without rat sera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-239T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune plasma to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-ACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human monocytic cell line K562 (ATCC CCL-243), which endogenously expresses FcγRII, was also used for ADE assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: ATCC Cat# CCL-243, RRID:CVCL_0004)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: The statistical significance of differences between preimmune and immune sera, or ACE2-Ig, in their abilities to neutralize, bind the S protein, and mediate ADE was analyzed by two-way ANOVA calculated using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.04.10.032342: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with 5 μg/mL RBD-Fc proteins at 37 °C for 10 min, washed three times, and then stained with 2 μg/mL Alexa488 conjugated goat anti-mouse IgG secondary antibody (Invitrogen, Cat. No. A-11001) at room temperature for 20 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-S-tag expression was detected by using 6.2, a mouse anti-S-tag monoclonoal antibody (Invitrogen, Cat. No. MA1-981), and an HRP-conjugated goat anti-mouse IgG Fc secondary antibody (Invitrogen, Cat. No. 31437).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-tag</div><div>suggested: (Thermo Fisher Scientific Cat# MA1-981, RRID:AB_347008)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-C9-tag expression was then detected by using 1D4, a mouse anti-C9-tag monoclonal antibody (Invitrogen, Cat. No. MA1-722), and the HRP-conjugated goat anti-mouse IgG Fc secondary antibody (Invitrogen, Cat. No. 31437).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-C9-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-based stable cells expressing human ACE2 were maintained under the same culture condition as 293T, except that 3 μg/mL of puromycin was added to the growth medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-based</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293F cells for recombinant protein production was generously provided by Dr. Yu J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of reporter retroviruses pseudotyped with coronavirus spike proteins or VSV-G: 293T cells were seeded at 30% density in 150 mm dish at 12-15 hours before transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using two-sided two-sample Student’s t-test using GraphPad Prism 6.0 software when applicable.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 12. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.06.02.130161: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In brief, the adult male alpaca Tyson at PreClinics, Germany, was immunized 4 times in a 60-day immunization schedule.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines used for experiments were negative for Mycoplasma as determined by PCR.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound nanobodies were detected with anti-E tag (Bethyl laboratories) secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-E tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with anti-dsRNA antibody (1:2000, J2 Scicons) for 1 hour at room temperature followed by 1 hour staining with the secondary antibody anti-mouse-Alexa Fluor 488 (1:2000, Thermo Fisher Scientific), Hoechst (1:1000, Invitrogen) and Ty1-AS635P (0.05 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (Millipore Cat# MABE1134, RRID:AB_2819101)</div></div><div style="margin-bottom:8px"><div>anti-mouse-Alexa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A HEK293T cell line engineered to overexpress human ACE2 (HEK293T-ACE2) was generated by the lentiviral transduction of HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TG1 cells (Lucigen) were transformed with this library by electroporation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TG1</div><div>suggested: RRID:CVCL_0P34)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 15,000 HEK293T-ACE2 cells were then added to each well and the plates were incubated at 37°C for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence: Vero E6 cells were seeded onto coverslips in a 24-well plate and incubated overnight at 37°C/5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence was quantified using a BD FACSCelesta and the FlowJo software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coverslips were mounted in mounting media and images were obtained using Zeiss Axiovert microscope and processed using Adobe Photoshop.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracted particles were imported into cryoSPARC v2.15.036 for 2D classification, 3D classification and non-uniform 3D refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure refinement and manual model building were performed using COOT and PHENIX44 in interspersed cycles with secondary structure and geometry restrained.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
doi.org doi.org
-
SciScore for 10.1101/2020.03.26.010165: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Immunizations and handling of the llama were performed according to directive 2010/63/EU of the European parliament for the protection of animals used for scientific purposes and approved by the Ethical Committee for Animal Experiments of the Vrije Universiteit Brussel (permit No. 13-601-1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Periplasmic ELISA screen to select MERS- and SARS-CoV directed VHHs: After panning, 45 individual colonies of phage infected bacteria isolated after the first panning round on MERS-CoV S-2P or SARS-CoV-1 S-2P protein and 45 individual colonies isolated after the second panning round on MERS-CoV S-2P or SARS-CoV-1 S-2P protein were randomly selected for further analysis by ELISA for the presence of MERS-CoV and SARS-CoV-1 specific VHHs, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Llama immunization: A llama, negative for antibodies against MERS-CoV and SARS-CoV-1 S glycoprotein, was subcutaneously immunized with approximately 150 µg recombinant SARS-CoV-1 S-2P protein on days 0, 7, 28 and 150 µg recombinant MERS-CoV S-2P protein on days 14 and 28 and 150 µg of both MERS-CoV S-2P and SARS-CoV-1 S-2P protein on day 35 (Kirchdoerfer et al., 2018; Pallesen et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-1 S glycoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the PE-ELISA screen after panning on SARS-CoV-1 S protein wells of microtiter plates (type II, F96 Maxisorp, Nuc) were coated with 100 ng SARS-CoV-1 S-2P protein (with foldon), SARS-CoV-1 S-2P protein captured with an anti-foldon antibody (with foldon) or as negative controls coated with MERS-CoV S-2P (without foldon), HCoV-HKU1 S-2P (without foldon), DS-Cav1 (with foldon) or bovine serum albumin (BSA, Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-foldon</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding was detected by incubating the plates sequentially with either mouse anti-Histidine Tag antibody (MCA1396, Abd Serotec) followed horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2000, NXA931, GE Healthcare) or Streptavidin-HRP (554066, BD Biosciences) or by an HRP-linked rabbit anti-camelid VHH monoclonal antibody (A01861-200, GenScript).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Histidine Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MCA1396</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG ( 1/2000 , NXA931 , GE Healthcare )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Streptavidin-HRP</div><div>suggested: (BD Biosciences Cat# 554066, RRID:AB_2868972)</div></div><div style="margin-bottom:8px"><div>anti-camelid VHH</div><div>suggested: (GenScript Cat# A01860, RRID:AB_2734123)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of the VHH-72-Fc and VHH-72-Fc (S) to cells was determined by an AF633 conjugated goat anti-human IgG antibody and binding to SARS-CoV-1 or SARS-CoV-2 S was calculated as the mean AF633 fluorescence intensity (MFI) of GFP expressing cells (GFP+) divided by the MFI of GFP negative cells (GFP-).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (R and D Systems Cat# AF633, RRID:AB_355491)</div></div><div style="margin-bottom:8px"><div>SARS-CoV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GFP-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen) for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudoviruses expressing spike genes for MERS-CoV England1 (GenBank ID: AFY13307) and SARS-CoV-1 Urbani (GenBank ID: AAP13441.1) were produced by co-transfection of plasmids encoding a luciferase reporter, lentivirus backbone, and spike genes in 293T cells (Wang et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of VHHs were mixed with pseudoviruses, incubated for 30 min at room temperature, and then added to previously-plated Huh7.5 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the VSV pseudotype neutralization experiments, the pseudoviruses were incubated for 30 min at 37 °C with different dilutions of purified VHHs or with dilution series of culture supernatant of 293S cells that had been transfected with plasmids coding for SARS VHH-72 fused to human IgG1 Fc (VHH-72-Fc) or with GFP-binding protein (GBP: a VHH specific for GFP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The incubated pseudoviruses were subsequently added to confluent monolayers of Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, suspension-adapted and serum-free HEK 293S cells were seeded at 3 x 106 cells/mL in Freestyle-293 medium (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatant of non-transfected and VHH-72-Fc transfected HEK293-S cells was applied in a three-fold dilution series in kinetics buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Curve fitting was performed using nonlinear regression (Graphpad 7.0)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting molecular replacement solutions were iteratively rebuilt and refined using Coot, ISOLDE and Phenix (Adams et al., 2002; Croll, 2018; Emsley and Cowtan, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2021.01.13.426626: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were approved by the Institutional Animal Ethics committee (IAEC) (RR/IAEC/61-2019, Invivo/GP/084).<br>IRB: The ethics approval of human clinical samples were approved by Institute Human Ethical Committee (Approval No: CSIR-IGIB/IHEC/2020-21/01) CPE based viral Neutralization assay: Mice and Guinea pig pre-immune (negative control) sera and post boost sera were assayed for virus neutralization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice and Guinea Pig Immunizations: Immunizations of BALBc mice (n=5/group, female, 3-4 weeks old, ∼16-18 g) and Hartley strain guinea pigs (n=5/group, female, 6-8 weeks old, ∼300 g) were performed with freshly adjuvanted (AddaVax™ (vac-adx-10)) protein (1:1 v/v Antigen : AddaVax™ ratio per animal/dose, 20 µg protein in 50 µl PBS (pH 7.4) and 50 µl AddaVax™) (InvivoGen, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimeric RBD, ACE2-hFc and antibody expression constructs: The present trimeric mRBD construct consists of an N-terminal trimerization domain of human cartilage matrix protein (hCMP) (hCMP residues 298-340) (accession number AAA63904) linked by a 14-residue flexible linker (ASSEGTMMRGELKN) derived from the V1 loop of HIV-1 JR-FL gp120 linked to RBD residues 332-532 (accession number YP_009724390.1) with an engineered glycosylation site (NGS) at N532 fused to an HRV-3C precision protease cleavage site linked to a 10x Histidine tag by a GS linker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>gp120</div><div>suggested: (Fitzgerald Industries International Cat# 10R-G114a, RRID:AB_1285924)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression levels were checked using a dot blot analysis with Anti-his tag antibodies conjugated with HRP enzyme.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-his tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPR-binding of hCMP-mRBD analyte to immobilized ACE2-hFc/CR3022: hCMP-mRBD protein kinetic binding studies to ACE2-hFc and CR3022 antibody were performed on a ProteOn XPR36 Protein Interaction Array V.3.1 (Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, three washes were performed (200 µL of PBST/well) and anti-Human IgG secondary antibody (Sigma-Aldrich)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of adherent polyclonal Flp-In stable lines: T25 flasks (5 ml media) having either adherent Flp-In™-293 or Flp-In™-CHO cells (∼80 % confluent) were co-transfected with pOG44 (10 µg) and hCMP-mRBD-HRV-Tg-pcDNA5/FRT/TO (5µg) plasmid DNA using 35 µg of Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, Cat # 11668030) in serum free media as per the manufacturers instruction for 4 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In</div><div>suggested: RRID:CVCL_U423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Thermofisher Scientific Cat# 10687010) for Flp-In™-293 and 750 µg/ ml for Flp-In™-CHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In™-293</div><div>suggested: RRID:CVCL_U421)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tagless protein purification: The spent media from stable hCMP-mRBD-HRV-Tg-Flp-In™-293 or Flp-In™-CHO grown cells contained the expressed protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In™-CHO</div><div>suggested: RRID:CVCL_U424)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum incubated premix samples were serially diluted and plated in duplicates in VeroE6 cell containing 96 well plate (104/well) and cultured for 48/96 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transiently transfected with plasmid DNA pHIV-1 NL4.3Δenv-Luc and Spike-Δ19-D614G by using Profection mammalian transfection kit (Promega Inc) following the instructions in the kit manual.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patient derived convalescent sera (n = 40) were tested for neutralization in both 293T-ACE-2 and Vero/TMPRSS2 cells whereas animal sera were tested only in Vero/TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The correlation coefficients for ACE2-hFc receptor competition, pseudovirus, live virus and 293T-ACE2/VeroE6-TMPRSS2 cell line pseudovirus neutralizations were analysed by Spearman correlation using the GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2/VeroE6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The unbound tagless proteins concentration was determined by absorbance (A280) using NanoDrop™2000c with the theoretical molar extinction coefficient calculated using the ProtParam tool (ExPASy)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div><div style="margin-bottom:8px"><div>ExPASy</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference-free 2D classification using single-particle analysis: The evaluation of micrographs was done with EMAN 2.1 (58).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMAN</div><div>suggested: (EMAN, RRID:SCR_016867)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference free 2D classification of different projections of particle were calculated using simple_prime2D of SIMPLE 2.1 software (59).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SIMPLE</div><div>suggested: (SIMPLE, RRID:SCR_009389)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The p values for ELISA binding titers, neutralization titers, ACE2 receptor competition titers were analysed with a two-tailed Mann-Whitney test using the GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.05.19.104281: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, 10 μg/ml antibody A was captured by anti-human Fc biosensor (ForteBio, cat# 18-5060) until saturation, followed by sequential binding of 10 μg/ml RBD, antibody B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fc biosensor</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To examine if the antibody hits from ELISA screening were still capable of binding to native spike trimer, the individual antibody hit at 5 μg/ml and/or ACE2-mFc was incubated with 1-2 million 1D8 spike+ cells and detected by anti-human-Fc PE (invitrogen, 12-4998-82) and FITC Goat anti-mouse-IgG (Biolegend, cat#405305) or APC Goat anti-mouse-IgG (Biolegend, cat# 405308) following standard FACS protocol and analyzed by Beckman FACS (CytoFLEX, CytExpert2.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-Fc PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse-IgG</div><div>suggested: (Proteintech Cat# 10283-1-AP, RRID:AB_2877728)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay of RBD-antibodies by FACS: To check whether ACE2-Spike interaction can be blocked by the isolated nAbs, individual titrated antibody from 10 ug/ml down to 0.31 ug/ml (2 times down) was incubated with 1-2 spike+ cells for 1 hour at 4°C before adding of 0.02 ug/ml ACE2-mFc followed by FITC conjugated anti-mouse IgG (Biolegend, cat#405305) and the MFI of FITC and positive percentage were collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (BioLegend Cat# 405305, RRID:AB_315008)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of Covid-19 spike-expressing cell line: To express the spike (S) protein of SARS-CoV-2 in mammalian cells, a codon optimized cDNA (GenBank:NC_045512.2) encoding the full-length S protein, a transmembrane motif (TM) and 3xFLAG tag was synthesized and cloned into a pRRL-derived vector (R48) by XbaI/XmaI, yielding pRRL-19S-FLAG-BSD. 293FT cells were transfected with lenti-viral made from SARS-CoV-2 S plasmid and other vectors (pLP-1-Gag/Pol, pLP-2-Rev and pLP-VSVG, all in-house made) containing packaging elements.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One each of Kappa and lambda EHL Library aliquots were mixed and blocked with 4% milk PBS (MPBS), 10 million 293F cells (to deplete potential binders to residual protein contaminated in vendor’s RBD) and 10μg/ml mouse IgG (to deplete mouse Fc binders) before adding the library stock to the RBD-coating wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
-
SciScore for 10.1101/2020.11.18.388934: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Protein immunizations and sera collection in rats: All animals used in these studies were handled and maintained in accordance with NIH guidelines and approved by Institutional Animal Care and Use Committee (IACUC) of Scripps Research (Protocol 18-025).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hACE2 expression was confirmed by SARS1-PV and SARS2-PV entry assays and by immunofluorescence staining using mouse monoclonal antibody recognizing c-Myc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were stained with anti-rabbit IgG-Alexa647 antibody for 45 minutes at 4°C, and mean fluorescence intensities were measured for each well by flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG-Alexa647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune sera to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-hACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD64</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-hACE2 cells transduced with MLV vectors were selected and maintained with medium containing puromycin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein Production: Expi293 cells (Thermo-Fisher) were transiently transfected using FectoPRO (Polyplus) with plasmids encoding SARS-CoV2 RBD with a human or rabbit-Fc fusion or a C-terminal C-tag (-EPEA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mouse studies, one hour later, 104 ACE2-239T cells were added and spun at 3000×g for 30 minutes at 4°C, was then returned to 37°C, and media was exchanged 2 hours later with fresh media without mouse sera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-239T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune sera to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-hACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human monocytic cell line K562 (ATCC CCL-243), which endogenously expresses FcγRII, was also used for ADE assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: ATCC Cat# CCL-243, RRID:CVCL_0004)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female 8 to 9-week-old BALB/cJ mice were electroporated with 60 μg DNA in each hindquarter for a total dose of 120 μg on day 0 and day 14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/cJ</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
stackoverflow.com stackoverflow.com
-
Include the following <meta> tag in the document <head>: <meta name="viewport" content="width=device-width, initial-scale=1"> This will correctly establish the view frame, and thus eliminate the need for "FontBoosting".
- web - gotcha : fontboosting
-
-
drive.google.com drive.google.com
-
The@featurewehavejustdiscussedhelpedpeopleorganizeintopairsandcreateconversationalstreams.
The only time I really used the @ symbol, is really just to tag friends In pictures online or tag them in a video so it will pop up in their notifications. Never really looked at it as a pairing tool but more of a social tool.
-
-
vitalik.ca vitalik.ca
Tags
Annotators
URL
-
-
impedagogy.com impedagogy.com
-
the Hypothes.is extension called “Fetch”:
Browser extension for fetching and formatting Hypothes.is annotations into markdown bullet points, ready for copying into Roam, Notion or similar apps.
Here are our annotations so far fetched by Fetch:
Muse Matters
Source: https://impedagogy.com/wp/blog/2021/03/19/muse-matters/
- ^^Please respond in any way you wish to the blog post. I will take our responses and share them in another blog post as well as use the responses for remix, sharing, and other creative uses. Please tag your responses if it seems appropriate.^^
- Muse
- ^^Reminded of Chapter 11 in The Odyssey: I am likely going to retire this year and I find resonance in this as it appears that I will be accepting a "voluntary" buyout at the end of this fiscal year. My long sea journey, 25 years worth in teaching, will be officially over. Hence...the appeal to propitiate the gods, to let all the pain go, to ask forgiveness of the implacable Poseidon. ^^
- then convert that
- "then have them convert that"
- describe how you might go about creating a poem, short story, or play from the blog post.
- ^^I am always a little surprised by how few students choose this option. I should ask them. ^^
- ^^Please respond in any way you wish to the blog post. I will take our responses and share them in another blog post as well as use the responses for remix, sharing, and other creative uses. Please tag your responses if it seems appropriate.^^
-
Please respond in any way you wish to the blog post. I will take our responses and share them in another blog post as well as use the responses for remix, sharing, and other creative uses.
Please tag your responses if it seems appropriate.
Tags
Annotators
URL
-
-
twitter.com twitter.com
-
So few retweets and likes. Yet it is IHO is the best thing since sliced bread: https://hyp.is/z4Pv0IiUEeuXsdeOc5Pikw/hackernoon.com/tagspaces-the-welcome-screen-is-a-welcome-sight-yh383572… Privacy focused Open Core no-backend n- vendor lock-in Cloudless Computing Stable Reliable Continuity It's Own Ecosystem photo, file, tag organizer gateway to cloud storage
- about : TagSpaces
-
-
twitter.com twitter.com
-
You can always see the latest SocArXiv papers on COVID-19 topics here: https://bit.ly/2XNVF7b. You can comment using the @hypothes_is tool, and endorse using the @PlauditPub button. And add your own work, using the covid-19 tag.
-
SocArXiv. (2020, May 30). You can always see the latest SocArXiv papers on COVID-19 topics here: Https://t.co/pzqftUqY81. You can comment using the @hypothes_is tool, and endorse using the @PlauditPub button. And add your own work, using the covid-19 tag. Https://t.co/owGxoaDfsJ [Tweet]. @socarxiv. https://twitter.com/socarxiv/status/1266796731527806983
-
-
-
Here are my thoughts: making vim startup time shorter is GOOD added complexity - BAD my main concern is with the complexity that gets added to get startup time improvements. User has to tag scripts, and then manually BundleBind to get scripts loaded. This seems like too much hassle(manual involvement) to me. Fixing 1 time thing (startup) we're adding many more (like BundleBinding required scripts once they're used) For instance in my case i don't start Vim often because i'm using --remote-tab-silent option. So i'll get no benefit along with complexity (
-
-
loganhr.online loganhr.online
-
Partnering with businesses to help them think forward,guide their people onward, and grow upwards
Maybe a little long for tag line? Although haven't come up with anything else?
-
-
drive.google.com drive.google.com
-
Theaggregation,andcounting,ofthesemarkersofconversationalitycreatedanewsetofmetrics,andwiththatanewsetofaspirationsandex-ploitsthatcontinuetoreshapetheplatform.
I remember being younger and getting an adrenaline rush whenever I would get a mention or someone would tag me in something. I think it's because it's a different way of showing someone that you are thinking about them.
-
Thisuseofthe@symbolprecedinganotherusersnamestartedtobecomearegularconventionforaddressingotherusers
From my time on Twitter, this has been the most common way "@" was used - to "tag" a certain account.
-
Thisgavethe@symbolbothlocativeandcommunicativeproperties,specifyingwhereamessageshouldgo,andalsoforwhomitwasmeant
Like it was stated above. the @ symbol can be used to tag somebody or an account and it can be used to show a location! There is many different meanings to it!
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.01.433503: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and reagents: Antibodies used in this study include: SARS-CoV-2 spike (GeneTex, Taiwan), HA tag, EEA1 (Cell Signaling Technology, Danvers, MA), HIV-p24 (SinoBiological, Beijing, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA tag , EEA1 ( Cell Signaling Technology , Danvers , MA)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV-p24</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PI4P and PI(4,5)P2 antibodies were purchased from Echelon Biosciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PI(4,5)P2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and constructs: Huh 7, Vero E6 and 293T cells were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2 stable cell lines were generated by transfecting 293T cells with pSMPUM-ACE2 and selected with blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For phosphatase inhibition test, 293T-ACE2 cells were first transfected with Sac1 or INPP5E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.03.05.21249174: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The email provided information about the study and links to a screening eligibility survey, informed consent document, initial survey regarding COVID-19 risk factors, and information regarding shipping addresses.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 1,001 individuals were then randomly selected to receive a sampling kit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were then assayed for SARS-CoV-2 antibodies according to published protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Batches were control for purity by SDS-PAGE followed by Coomassie staining and ELISA using an anti His-tag monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were tested against IgG and positive samples were confirmed and tested with anti IgM antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">18,19 The RBD protein was produced in-house via transfection of HEK293T cells using polyethylenimine (Plasmid was a generous gift from Pr. F. Kramer mount Sinai School of Medicine).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All survey responses were collected and stored in REDCap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:These results reinforce results from other studies: asymptomatic illness is an important contributor to observed force of infection; and important limitations of testing availability at the time of survey. Differing antibody dynamics have been reported in other studies. A number of studies have found sustained antibody levels for over 3 months,29,30 while others have found IgG levels can remain 6 months or more.31–33 An additional study has reported rapid waning of routine serological markers in individuals who had lower initial antibody responses.34. Only 7.1% of those with high titers at baseline seroreverted to a level below the threshold for positivity within 60 days, compared to 64.9% of those with lower titers at baseline.34 Evidence for IgM seropositivity was not detected in any of IgG positive samples, which is consistent with results from other surveys studies that included asymptomatic or subclinical populations due to rapidly waning titers.32,35 Studies have shown that IgM levels decline more rapidly after infection than IgA and IgG levels, 30,36,37, and this is especially apparent with asymptomatic and sub-clinical infections.32,35 Trends in the patterns of SARS-CoV-2 antibody levels vary greatly depending on the timing of sampling and severity of disease.31,32,35 Seroconversion times vary depending on the study, but one study found a median time-to-seroconversion for IgM of 8 days and median seroconversion for IgG of 10 days. Additionally, the SARS-CoV-2 IgG resp...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- Thank you for including a protocol registration statement.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.08.433449: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were in compliance with the German animal protection law and approved by the animal welfare committee of the Regierungspräsidium Freiburg (permit G-20/91).<br>IRB: Housing conditions and experimental procedures were approved by the ethics committee of animal experimentation of KU Leuven (license P065-2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In brief, female Syrian hamsters (Mesocricetus auratus) of 6-8 weeks’ old were anesthetized with ketamine/xylazine/atropine and inoculated intranasally with 50 µL containing 2×106 TCID50 SARS-CoV-2 BetaCov/Belgium/GHB-03021/2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Open reading frames corresponding to the light and heavy chains of the hIgG1 anti-SARS-CoV-2 antibody S309 were ordered synthetically at IDT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding was detected by incubating the plates sequentially with either mouse anti-Histidine Tag antibody (MCA1396, Abd Serotec) followed by horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2000, NXA931, GE Healthcare) or Streptavidin-HRP (554066, BD Biosciences) or by HRP-linked rabbit anti-human IgG (A8792, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Histidine Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MCA1396</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG ( 1/2000 , NXA931 , GE Healthcare )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Streptavidin-HRP</div><div>suggested: (Cell Signaling Technology Cat# 3999, RRID:AB_10830897)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of human monoclonal antibodies palivizumab, CB6, and S309 and VHH72-Fc or variants thereof was detected with an AF633 conjugated goat anti-human IgG antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CB6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VHH72-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of monomeric VHHs to SARS-CoV-1 or SARS-CoV-2 S was detected with a mouse anti-HisTag antibody (AbD Serotec) and an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HisTag</div><div>suggested: (RevMAb Biosciences Cat# 54-1161-00, RRID:AB_2716428)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen) for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, a pre-screen was undertaken to determine the levels of background binding of the test antibody to untransfected HEK293 cells, and to slides spotted with gelatin +/- SARS-CoV-2 spike protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-His monoclonal antibody was immobilized on S sensor chip CM3 by covalent coupling and used to capture the His-tagged Fcγ receptors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing in PBS, the cells were fixed in 1% PFA, washed twice with PBS, blocked with 1% BSA and stained with dilution series of anti-RBD antibodies or palivizumab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of the antibodies was detected using Alexa fluor 633 conjugated anti-human IgG antibodies (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of the surface-displayed myc-tagged RBDs was detected using a FITC conjugated chicken anti-myc antibody (Immunology Consultants Laboratory, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where data are labeled as ‘XVR011’, protein material manufactured from a stable CHO cell line has been used in the experiments, of identical sequence as humVHH_S56A/LALA-Fc/Gen2 (which is the naming we use for the protein produced in ExpiCHO transient transfection).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two days after transfecting HEK293T cells or HEK293S cells with spike expression plasmids each combined with a GFP expression plasmid, the cells were collected, washed once with PBS and fixed with 1% PFA for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV pseudovirus neutralization assay: To generate replication-deficient VSV pseudotyped viruses, HEK293T cells, transfected with SARS-CoV-1 S or SARS-CoV-2 S were inoculated with a replication deficient VSV vector containing eGFP and firefly luciferase expression cassettes77, 78.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The incubated pseudoviruses were subsequently added to subconfluent monolayers of VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human HEK293 cells were used for reverse transfection/expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse challenge experiments: Transgenic (K18-hACE2)2Prlmn mice were originally purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2)2Prlmn</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simulations of the VHH72(mutant)-RBD complex were with Gromacs version 2020.141 using the Amber ff99SB-ILDN force field70 and were run for 5 nanoseconds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gromacs</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike coding sequences were retrieved by aligning the genomes to the reference spike sequence annotated in NC_045512.2 (Wuhan-Hu-1 isolate, NCBI RefSeq).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this purpose, pairwise alignments were performed using the R package Biostrings version 2.54.0 , a fixed substitution matrix in the “overlap” mode with the following parameters according to Biostrings documentation: 1 and -3 for match and mismatch substitution scores; 5 as gap opening and 2 as gap extension penalties.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biostrings</div><div>suggested: (Biostrings, RRID:SCR_016949)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collected for spike protein RBD (positions 333 – 516) was visualized using ggplot2 version 3.3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were prepared by mixing the following: 30 µl sample (from a 1 mg/ml stock in HPLC grade water), 35 µL of 1% methylcellulose solution (ProteinSimple, 101876), 4 µl pH 3-10 pharmalytes (ProteinSimple, 042-848), 0.5 µl of 4.65, 0.5 µl 9.77 synthetic pI markers (ProteinSimple, 102223 and 102219), and 12.5 µl of 8 M urea solution (Sigma Aldrich®)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigma Aldrich®</div><div>suggested: (Sigma-Aldrich, RRID:SCR_008988)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting MS/MS spectra were analyzed with the BioPharma FinderTM 3.0 software (Thermo Fischer Scientific) and mapped onto the appropriate protein sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPharma</div><div>suggested: (TransCelerate BioPharma, RRID:SCR_003728)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was carried out using the ASTRA 7.3.2 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ASTRA</div><div>suggested: (ASTRA, RRID:SCR_016255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, 2019-nCoV S protein RBD that was biotinylated through an Avi-tag (AcroBiosystems, Cat nr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This is achieved by visual inspection using the images gridded on the ImageQuant software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical evaluation (mean, SD) was conducted using Excel (Microsoft).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The binding curves were fitted using nonlinear regression (Graphpad 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concentrations were back-calculated by 4PL interpolation using Graphpad Prism (9.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:While the field of SARS-CoV-2 antibody development currently sees arguments in both directions with regard to the desired extent of Fc effector functionality in diverse settings (prophylactic, therapeutic, route and frequency of administration), our LALA-Fc choice attempts to strike an optimal balance between safety and efficacy in diverse application modalities, within the limitations of relevant current clinical data, while ascertaining an established regulatory track record and freedom to operate. It was recently reported that in a therapeutic setting, some human neutralizing antibodies require intact Fc effector functions to control SARS-CoV-2 replication in the K18-hACE2 transgenic mouse and Syrian hamster challenge models68, using the LALAPG mutations to remove effector function of those antibodies. In contrast to that report, we found that Fc effector silent humVHH_S56A/LALA(PG)-Fc/Gen2 administered 4, 16 or 24 hours after viral challenge resulted in a very strong reduction of lung viral RNA and infectious virus levels. This suggests that the non-RBM binding mode of neutralization, likely including spike destabilization, perhaps combined with a faster biodistribution compared with a conventional antibody, allows for efficacious viral control. The requirement of effector functionality for therapeutic efficacy appears to be very antibody-dependent even with human antibodies, as a very recent study also demonstrated therapeutic efficacy in the same hamster model of other ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.03.07.21253098: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects and specimen collection: The study protocols for the collection of clinical specimens from individuals with and without SARS-CoV-2 infection by the Personalized Virology Initiative were reviewed and approved by the Mount Sinai Hospital Institutional Review Board (IRB-16-16772; IRB-16-00791; IRB-20-03374).<br>Consent: All participants provided written informed consent prior to collection of specimen and clinical information.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mouse samples, anti-mouse IgG conjugated to HRP was used at the same dilution (Rockland antibodies and assays; catalog #610-4302).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Rockland Cat# 610-4302, RRID:AB_219682)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, a mouse anti-histidine antibody (Takara; catalog #631212) was used as a positive control to detect proteins with a hexa-histidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-histidine</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 hours, cells were permeabilized and stained using an anti-nucleoprotein antibody 1C7 as discussed in detail earlier (Amanat et al., 2020b; Sun et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: Vero.E6 cells (ATCC #CRL-1586) cells were maintained in culture using Dulbecco’s Modified Eagles Medium (DMEM, Gibco) which was supplemented with 10% fetal bovine serum (FBS, Corning) and antibiotics solution containing 10,000 units/mL of penicillin and 10,000 µg/mL of streptomycin (Pen Strep, Gibco)(10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero.E6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: Ninety-six well plates (Immulon 4 HBX; Thermo Scientific) were coated overnight at 4°C with recombinant proteins at a concentration of 2 ug/ml in PBS (Gibco; Life Technologies) and 50 uls/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data was analyzed in Graphpad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of serum samples were made in 1X minimal essential medium (MEM; Life Technologies) starting at a dilution of 1:20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEM</div><div>suggested: (E-mem, RRID:SCR_016081)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mutation analysis, heavy chains of mAbs and single-cell BCRs first underwent V(D)J gene annotation using IgBLAST (v1.14.0) (Ye et al., 2013) with human reference (release 201931-4) from the international ImMunoGeneTics information system (IMGT) (Giudicelli et al., 2005) and then parsing using Change-O (v0.4.6)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure visualization: Structural figures were modeled and rendered in Pymol (The PyMOL Molecular Graphics System, Version 2.4 Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:In one vaccinee not a single RBD binding mAbs was isolated with the caveats that the overall number of mAbs derived from that individual were low and their polyclonal serum antibody responses included RBD recognition. These data suggest that the NTD, which also harbors neutralizing epitopes, is - at least - as important as the RBD and warrants as much attention. In fact, five out of seven neutralizing antibodies isolated in this study bound to the NTD and only two targeted the RBD. Thus, a re-evaluation of the B cell responses to natural SARS-CoV-2 infection with unbiased approaches is needed to understand if the co-dominance of NTD and RBD is vaccine specific or also seen upon natural infection. Further characterization of the mAbs obtained in this study showed a complete loss of neutralization against an authentic, replication-competent variant virus that harbored extensive changes in the NTD. These observations may explain why a reduction in neutralization against the viral variant of concern B.1.17 is seen in some studies despite the fact the N501Y substitution in the RBD of this variant does not significantly impact binding and neutralizing activity (Emary et al., 2021). We also assessed the impact of different RBD mutations on affinity towards human ACE2. Interestingly, N501Y increased the affinity by five-fold. This increase in receptor binding affinity may contribute to the higher infectivity of B.1.1.7, which carries this mutation in its RBD. In contrast, introductio...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.09.434592: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-T7 tag HRP-conjugated secondary antibodies were diluted at 1:5000 and incubated at room temperature for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-T7 tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To express the S protein, HEK293-ES cells were transiently transfected with the plasmid using polyethyleneimine and 3.5 mM valproic acid sodium salt to enhance protein production.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ES</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: The 293T-hsACE2 stable cell line and the pseudotyped SARS-CoV-2 particles (wild-type and mutants) with luciferase reporters were purchased from the Integral Molecular.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hsACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies of the specimen were recorded with a nominal defocus setting in the range of −0.5 to −2.5 μm using SerialEM with beam-tilt image-shift data collection strategy with a 3 x 3 pattern and 3 shot per hole.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beam-induced motion correction was performed using the motion correction program implemented in Relion to generate average micrographs and dose-weighted micrographs from all frames.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For other structures, each movie stack was processed on-the-fly using CryoSPARC live (version 3.0.0) 44,45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After refinement, each residue of the sequence-updated models was manually checked and refined iteratively in Coot and Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural models were validated by MolProbity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Nb-RBD complex structure was superimposed on its best matched Fab-RBD structure and protein volume was calculated using ProteinVolume51.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProteinVolume51</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was then processed by Prism GraphPad 9.0 to fit into a 4PL curve and to calculate the logIC50 (half-maximal inhibitory concentration).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the data was performed using Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.09.434529: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Biospecimens may be collected under an IRB-approved initial waiver of consent with subsequent attempts to consent surrogates and study subjects for full study participation.<br>IRB: This study is approved by the Institutional Review board: UCSF Human Research Protection Program (HRPP) IRB# 20-30497.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Differential proportion analysis was performed using a permutation-based approach that compares observed cell type proportion differences with those calculated from a null-distribution that is generated by randomly shuffling cell type labels (100,000 permutations) for a fraction (w=0.1) of the total cells, as described previously (38).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Radioligand binding assay for anti-IFN-α2 autoantibody detection: A DNA plasmid containing full-length cDNA sequence with a Flag-Myc tag (Origene #RC221091) was verified by Sanger sequencing and used as template in T7-promoter-based in vitro transcription/translation reactions (Promega, Madison, WI: #L1170) using [S35]-methionine (PerkinELmer, Waltham, MA; #NEG709A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-α2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFN-α2 protein was column-purified using Nap-5 columns (GE Healthcare, Chicago, IL; #17-0853-01), incubated with 2.5ul serum, or 2.5ul plasma, or 1ul anti-myc positive control antibody (CellSignal, Danvers, MA; #2272), and immunoprecipitated with Sephadex protein A/G beads (Sigma Aldrich, St. Louis, MO; #GE17-5280-02 and #GE17-0618-05, 4:1 ratio) in 96-well polyvinylidene difluoride filtration plates (Corning, Corning, NY; #EK-680860).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1ul anti-myc positive control</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase reporter assays: The blocking activity of anti-IFN-α autoantibodies was determined by assessing a reporter luciferase activity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-α</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transfected with the firefly luciferase plasmids under the control human ISRE promoters in the pGL4.45 backbone, and a constitutively expressing Renilla luciferase plasmid for normalization (pRL-SV40).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We selected samples from 69/101 of subjects enrolled in COMET between 4/8/2020 and 6/20/2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COMET</div><div>suggested: (CoMet, RRID:SCR_011925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This study is approved by the Institutional Review board: UCSF Human Research Protection Program (HRPP) IRB# 20-30497.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSF Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peripheral blood mononuclear cells (PBMCs) were isolated at RT using SepMate PBMC Isolation Tubes (STEMCELL Technologies) by the UCSF Biospecimen Resource Program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biospecimen Resource Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell epitope and RNA-sequencing preprocessing and alignment: CellRanger v3.1.0 (run 1 to 7, cDNA library generation of run 6 failed) or v4.0.0 (run 8 to 10) software with the default settings was used to demultiplex the sequencing data and generate FASTQ files (Cellranger mkfastq), align the sequencing reads to the hg38 reference genome, and generate a unique molecular identifier (UMI)-filtered gene and protein expression count matrix for each lane (Cellranger count for scRNA-seq and CITE-seq data).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellRanger</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell epitope and RNA-sequencing processing and quality control: Resulting gene and protein expression count matrices were further processed in the Python package Scanpy v1.5.1 (36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was performed per run on the raw gene expression matrix using Memento v0.0.4 (unpublished, Kim MC et al. https://github.com/yelabucsf/scrna-parameter-estimation), after which results were meta-analyzed over all runs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Memento</div><div>suggested: (Memento, RRID:SCR_002634)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFN-α2 protein was column-purified using Nap-5 columns (GE Healthcare, Chicago, IL; #17-0853-01), incubated with 2.5ul serum, or 2.5ul plasma, or 1ul anti-myc positive control antibody (CellSignal, Danvers, MA; #2272), and immunoprecipitated with Sephadex protein A/G beads (Sigma Aldrich, St. Louis, MO; #GE17-5280-02 and #GE17-0618-05, 4:1 ratio) in 96-well polyvinylidene difluoride filtration plates (Corning, Corning, NY; #EK-680860).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MA</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.03.08.434440: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) and THE anti-Strep II tag FITC (Genescript, A01736-100) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep II tag FITC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A01736-100 </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, M2 anti-FLAG (Sigma-Aldrich, F1804), and anti-GAPDH (GeneTex, GTX627408) antibodies in 5% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (GeneTex Cat# GTX627408, RRID:AB_11174761)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During the first IP for each construct, immunoprecipitation was confirmed by silver stain using a Pierce Silver Stain Kit (Thermo Fisher) and by western blotting with anti-FLAG antibody (Sigma-Aldrich, F1804) Nsp3.1-ST & ATF6-FT Co-immunoprecipitation: HEK293T-REx cells expressing doxycycline-inducible 6xHis-3xFLAG-HsATF6α were seeded in 15cm tissue culture dishes67.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-REx</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot and RT-qPCR analysis of UPR activation: HEK293T cells were transfected with nsp3.1-FT homologs or tdTomato (mock) in 6-well plates as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amino acid sequences of full-length nsp3 for the remaining hCoV strains were aligned using ClustalOmega to the SARS-CoV fragments to determine the corresponding starting/ending positions for each fragment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalOmega</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peptide IDs were filtered using Percolator with an FDR target of 0.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Percolator</div><div>suggested: (OMSSAPercolator, RRID:SCR_000287)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pairwise ratios between conditions were calculated in Proteome Discoverer based on total protein abundance, and ANOVA was performed on individual proteins to test for change in abundances and report adjusted P-values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteome Discoverer</div><div>suggested: (Proteome Discoverer, RRID:SCR_014477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geneset enrichment analysis, comparative heatmaps, and network plots: A gene ontology (GO) enrichment analysis for biological processes was conducted in EnrichR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EnrichR</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Network plots were generated in Cytoscape71; human protein interactions were validated based on the STRING database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
forum.obsidian.md forum.obsidian.md
-
When I run across interesting questions or topics that would make good papers or areas of future research I’ll use a tag like #OpenQuestion, so when I’m bored I can look at a list of what I might like to work on next.
-
Now, I simply (1) highlight what I find relevant and useful in journal articles or book chapters, (2) tag each highlight as I go in Acrobat Reader for articles or Kindle for chapters, (3) import them into Obsidian in a folder called ‘Highlight notes’, and (4) rework them with my own ideas into outputs. Perhaps the key to this system is that I not only tag each highlight for its key concepts, I also tag their ‘rhetorical purposes’ which will help me to find them again later. So, an example for a useful quote that defines the writing prompts used in an assessment like NAPLAN (Australia’s national writing test) might be:
- 阅读
- 笔记转移到obsidian中的高亮笔记文件夹
- 编辑笔记,用自己的语言表达
- 打标签,想到什么打什么?基于目的的想象
Tags
Annotators
URL
-
-
blog.fission.codes blog.fission.codes
-
Categorizing your ideas with different tags allows you to find relevant information in a note-taking system quickly. And because one idea may have more than one tag, you can easily find the relevant idea from any number of search terms.
使用标签,可以赋予我们的笔记更多的入口
-
-
laulima.hawaii.edu laulima.hawaii.edu
-
$33 million per
This $33million price tag should be raised substantially. The use of their oceans and land is worth more than that number.
-
-
www.sitepoint.com www.sitepoint.com
-
We standardize on a finite subset of JS (such as asm.js) — and avoid the endless struggle through future iterations of the JavaScript language, competing super-sets and transpilers
asm.js and RPython sound similar (restrictive subsets)
-
As to opinions about the shortcomings of the language itself, or the standard run-times, it’s important to realize that every developer has a different background, different experience, different needs, temperament, values, and a slew of other cultural motivations and concerns — individual opinions will always be largely personal and, to some degree, non-technical in nature.
Tags
- standardization
- everyone has different background/culture/experience
- +0.9
- asm.js
- annotation meta: may need new tag
- runtime environment
- JavaScript: as a process VM
- what is important/necessary for one person may not be for another
- non-technical reasons
- software preferences are personal
- the high churn in JavaScript tooling
- software project created to address shortcomings in another project
- good point
- RPython
- JavaScript
- reaction / reacting to
- everyone has different preferences
Annotators
URL
-
-
github.com github.com
-
Normally you should not register a named module, but instead register as an anonymous module: define(function () {}); This allows users of your code to rename your library to a name suitable for their project layout. It also allows them to map your module to a dependency name that is used by other libraries.
-
-
github.com github.comd3/d32
-
The non-minified default bundle is no longer mangled, making it more readable and preserving inline comments.
-
D3 now passes events directly to listeners, replacing the d3.event global and bringing D3 inline with vanilla JavaScript and most other frameworks.
-
-
forum.paradoxplaza.com forum.paradoxplaza.com
-
This thread is more than 5 months old. It is very likely that it does not need any further discussion and thus bumping it serves no purpose. If you feel it is necessary to make a new reply, you can still do so though. I am aware that this thread is rather old but I still want to make a reply.
-
-
github.com github.com
-
I don't understand why this isn't being considered a bigger deal by maintainrs/the community. Don't most Rails developers use SCSS? It's included by default in a new Rails app. Along with sprockets 4. I am mystified how anyone is managing to debug CSS in Rails at all these days, that this issue is being ignored makes sprockets seem like abandonware to me, or makes me wonder if nobody else is using sprockets 4, or what!
-
-
github.com github.com
-
but I still have no idea if I'm writing this new file correctly.
-
-
github.com github.com
-
For the $$$ question, nothing comes to mind. These problems i'm hitting up against are larger than a contractor could solve in a few hours of work (which would be hundreds/thousands of dollars).
-
-
hyperstack.org hyperstack.org
-
we used `backticks` to jump into native Javascript to use moment.js
In regular Ruby, `` executes in a shell, but obviously there is no shell of that sort in JS, so it makes sense that they could (and should) repurpose that syntax for something that makes sense in context of JS -- like running native JavaScript -- prefect!
-
-
via4.hypothes.is via4.hypothes.is
-
For example, when news broke of TigerWoods’extramarital infidelities in late 2009, several sponsors suspended their contractswith him almost immediately, including Accenture, AT&T, Gatorade, General Motors,Gillette and TAG Heuer.
This examplifies how brands can drop people who don't supporttheir image
-
broke of TigerWoods’extramarital infidelities in late 2009, several sponsors suspended their contractswith him almost immediately, including Accenture, AT&T, Gatorade, General Motors,Gillette and TAG Heuer.
It was pretty entertaining i must say, especially when they had like 25 women on the magazine covers.
-
broke of TigerWoods’extramarital infidelities in late 2009, several sponsors suspended their contractswith him almost immediately, including Accenture, AT&T, Gatorade, General Motors,Gillette and TAG Heuer
This reminds me of one of Apple's policies; The villain in a movie/TV show is not allowed to use an Apple device. This is because they don't want a negative connotation with their brand.
-
-
runestone.academy runestone.academy
-
Another aspect of the heading tag is that it is what we call a block tag.
intresting
-
-
via4.hypothes.is via4.hypothes.is
-
Positive high-arousal is embedded in what the au-thors tag as “Awa” stories: pieces that generate a feeling of elevation in the face of something greater than oneself
This is a definition of a term that could be useful later
-
-
futurism.com futurism.com
-
One of the biggest obstacles standing in the path of a human colony on Mars is the price tag. Getting to Mars will be prohibitively expensive, and figuring out a method of paying for the project isn’t so easy.“I think it would be a natural next step in our human exploration to visit the Moon and/or Mars, but to stay for the long term probably requires an economic justification,” said Hendrix.
The amount of money being spent to be able to achieve a colony on Mars seems to be the biggest drawback that we face in order to achieve this mission. I think that people have to look at the mission as a whole instead of pinpointing reasons why going there isn't the best use of our resources.
-
-
www.biorxiv.org www.biorxiv.org
-
Reviewer #3 (Public Review):
Using high fat diet (HFD)-fed male mice and a variety of experimental approaches, the authors demonstrated the efficacy of xanthohumol (XN) and tetrahydro-xanthohumol (TXN) in attenuating weight gain and hepatic steatosis independently of calorie intake and identify inhibition of PPARγ as a mechanism. A strength of the study design was the incorporation of the test compounds into isocaloric, ingredient matched high-fat diet (HFD) formations and inclusion of a LFD control group. A weakness of the study, although minor, is that the dose of compound consumed will vary between mice and from day-to-day depending on how much food each animal consumes. The lower dose of XN (LXN, given as 30 mg/kg of diet) was found ineffective compared to the higher dose of XN (HZN, 60 mg/kg of diet) and TXN (30 mg/kg of diet) was most effective in attenuating weight gain and reversing HFD-induced liver steatosis. TXN almost completely suppressed hepatic lipid vacuole accumulation and showed greatest reduction in liver mass relative to body weight. TXN increased fasting plasma triglycerides compared to all other groups, but explanation is uncertain. Fecal excretion of TAG between groups was similar and therefore could not explain the decreased weight gain or improved liver phenotypes in XN- or TXN-treated groups. Whole body energy metabolism suggested that XN and TXN supplemented mice were more physically active then HFD-fed mice. HXN and TXN supplemented mice showed less accumulation of subcutaneous and mesenteric fat mass, but these groups had somewhat higher levels of epididymal fat mass.
After 16 weeks on diets, RNAseq performed on murine liver tissues. Compared to HFD group, TXN group had 295 differentially expressed genes (DEGs), HXN group had 6 DEGs, and LFD group had 212 DEGs. TXN supplementation upregulated 6 and down regulated 25 KEGG pathways. SVM was used to identify signature genes that significantly differentiated HFD and TXN group transcriptomes. Of 13 identified genes, 8 showed significant, differential hepatic expression between TXN and HFD groups. Of these 8 genes, 3 genes (Ucp2, Cidec, Mogat1) were identified as known target genes of PPARγ with roles in lipid metabolism. qPCR of liver tissues was used to verify these RNAseq results.
XN or TXN were shown to inhibit murine preadipocyte 3T3-L1 differentiation and adipogenesis and lipid accumulation in a dose dependent manner. In a second dose escalating experiment, TXN or XN were shown to block the ability of rosiglitazone (RGZ), a PPARγ agonist, to promote adipogenesis of 3T3-L1. These data suggested that XN and TXN may interfere or compete with binding of RGZ to the PPARγ receptor. qPCR of 3T3-L1 cells confirmed that TXN or XN could inhibit gene expression of RGZ-induced PPARγ target genes (Cd36, Fabp4, Mogat1, Cidec, Plin4, Fgf21) and further supported the hypothesis that TXN and XN are PPARγ antagonists. To further test this idea the authors performed a competitive PPARγ TR-FRET binding assay and showed that XN and TXN could displace a labelled pan-PPARγ ligand in a dose-dependent manner. Finally, molecular docking experiments confirmed the putative binding pose and position of XN/TXN and estimated the relative binding affinities of various ligands for PPARγ. XN and TXN may serve as scaffolds for the development of more potent therapeutics in structure-activity relationship (SAR) studies. Overall, this work contributes compelling preclinical data to support future clinical investigations to determine dosing, efficacy, and safety of XN and TXN as therapeutics for diet-induced NAFLD.
-
-
book.douban.com book.douban.com书之极 (豆瓣)1
-
本书作者王骥是迄今为止中国唯一的艺术家手作书藏家,十几年来,他斥巨资收藏了200多本艺术家手作书,却始终蜗居在30㎡的小房子里。
2020年末,《书之极》一出版,旋即获选2020年“中国最美的书”。
书中呈现了24位艺术家的作品:有常玉、赵无极、萨尔瓦多·达利、安迪·沃霍尔、亨利·马蒂斯……甚至还有诺贝尔文学奖获得者君特·格拉斯。它展现了“书”这个载体做到极致能做成什么样子。
-
-
-
Congratulations on this research and best wishes for a helpful and robust peer review experience! I offer the following feedback, which I hope you can consider:
Given the involvement of a patient author and the recommended reporting guidelines for patient involvement, would you be able to include the GRIPP2 Short Form in your manuscript? See EQUATOR Network/BMJ/Res Involvement and Engagement for GRIPP2. By sharing insights via this best practice reporting guideline we can all learn from each other. The table could be added in your existing Methods section in the Patient and Public Involvement paragraph.
To assist with meta-research on patient authorship and facilitate listing and searchability in PubMed via the 'Patient Author' affiliation tag, would Laurie Proulx be able to add 'Patient Author' to her existing affiliation? We are working with publishers now to help boost use of this affiliation tag as trying to identify patient-authored publications right now relies on hand searching. A quick, free, and easy alternative is possible via PubMed if the 'Patient Author' affiliation is used. Wide use of this tag would help answer the Table 7 question re, has your journal published a paper with a patient author? We are presenting research on the use of this tag at a US conference this year and would be happy to share our results with you.
It is a concern that almost 1 in 5 of the respondents were not sure whether their journal adhered to the ICMJE criteria for authorship (Table 7). It could be useful from a hypothesis-generating perspective to see if the answers from this cohort influenced the broader results.
While not peer reviewed, there is reported documentation from ICMJE about patient authorship in the grey literature from Peter Bates "anyone (including patients) who meet all the criteria for authorship should be provided the option / opportunity to be so. Our document says so, and you should point to that if others think patients who meet all 4 criteria should not be authors.
In short, we believe that our statements apply to patients just as they do to anyone involved in a study and its reporting.
Personal communication from the Secretary of the ICMJE, December 2018"<br> https://peterbates.org.uk/home/garden-shed/payment-for-authors/
We have partnered with patients to conduct and author the first systematic review on the benefits and risks of patient authorship. It has been published in the peer-reviewed journal, Research Involvement and Engagement. I thought this might be of interest to your team for this or future work you do in this area. https://researchinvolvement.biomedcentral.com/articles/10.1186/s40900-020-00190-w
We have also partnered with patients to create a free and online plain language guide to help patients review the rights and responsibilities of authorship...before they commit to authorship. It is CC BY 4.0 so can be shared easily https://figshare.com/articles/poster/Plain_Language_Summary_of_Good_Publication_Practice_Guideline/11292047
Patient authorship is likely to increase as more patients lead robust research projects. One wonders who the 33 editors (who don't believe patients can be authors) would expect to author the resulting publications. If the researchers involved can't author publications, then could this lead unethical guest authorship?
Relevant to the advocacy from patients for authorship, we are working with WECAN to develop the first, online, co-created 'Publication Training Course for Patient Advocates'. This course will be released under a CC BY 4.0 license to facilitate free sharing and re-use. We would be happy to speak with you about the course.
Again, I hope these comments are useful and I look forward to seeing this preprint progress to a peer-reviewed publication.
Professor Karen L. Woolley Twitter: @KWProScribe
-
-
www.biorxiv.org www.biorxiv.org
-
Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.
Learn more at Review Commons
Reply to the reviewers
We wish to thank the reviewers for their detailed and constructive comments on our manuscript. This valuable feedback has resulted in substantial improvements to our paper. A detailed list addressing the reviewers’ comments and the changes to our manuscript since the first submission is outlined below:
Reviewer #1:
The manuscript by Martens et al investigates the mechanisms of Bnip3-mediated cell damage during hypoxia. The Authors show that modulation of prostaglandin (PG) E1 signaling with misoprostol prevents cardiac dysfunction, mitochondrial impairment and cell death induced by hypoxia. In addition, they show that the effect of misoprostol is dependent on PKA-mediated Thr181 phosphorylation. The Authors also suggest that there is a possible interaction between Bnip3 and 14-3-3beta that prevents ER Ca2+ release and mitochondrial Ca2+ overload. The Authors conclude that Bnip3 phosphorylation plays a key role in the regulation of cardiac and metabolic dysfunction and identify misoprostol treatment as a therapeutic intervention to prevent hypoxia-induced cardiac injury.
**Major Comments:**
1.Results presented in Figs. 1, 2 and 3 pertaining to hypoxia-induced changes in Bnip3 expression, changes in mitochondrial function, cell death, Bnip3-dependent Ca2+ transfer from ER to mitochondria and the effect of misoprostol have partially been demonstrated in a previous publication from the same group (PMID: 30275982).
Thank you for noting our previous work using predominantly the HCT-116 cell line and a rat model of neonatal hypoxia published in the journal Cell Death Discovery. The work in the current manuscript builds on our previous papers, and extends these findings utilizing a neonatal mouse model, primary neonatal ventricular myocytes, human iPSC-derived cardiomyocytes, and H9c2 cells. These models not only demonstrate the robust nature of the effects of misoprostol treatment on the hypoxic neonatal cardiomyocytes, but they also allowed us to utilize powerful genetic models, such as the Bnip3 knockout mouse, and knockout mouse embryonic fibroblasts (MEFs), which phenocopy many of the effects of misoprostol treatment. These findings strongly implicate Bnip3 as a primary target of misoprostol treatment in the hypoxic neonatal heart in rodents.
In addition, Figure 1 contains very important in vivo endpoints that we have not previously utilized, including echocardiography to assess neonatal cardiac function, transmission electron microscopy to assess mitochondrial ultrastructure, cardiac ATP and lactate levels, an array of gene expression, and HMGB1 immunofluorescence (Fig.1 I in the current version of the manuscript) implicating a necro-inflammatory phenotype that is modulated by misoprostol treatment. Moreover, in Figures 2 and 3 we confirm previous observations related to hypoxia- and Bnip3-mediated mitochondrial function, and calcium signaling, but also extend these observations to include the impact of hypoxia, Bnip3 and misoprostol treatment on mitochondrial morphology and necro-inflammatory markers, in additional to utilizing human cardiomyocytes and knockout MEFs. Finally, Figures 4-7 of our manuscript describes a novel mechanism by which misoprostol treatment can therapeutically target Bnip3 function both in vivo and in cell models (see below).
Although based on our previous observations, we feel the work in the present manuscript is highly novel and original, and adds substantially to our knowledge of both Bnip3 function, and neonatal hypoxic injury, which currently represents a world-wide health crisis that is underrepresented in the biomedical literature.
2.The very same publication from 2018 shows that misoprostol treatment of pups exposed to hypoxia for 7 days is able to prevent the increase in Bnip3 protein levels. Yet, in the present manuscript misoprostol treatment had no effect on Bnip3 protein levels in the same model (Fig. 1E). This raises some concerns regarding the solidity and soundness of the results presented. Thank you for noting this in our previous work. In our 2018 paper, we treated hypoxic neonatal rats with misoprostol and observed a complete repression of Bnip3 expression in the gut and hippocampus, but only a partial repression in the heart. This observation prompted us to explore other mechanisms by which misoprostol could inhibit Bnip3 function. We have increased our sample size for the data in Figure 1 J and K to be more statistically conclusive. The evidence is now stronger that misoprostol only the partial represses Bnip3 expression in the neonatal mouse heart. In addition, we provided a representative western blot (Fig. 1 J), which is consistent with the result in Figure 3C in MEF cells.
3.The validation of the custom antibody against p-Thr181 needs to be shown. Fig. 4E shows that p-Bnip3 band is quite strong in H9c2 cells, despite total endogenous Bnip3 levels are barely detectable. In addition, phosphorylation of the Bnip3 Thr181 residue in cells and/or in vivo should be confirmed by mass spectrometry.
Our plan in the next revision, we will be to provide additional validation of the p-Thr181 antibody, as we have done previously (PMID: 33044904). In addition, we will re-run the western blots noted above to improve their quality, as the difference between total Bnip3 and p-Bnip3 in H9c2 cells is likely due to different exposures of the two blots. Confirmation of Bnip3 phosphorylation using mass spectrometry in extracts from intact cells was previously published (PMID: 26102349), however, the nature of the signaling pathways leading to phosphorylation was not determine, nor was the mechanism of Bnip3 inhibition previously determined.
4.Fig. 4L shows that misoprostol treatment of H9c2 cells leads to an increase in Bnip3 phosphorylation, but this does not seem to be the case in normoxic conditions in vivo (Fig. 4N). Moreover, shouldn't this presumable increase in phosphorylation induced by misoprostol in normoxic conditions lead to Bnip3 accumulation in the cytosol thereby reducing its colocalization with mitochondria (Fig. 6B)? The results obtained with the colocalization method should be corroborated using different methods, such as cell fractionation.
In the previous version of the manuscript, we reported that misoprostol treatment increases Bnip3 phosphorylation in H9c2 cells following acute exposure (Supplement 5 B). In the updated version of the manuscript, we confirmed this in vitro observation in PVNC’s, demonstrating that in culture, acute misoprostol drug treatments during normoxia result in Bnip3 phosphorylation (Supplement 5 C). However, when we increased our N in the revised manuscript this difference remained not statistically sustained after 7 days of misoprostol treatment in vivo (Fig. 4 M, N). Importantly though, our observation that hypoxia exposure resulted in reduced Bnip3 phosphorylation, and that misoprostol drug treatment was sufficient to restore it is particularly novel, and ties together with our new colocalization data (Fig. 4 M, N). What is very intriguing about the data in Figure 6B is that myc-Bnip3 did not colocalize with the mitochondrial matrix-targeted mito-Emerald under normoxic conditions, and thus was not impacted by misoprostol treatment in normoxia. However, in hypoxic cells the colocalization coefficient between myc-Bnip3 and mito-Emerald increased and was abrogated by misoprostol treatment. This observation suggests that Bnip3 is actively translocated deeper into the mitochondria ultrastructure during hypoxic stress, and that misoprostol treatment can prevent this phenomenon. This observation is consistent with the pBnip3 data shown in Figure 4M. In the most recent version of the manuscript, we have performed additional confocal experiments to substantiate this novel observation. New data clearly demonstrates that hypoxia exposure in vivo increases the colocalization of Bnip3 with the inner mitochondrial membrane protein Opa1 (Fig. 6 C). However, when mice are treated with misoprostol, the colocalization with Opa1 is reduced and the colocalization of Bnip3 with 14-3-3b increases (Fig. 6 M). We have also shown in H9c2 cells that expression of Opa1 prevents Bnip3-induced mitochondrial fission (Fig. 3 J), and that when both Bnip3 and 14-3-3b are ectopically expressed, misoprostol treatment can increase their colocalization (Fig. 6 N, O), suggesting that this is regulated by post-translational modification and not alterations in Bnip3 expression due to hypoxia. Our plan is to include additional fractionation experiments in the next revision of the manuscript; however, this approach may not be as sensitive as confocal microscopy.
5.In relation to Fig. 4 M, N (page 19), the Authors concluded that the reduction in Bnip3 phosphorylation suggests an increase in Bnip3 activity in the hypoxic neonatal hearts. Nevertheless, this has not been demonstrated.
Thank you for pointing this out. At this time, we do not have data to suggest that a reduction in Bnip3 phosphorylation increases its activity in vivo. In the revised manuscript, we have new confocal-based colocalization experiments using fixed sections from hypoxic and misoprostol treated hearts that provide insightful information into the subcellular localization of Bnip3 (Please see above; Fig. 6 C, M). Importantly, based on our data in figure 5, particularly Fig.5F using Bnip3-null MEFs, the protective effect of misoprostol is completely prevented by reconstitution of the T181A mutant, but not wild-type Bnip3, suggesting phosphorylation at T181 is an important mechanism by which misoprostol inhibits Bnip3-induced mitochondrial depolarization. Finally, we have also been careful not to overstate our conclusions is the most recent version of the manuscript, have been more specific with our language, and have avoided vague terms like ‘activity’.
6.Along that line, the Authors concluded that misoprostol-induced cytoprotection is dependent on PKA Thr181 phosphorylation. Nevertheless, this dependence has not been convincingly demonstrated in hypoxic cells and in vivo.
The new data described outline above, in point #4 and #5, have provided assurances regarding the role of Bnip3 phosphorylation on its subcellular location in vivo and in cultured cells. To further address the dependency of PKA on T181 phosphorylation, we have performed experiments using the PKA inhibitor, H89, in cellular experiments and evaluate whether the protective effect of misoprostol is lost in the presence of this inhibitor. This new data has been added to the most recent version of the manuscript (Fig. 4 G).
7.Previous studies showed that Bnip3 induces mitochondrial fragmentation and mitophagy (PMID: 16645637, 20436456). What is the hypothesis for the inhibition of mitochondrial fragmentation induced by misoprostol in the present study? Does it prevent Bnip3 interaction with Opa1 or is this event downstream of ER Ca2+ release and mitochondrial Ca2+ overload? Does misoprostol affect mitophagy?
We have added new experimental data to address the hypothesis that Bnip3 colocalizes with Opa1 to induce mitochondrial fragmentation (as noted by the reviewer, they were previously shown to physically interact), and that this is inhibited by misoprostol treatment (Fig. 6 C). We have also added new data to the supplemental material demonstrating that misoprostol inhibits hypoxia- and Bnip3-induced mitophagy. Based on our data, we proposal that misoprostol inhibits both Bnip3-induced ER-calcium release and Opa1-dependent mitochondrial fusion. This is based on our data that misoprostol prevents Bnip3 accumulation at both the ER and mitochondria, respectively.
8.The link between Bnip3 interaction with 14-3-3 and Bnip3 Thr181 phosphorylation, if there is any, is not clear. The Authors mention that Thr181 lies within the 14-3-3 binding domain. Is Thr181 phosphorylation required for 14-3-3 binding or are these events unrelated? What is the significance of these events in hypoxia, does 14-3-3 binding to Bnip3 occur in vivo? Is Bnip3 localization affected by hypoxia, 14-3-3 binding and/or misoprostol treatment in vivo?
Previously, we described the role of phosphorylation of Bnip3L (Nix) at Ser-212 how this regulates the interaction with 14-3-3 (PMID: 33044904). This phosphorylation site is conserved in Bnip3 as T181. Interestingly, phosphorylation of Nix by PKA was not required for interested with 14-3-3b, but the interaction between Nix and 14-3-3b was enhanced by phosphorylation. Our plan is to perform similar experiments with Bnip3 and 14-3-3b to determine if this mechanism is conserved. However, as noted above we have new in vivo data showing that misoprostol increased the colocalization of Bnip3 and 14-3-3b in the hypoxic heart (Fig. 6 M).
9.Fig. 6P shows the presence of myc-tag after IP for HA-tag, even when HA-14-3-3 was not expressed (middle lane). How is this possible?
This appears to be a small amount of non-specific interaction between the HA antibody and myc-Bnip3. This is relatively small compared to the band in lane 3, which demonstrates specificity, and the importance of including this control condition. Our plan is to re-run this CO-IP to improve the western blot quality.
**Minor Comments:**
1.Please co-stain with the cardiomyocyte marker in Fig. 2A (such as alpha-actinin).
Yes, good suggestion.
2.The Methods are not sufficiently detailed. For instance, it is not clear what is the Ca2+ concentration used for Ca2+ pulses in the CRC experiment. The fact that cardiac mitochondria are able to uptake only two Ca2+ pulses raises some concerns regarding the quality of mitochondrial preparation. What is the reason for isolating mitoplasts instead of intact mitochondria?
We have provided more detail in the revised manuscript.
3.TMRM fluorescence should be measured before and after FCCP administration, to account for the difference in plasma membrane potential (the results should be expressed as F/FFCCP).
We can provide some additional control experiments in the revised manuscript, if necessary.
4.Measurement of extracellular acidification is mentioned in the methods, but the relative results are not shown.
Thank you, this has been removed.
5.RNAi experiments targeting Bnip3 are also mentioned in the methods, but the results are not described.
Thank you. This has been fixed.
Reviewer #1 (Significance (Required)):
Previous studies have demonstrated that Bnip3 is upregulated by hypoxia and plays a key role in inducing mitochondrial dysfunction and PTP opening that eventually results in cell death (PMID: 12169648, 10922063). Along that line, misoprostol has been shown to prevent damaging effects of hypoxia by repressing Bnip3 and promoting the expression of pro-survival alternative splicing isoforms (PMID: 30275982). Indeed, the same study showed that misoprostol treatment prevents loss of mitochondrial membrane potential, ROS formation and impairment in mitochondrial oxygen consumption caused by hypoxia in primary neonatal cardiomyocytes. The present manuscript recapitulates these previously published findings. The truly novel findings concern the identification of Bnip3 residue Thr181 as target for PKA phosphorylation and the possible interaction of Bnip3 with 14-3-3. However, the role and/or involvement of these events has not been thoroughly investigated in relation to hypoxia and misoprostol treatment in cells or in vivo.
Thank you for noting our previous work and identifying the novelty in our present work. As stated above, for Reviewer #1 comments 4, 6, and 8. We have provided additional mechanistic and in vivo data to more fully describe the role of T181 phosphorylation and the interaction with 14-3-3 chaperones in the revised manuscript.
Reviewer #2:
Systemic hypoxia, a major complication associated with reduced gestational time, affects more 60% of preterm infants and is a known driver of hypoxia-induced Bcl-2-like 19kDa-interacting protein 3 (Bnip3) expression in neonatal heart. At the level of the cardiomyocyte, Bnip3 activity plays a prominent role in the evolution of necrotic cell death, disrupting subcellular calcium homeostasis and initiating mitochondrial permeability transition (MPT). Emerging evidence suggests both a cardioprotective role for protein kinase A (PKA) through stimulatory prostaglandin (PG) E1 signalling during prolonged periods of hypoxia, and a cytoprotective role for Bnip3 phosphorylation, indicating that post-translational modifications of Bnip3 may be a point of convergence for these two protective pathways. Using a combination of in vivo and multiple cell models, including human iPSC-derived cardiomyocytes, the authors tested if the PGE1 analogue misoprostol is cardioprotective during neonatal hypoxic injury by altering the phosphorylation status of Bnip3. Here we report that hypoxia exposure significantly increases Bnip3 expression, mitochondrial-fragmentation, -ROS, -calcium accumulation and -permeability transition, while reducing mitochondrial membrane potential, all of which were restored to control levels with addition of misoprostol, despite elevated Bnip3 protein expression. Through both gain- and loss-of function genetic studies, the authors show that misoprostol-induced protection directly affects Bnip3, preventing mitochondrial perturbations. They demonstrate that this is a result of PG EP4 receptor signalling, PKA activation, and direct Bnip3 phosphorylation at threonine-181. Furthermore, when this PKA phosphorylation site within Bnip3 is neutralized, the protective misoprostol effect is lost. They also provide evidence that misoprostol traffics Bnip3 away from the ER through a physical interaction with 14-3-3β, thereby preventing aberrant ER calcium release and MPT. In vivo studies further demonstrate that misoprostol treatment increases Bnip3 phosphorylation at threonine-181 in the mouse heart, while both misoprostol treatment and genetic ablation of Bnip3 prevented hypoxia-induced reductions in contractile function. Taken together, these results demonstrate a foundational role for Bnip3 phosphorylation in the molecular regulation of cardiomyocyte contractile and metabolic dysfunction and identifies EP4 signaling as a potential pharmacological mechanism to prevent hypoxia-induced neonatal cardiac injury. While this work is interesting, a number of issues remain.
1.English expression needs some attention. For example, the first sentence of the abstract - "more than 60%...."; Page 20, line 9 "We observed that misoprostol's ability to to". Many sections should be broken into 2 or 3 sentences.
Thank you, we have made these changes and have fully proof-read our manuscript.
2.Evidence from In vivo studies such as those described in section 3.7 is minimal. Much more in vivo evidence is needed. It is unclear the authors established this in vivo model of hypoxia - supposedly gestational hypoxia should be considered. Consider citing these reviews on maternal over- and under-nutrition for postnatal heath (PMID 33181042; 22982026).
Thank you, we will cite these papers and have clarified our in vivo model, related to comparable human gestation time, in the Methods section. We have also revised the Introduction and Discussion to be more consistent with our in vivo model. In addition, and noted above, we have preformed addition in vivo experiments in both the hypoxia/misoprostol model, and in Bnip3 KO mice to more fully support our conclusions. Additional HMGB1 immunofluorescence has already been added to Figures 1 and 7, and we have include additional confocal-based colocalization experiments from fixed tissues (described in more detail above; Fig. 7 D).
3.Which one does misoprostol exactly execute its action? Phosphorylation through PKA or trafficking Bnip3 away from the ER through a physical interaction with 14-3-3β?
This is a very good question. Based on our previous work on Bnip3L (Nix; PMID: 33044904,) PKA-induced phosphorylation of the transmembrane domain increased the physical interaction with 14-3-3b, which acts as a chaperone to translocate Nix away from the mitochondria and ER/SR. We will preform similar experiments with Bnip3 and 14-3-3b for the next revision to provide additional support for this conclusion.
4.More in vivo proof of concept studies are needed to validate the signaling mechanism - this is an invitro-based study (hypoxia challenge occurs in vitro).
We have already included additional in vivo immunofluorescence to Figure 1 and 7, and have performed additional colocalization experiments to validate the signaling pathway in this revision. Many of these experiments are described above.
5.Quality of figures is somewhat poor.
Our images are the highest possible resolution within the confines of the figure size limit. Perhaps the reviewer received a web-optimized version of the figures for review.
Reviewer #2 (Significance (Required)):
Relatively high - although in vivo evidence is needed.
Thank you. This is provided in the revised manuscript.
-
Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.
Learn more at Review Commons
Referee #1
Evidence, reproducibility and clarity
The manuscript by Martens et al investigates the mechanisms of Bnip3-mediated cell damage during hypoxia. The Authors show that modulation of prostaglandin (PG) E1 signaling with misoprostol prevents cardiac dysfunction, mitochondrial impairment and cell death induced by hypoxia. In addition, they show that the effect of misoprostol is dependent on PKA-mediated Thr181 phosphorylation. The Authors also suggest that there is a possible interaction between Bnip3 and 14-3-3beta that prevents ER Ca2+ release and mitochondrial Ca2+ overload. The Authors conclude that Bnip3 phosphorylation plays a key role in the regulation of cardiac and metabolic dysfunction and identify misoprostol treatment as a therapeutic intervention to prevent hypoxia-induced cardiac injury.
Major Comments:
1.Results presented in Figs. 1, 2 and 3 pertaining to hypoxia-induced changes in Bnip3 expression, changes in mitochondrial function, cell death, Bnip3-dependent Ca2+ transfer from ER to mitochondria and the effect of misoprostol have partially been demonstrated in a previous publication from the same group (PMID: 30275982).
2.The very same publication from 2018 shows that misoprostol treatment of pups exposed to hypoxia for 7 days is able to prevent the increase in Bnip3 protein levels. Yet, in the present manuscript misoprostol treatment had no effect on Bnip3 protein levels in the same model (Fig. 1E). This raises some concerns regarding the solidity and soundness of the results presented.
3.The validation of the custom antibody against p-Thr181 needs to be shown. Fig. 4E shows that p-Bnip3 band is quite strong in H9c2 cells, despite total endogenous Bnip3 levels are barely detectable. In addition, phosphorylation of the Bnip3 Thr181 residue in cells and/or in vivo should be confirmed by mass spectrometry.
4.Fig. 4L shows that misoprostol treatment of H9c2 cells leads to an increase in Bnip3 phosphorylation, but this does not seem to be the case in normoxic conditions in vivo (Fig. 4N). Moreover, shouldn't this presumable increase in phosphorylation induced by misoprostol in normoxic conditions lead to Bnip3 accumulation in the cytosol thereby reducing its colocalization with mitochondria (Fig. 6B)? The results obtained with the colocalization method should be corroborated using different methods, such as cell fractionation.
5.In relation to Fig. 4 M, N (page 19), the Authors concluded that the reduction in Bnip3 phosphorylation suggests an increase in Bnip3 activity in the hypoxic neonatal hearts. Nevertheless, this has not been demonstrated.
6.Along that line, the Authors concluded that misoprostol-induced cytoprotection is dependent on PKA Thr181 phosphorylation. Nevertheless, this dependence has not been convincingly demonstrated in hypoxic cells and in vivo.
7.Previous studies showed that Bnip3 induces mitochondrial fragmentation and mitophagy (PMID: 16645637, 20436456). What is the hypothesis for the inhibition of mitochondrial fragmentation induced by misoprostol in the present study? Does it prevent Bnip3 interaction with Opa1 or is this event downstream of ER Ca2+ release and mitochondrial Ca2+ overload? Does misoprostol affect mitophagy?
8.The link between Bnip3 interaction with 14-3-3 and Bnip3 Thr181 phosphorylation, if there is any, is not clear. The Authors mention that Thr181 lies within the 14-3-3 binding domain. Is Thr181 phosphorylation required for 14-3-3 binding or are these events unrelated? What is the significance of these events in hypoxia, does 14-3-3 binding to Bnip3 occur in vivo? Is Bnip3 localization affected by hypoxia, 14-3-3 binding and/or misoprostol treatment in vivo?
9.Fig. 6P shows the presence of myc-tag after IP for HA-tag, even when HA-14-3-3 was not expressed (middle lane). How is this possible?
Minor Comments:
1.Please co-stain with the cardiomyocyte marker in Fig. 2A (such as alpha-actinin).
2.The Methods are not sufficiently detailed. For instance, it is not clear what is the Ca2+ concentration used for Ca2+ pulses in the CRC experiment. The fact that cardiac mitochondria are able to uptake only two Ca2+ pulses raises some concerns regarding the quality of mitochondrial preparation. What is the reason for isolating mitoplasts instead of intact mitochondria?
3.TMRM fluorescence should be measured before and after FCCP administration, to account for the difference in plasma membrane potential (the results should be expressed as F/FFCCP).
4.Measurement of extracellular acidification is mentioned in the methods, but the relative results are not shown.
5.RNAi experiments targeting Bnip3 are also mentioned in the methods, but the results are not described.
Significance
Previous studies have demonstrated that Bnip3 is upregulated by hypoxia and plays a key role in inducing mitochondrial dysfunction and PTP opening that eventually results in cell death (PMID: 12169648, 10922063). Along that line, misoprostol has been shown to prevent damaging effects of hypoxia by repressing Bnip3 and promoting the expression of pro-survival alternative splicing isoforms (PMID: 30275982). Indeed, the same study showed that misoprostol treatment prevents loss of mitochondrial membrane potential, ROS formation and impairment in mitochondrial oxygen consumption caused by hypoxia in primary neonatal cardiomyocytes. The present manuscript recapitulates these previously published findings. The truly novel findings concern the identification of Bnip3 residue Thr181 as target for PKA phosphorylation and the possible interaction of Bnip3 with 14-3-3. However, the role and/or involvement of these events has not been thoroughly investigated in relation to hypoxia and misoprostol treatment in cells or in vivo.
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.10.27.357558: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatants were collected and quantified by western blotting using anti-human IgG secondary antibody (ThermoFisher A-21091).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-21091, RRID:AB_2535747)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twenty-four hours before electroporation, BHK-SARS-N cells were treated with 1 μg ml−1 doxycyclin to express SARS-CoV N protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-SARS-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: A stable clone of BHK cells expressing exogenous hACE2 were pelleted and resuspended in reaction buffer (PBS pH7.4 with 0.02% tween-20 and 4% BSA) at a concentration of 5 × 106 cells/ml. 100 μl/well of the cells were aliquoted into a round-bottom 96-well plate and incubated on ice for at least 5 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcribed capped mRNA was electroporated into baby hamster kidney (BHK-21) cells expressing SARS-CoV N protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, Vero E6 cells were infected with P.1 viruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the ratios of S-614D:S-614G in competition assays in Epithelix and hACE2-KI mice, reverse transcription PCR was performed on extracted RNA using SuperScript™ IV One-step RT-PCR System (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-KI</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, cells were washed in 200 μl PBST washing solution (PBS pH7.4 with 0.02% tween-20) once and then 100 μl of 1:300 diluted secondary antibody (ThermoFisher Cat # A-21091 for Fc-tag and ThermoFisher Cat # MA1-21315-647 for polyhistidine-tag) was added into each well of cells, mixed, and incubated on ice with shaking for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of infectious cDNA clones using TAR cloning and rescue of recombinant viruses: To introduce the 614G mutation to the Spike gene, PCR mutagenesis (Supplementary Table 1) was performed on the pUC57 plasmid containing SARS-CoV-2 fragment 1010 using Q5® Site-Directed Mutagenesis Kit (New England BioLab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>New England BioLab</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA concentration was determined using Qubit dsDNA HS (High Sensitivity) Assay (Thermo Fisher), and subsequently diluted to 200 ng in 50 μl of nuclease-free water for sequencing by Nanopore sequencing MinION.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For data analysis, TrimGalore v0.6.5 was used to remove low-quality reads and adaptors from the raw sequencing files.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TrimGalore</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting trimmed paired-end reads were then aligned to the SARS-CoV-2 genome (GenBank accession MT108784) using Bowtie2 v2.3.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, a consensus sequence was generated for each virus stock using Samtools v1.10 with the -d option set to 10,000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.11.04.355842: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S protein was surface captured via anti-AviTag pAb covalently immobilized on a CM5 chip, RBD protein was surface captured via StrepTactin XT covalently immobilized on a CM5 chip, and ACE2-mFc was surface captured via covalent immobilization of the Cytiva Mouse antibody capture kit on a C1 chip.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-AviTag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For S binding measurements, recombinant ACE2 (residues 19-615 from Uniprot Q9BYF1 with a C-terminal thrombin cleavage site-TwinStrep-10xHis-GGG-tag, and N- terminal signal sequence) was expressed in Expi293 cells at 37°C and 8% CO2 in a humified incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral growth curve: VeroE6-ACE2 cells (VeroE6 cells induced to overexpress Ace2) either with or without TMPRSS2 overexpression (Rhin et al., 2020 under review) were seeded in a 12- well plate and inoculated with an MOI of 0.01 with either the GLA1 (N439/D614G) or GLA2 (N439K/D614G) virus isolates for 1hr before washing the cells three times in PBS and replacing with 2% DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lenti-X™ 293T cells (Takara, 632180) were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were size filtered, demultiplexed and trimmed with Porechop (https://github.com/rrwick/Porechop), and mapped against reference strain Wuhan-Hu-1 (MN908947).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD residues within 6.0A distance of any ACE2 atoms (determined using MOE) were determined for each of the two copies of the complex in the asymmetric unit, and then were combined to obtain the RBM. 6M0J was obtained from the Coronavirus Structural Task Force server (https://github.com/thorn-lab/coronavirus_structural_task_force) and was further refined (using Refmac5 v5.8.0258), manually fitted (using Coot v0.9) and prepared (using MOE, as described above) in multiple iterative cycles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generated amplicons were used to prepare either Oxford Nanopore or Illumina sequencing libraries.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Nanopore</div><div>suggested: (Oxford Nanopore Technologies, RRID:SCR_003756)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oxford Nanopore libraries were prepared as described in the link above and sequenced in a flow cell R9.4.1 (Oxford Nanopore Technologies, Part Number FLO- MIN106D), using MinKNOW version 19.12.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinKNOW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were size filtered, demultiplexed and trimmed with Porechop (https://github.com/rrwick/Porechop), and mapped against reference strain Wuhan-Hu-1 (MN908947).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Porechop</div><div>suggested: (Porechop, RRID:SCR_016967)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using Nanopolish 0.11.3 and accepted if they had a log- likelihood score of greater than 200 and minimum read coverage of 20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were trimmed with trim_galore (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) and mapped with BWA (Li and Durbin, 2009)) to the Wuhan-Hu-1 (MN908947) reference sequence, followed by primer trimming and consensus calling with iVar (Grubaugh et al., 2019) and a minimum read coverage of 10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/</div><div>suggested: (Trim Galore, RRID:SCR_011847)</div></div><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A maximum-likelihood phylogenetic tree was constructed using IQ-TREE with the the following parameters: -czb -blmin 0.0000000001 -m HKY --runs 5 and all other parameters set to default.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tree was visualised with custom python code using the baltic library, https://github.com/evogytis/baltic.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Change in molecules bound to the biosensors caused a shift in the interference pattern that was recorded in real time and plotted using GraphPad Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed and visualized with Prism (Version 8.4.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN66726260</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.01.11.21249265: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each forward primer additionally includes on the 5’ end, a random 10 nucleotide sequence to serve as molecular barcode.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 155 samples, corresponding to 48 individuals were analyzed by NGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Barcode sequences were clustered based on sequence and amplicon identity, and consensus calling was done for each molecular tag (or barcode) cluster, by first performing global alignment among all associated reads using MAFFT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Insert length analysis and calculation of viral fragmentation score: For each positive sample with sequencing data, SAMtools was used to capture insert sizes from alignment files with the following specifications: samtools view -f65 -F2048 SampleXYZ_consensus.bam | cut -f 1,4,9 > SampleXYZ_f65F2048.txt where f65 = filter in read paired, first in pair (Reads which are paired and insert sizes for first read in read pair and second in read in read pair will have same same insert size with “negative” length); F2048 = filter out reads with supplementary alignment (removes most subgenomic RNA reads which have part of reads with supplementary alignment and removes chimeric reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Regression analysis and curve fitting was done using Prism 8.0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:There are important limitations to this study. The use of the exact cut-off of VFS to categorize samples into clinical groups may not universally apply. Nonetheless, the basic premise of the argument that more intact virus would reflect in more longer fragments in a clinical sample would universally apply. As the study’s main conclusions are based on NGS, with some comparison to RT-PCR results, without evidence from virus culture studies it cannot be ruled out that some of the observed infectivity measures are correlated and result from a feature of the specific NGS method. In conclusion, we have applied NGS to comprehensively characterize longitudinal samples collected from different sites. NGS is an enabling tool that provides sequence-related information for which it is primarily designed, and also information from size and length dimensions. Based on this, we identify fragment length differences among clinical samples which are correlated to clinical features of infectiousness of SARS-CoV-2, quantification of which could be incorporated as relevant and straightforward measure to determine infection potential.
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.02.05.21250127: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was exempted from Institutional Review Board review by Yale University as it did not engage in research involving human subjects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: 23] Signals Analytics, an advanced analytics consultant that conducted the analysis, accessed these data sources through a third-party data vendor, NetBase.[24,25] These social media posts were geotagged by NetBase both directly, by using geolocation data from posts, and indirectly, by using author profiles and unique domain codes (such as .uk).</td></tr></table>Table 2: Resources
No key resources detected.
Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Our study has several limitations. First, although our third-party data provider reported that about 70% of posts were from the US, we do not know the location for most posts according to our direct geotagging methods, which were only able to tag about 80% of posts (eTable 2). As a result, we cannot make international comparisons, but our dataset is more representative of the US than of any other country. Second, the number of posts included in our dataset was much lower than previous studies, likely due to the types of data sources used, which excluded sites such as Twitter in order to exclude noise that might have obscured signals in social media data, and our methodology, which included removing posts not relevant to our more refined taxonomy. We used a stringent exclusion criterion with a list of prespecified keywords that may also have led to a smaller sample size, but our approach aimed to create a sample with high specificity. Finally, there is no demographic information available from the data posts directly due to privacy considerations and data use agreements. Thus, we cannot determine whether our data sample contains biases due to the demographics of the people who post. For instance, Reddit, which was the most common forum source for our data sample, has been found to be used by a younger, male audience.[45,46]
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.06.17.157982: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following overnight equilibration of ACE2 binding at room temperature, cells were washed in ice-cold PBS-BSA, and resuspended in PBS-BSA containing 1:200 diluted FITC-conjugated anti c-Myc antibody (Immunology Consultants Lab, CMYC-45F) to label for RBD surface expression via a C-terminal c-Myc epitope tag, and 1:200 diluted PE-conjugated streptavidin (Thermo Fisher S866) to detect bound biotinylated ACE2 ligand.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti c-Myc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>c-Myc epitope tag ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For library expression experiments, 45 OD units yeast were washed twice with PBS-BSA and labeled in 3mL 1:100 diluted anti-Myc-FITC antibody for 1hr at 4°C with gentle mixing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-FITC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700448, RRID:AB_10896411)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody epitopes were mapped from crystal structures 6W41 (Yuan et al., 2020b), 6WAQ (Wrapp et al., 2020b), 2DD8 (Prabakaran et al., 2006), 3BGF (Pak et al., 2009), 2GHW (Hwang et al., 2006), 7BZ5 (Wu et al., 2020), and cryo-EM structures 6NB6 and 6NB7 (Walls et al., 2019), and 6WPS (Pinto et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>6NB7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 2.5e5 293T cells per well were seeded in 12-well plates in 1 mL D10 growth media (DMEM with 10% heat-inactivated FBS, 2 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was removed from the 293T-ACE2 cells and replaced with fresh D10 containing 50 μL of pseudovirus supernatant in a final volume of 150 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were transfected into 150mL suspension expi293F or HEK293F cells at 37°C in a humidified 8% CO2 incubator rotating at 130 rpm and harvested 3 days later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment and phylogeny: We used the curated RBD sequence set from Letko et al. (Letko et al., 2020), adding newly described RBD sequences from sarbecovirus strains RaTG13 (Zhou et al., 2020b), RmYN02 (Zhou et al., 2020a), GD-Pangolin and GX-Pangolin (Lam et al., 2020), and the additional non-Asian bat sarbecovirus isolate BtKY72 (Tong et al., 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RaTG13</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For one bin in which the number of HiSeq reads was less than the number of cells sorted into a bin, we re-amplified PCR product from a newly purified plasmid aliquot, and obtained reads via a single lane of MiSeq 50bp single end sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization: The interactive heatmap of mutational effects shown at https://jbloomlab.github.io/SARS-CoV-2-RBD_DMS/ was made using the altair (VanderPlas et al., 2018) Python package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural images were rendered in PyMol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD nucleotide sequences were aligned via mafft with a gap opening penalty of 4.5, and the maximum likelihood phylogeny was inferred in RAxML (Stamatakis, 2014) under the GTR model with 4 gamma-distributed discrete categories of among-site rate variation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:To some degree, these caveats are universal of experimental studies, as even sophisticated animal models are imperfect proxies for true fitness (Louz et al., 2013)—but they are especially true for basic biochemical phenotypes like the ones we measure. However, on a hopeful note, our measurements correlate well with cellular entry by spike-pseudotyped viral particles expressing sarbecovirus RBD homologs (Figures 1D) and single mutants of the SARS-CoV-2 RBD (Figure 4E). Furthermore, fitness ultimately arises from the concerted action of biochemical phenotypes, which are in turn determined by genotype (Dean and Thornton, 2007; Harms and Thornton, 2013; Russell et al., 2014). By making the first link from mutations to biochemical phenotypes, we have taken a step towards enabling better interpretation of viral genetic variation. One important area where our maps do have clear relevance is assessing the potential for SARS-CoV-2 to undergo antigenic drift by fixing mutations at sites targeted by antibodies, as occurs for some other viruses such as influenza (Smith et al., 2004). The RBD is the dominant target of neutralizing antibodies (Cao et al., 2020; Ju et al., 2020; Pinto et al., 2020; Rogers et al., 2020; Seydoux et al., 2020; Shi et al., 2020; Wu et al., 2020; Zost et al., 2020), and so any antigenic drift will be constrained by its mutational tolerance. Our results show that many mutations to the RBD are well-tolerated with respect to both protein folding and ACE2 binding. H...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.07.30.229377: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfected cells were incubated for 3 hours at RT with the following anti-SARS-CoV structural protein monoclonal or polyclonal antibodies at a 1:250 dilution:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV structural protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, mouse anti-SARS-CoV N monoclonal IgN 42c, rabbit anti-SARS-CoV S polyclonal sera (BEI Resources) and mouse anti-2xStrep-tag antibody (Sigma-Aldrich)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-2xStrep-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. Anti-mouse IgG AF555, anti-rabbit IgG AF555, or anti-mouse IgM AF488 conjugated secondary antibodies were added at 1:500 dilution for 1 hour at RT (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse IgG</div><div>suggested: (R and D Systems Cat# AF555, RRID:AB_355438)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (SouthernBiotech Cat# 4030-32, RRID:AB_2795940)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgM</div><div>suggested: (SouthernBiotech Cat# 1021-30, RRID:AB_2794251)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LzGreen SARS-COV-2 S pseudotyped lentivirus were mixed with 2-fold dilutions of the following monoclonal or polyclonal anti-SARS-CoV-2 S antibodies: mouse anti-SARS-CoV S monoclonal IgM 154c</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following anti SARS-CoV-2 S monoclonal and polyclonal antibodies were serially diluted by 2-fold dilutions in blocking buffer: mouse anti-SARS-CoV S monoclonal IgM 154c</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse HRP, and anti-human-HRP secondary antibodies were used at 1:4000 concentration in blocking buffer, and were incubated 1 hour at RT. 50 μL of TMB HRP substrate (ThermoFisher Scientific) was added, and following incubation for 10 minutes at RT, 50μL of 2N H2SO4 was added as a stopping solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-HRP secondary antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Resolved proteins were then transferred to a PVDF membrane, blocked in TBS with 2% BSA 0.1% Tween-20, then incubated with the following antibodies diluted to 1:500 in blocking buffer: mouse anti-SARS-CoV N monoclonal IgM 19c, mouse anti-SARS-CoV M monoclonal IgG1 283c, mouse anti-SARS-CoV E monoclonal IgM 472c, and mouse anti-2xStrep-tag antibody, and anti-His-HRP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus transduction capability was then tittered on 293T-Ace2 cells treated with 50μl of 5μg/ml polybrene (Sigma-Aldritch LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-Ace2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">His-tagged RBD bearing lentivirus was produced in HEK 293T cells and used to infect HEK 293-F suspension cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot: 293T cells were seeded in 10 cm dishes at a density of 3.5 million cells per dish.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum intensity z-projections were prepared in Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.08.24.264333: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated secondary antibodies against T7-tag (Thermo) were diluted 1:7500 and incubated with the well for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T7-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A validated SARS-CoV-2 antibody-negative human serum control, a validated NIBSC SARS-CoV-2 plasma control, was obtained from the National Institute for Biological Standards and Control, UK) and an uninfected cells control were also performed to ensure that virus neutralization by antibodies was specific.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Control , UK </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD (residues 319-541) of the SARS-Cov-2 S protein was expressed as a secreted protein in Spodoptera frugiperda Sf9 cells (Expression Systems) using the Bac-to-bac baculovirus method (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: CLS Cat# 604328/p700_Sf9, RRID:CVCL_0549)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped SARS-CoV-2 neutralization assay: The 293T-hsACE2 stable cell line (Cat# C-HA101) and the pseudotyped SARS-CoV-2 (Wuhan-Hu-1 strain) particles with GFP (Cat# RVP-701G, Lot#CG-113A) or firefly luciferase (Cat# RVP-701L, Lot# CL109A, and CL-114A) reporters were purchased from the Integral Molecular.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hsACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The serum–virus mixes (220 μl total) were incubated at 37 °C for 1 h, after which they were added dropwise onto confluent Vero E6 cell monolayers in the six-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data was processed by Prism 7 (GraphPad) to fit into a 4PL curve and to calculate logIC50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the MS analysis, the data was searched by pLink for the identification of cross-linked peptides.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLink</div><div>suggested: (PLINK, RRID:SCR_001757)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each Nb model was then docked to the RBD structure (PDB 6LZG) by an antibody-antigen docking protocol of PatchDock software that focuses the search to the CDRs and optimizes CXMS-based distance restraints satisfaction (Schneidman-Duhovny, 2012 #52; Schneidman-Duhovny, 2020 #53).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PatchDock</div><div>suggested: (PatchDock, RRID:SCR_017589)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antigen interface residues (distance <6Å from Nb atoms) among the top 10 scoring models, according to the SOAP score, were used to determine the epitopes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SOAP</div><div>suggested: (SOAP, RRID:SCR_000689)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial model was refined in Phenix (Adams, 2010 #61)and adjusted in COOT (Emsley, 2004 #62).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model quality was checked by MolProbity (Williams, 2018 #63).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nb21 comparative modeling was done using the Nb20 structure as a template in MODELLER.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.09.14.20194308: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We enrolled 14,057 participants who all signed a written informed consent that also included permission to extract data from the employer’s administrative databases that contain data on sick leave.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data analyses: With conventional statistical power and two-sided tests of significance, and assuming a cumulative proportion of sick leave among non-exposed persons of 30% and that 10% of the cohort might be exposed, at least 3800 subjects would need to be enrolled to be able to detect associations of 1.4 or greater, a level which was considered to be medically meaningful.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Most participants were between 30-59 years old and 79% were females (Supplementary Table 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum IgG bound to antigen coated beads was detected by F(ab’)2-Goat anti-Human IgG Fc Secondary Antibody, PEfluorescent anti-hIgG (Invitrogen, H10104.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG Fc Secondary Antibody, PEfluorescent anti-hIgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H10104</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The evaluation of different production hosts was based on degree of concordance in antibody reactivity of the alternative hosts with the virus proteins produced in the HEK cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Consequently, antigen reactivity was measured towards three different virus protein-variants, (i) Spike trimers comprising the prefusion-stabilized spike glycoprotein ectodomain [7] expressed in HEK cells and purified using a C-terminal Strep II tag), (ii) Spike S1 domain, expressed in CHO cells and purified using C- terminal HPC4-tag, and (iii) Nucleocapsid protein, expressed in E.coli and purified using a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A limitation is that we were not able to study infections occurring more than six to seven weeks before enrollment, as community transmission of SARS-CoV-2 in the region started only about six to seven weeks before the study. Participants were not questioned about present or prior symptoms, but the hospital rules were clear that employees with symptoms should not be at work and we had, by design, decided to use only sick leave data to avoid possible recall bias. Hospital rules state that also employees working from home that develop COVID-19 symptoms must report this as sick leave. We conclude that antibody testing is a powerful tool for identification of subjects who have had prior virus exposure and are protected against future disease. Although it is commonly assumed that antibodies mark immunity, it is important that it has now been shown in a large cohort study that seropositive subjects have no excess risk for future sick leave. We would like to caution that there is a large number of serology tests currently on the market and the extent of their validation may vary. Also, none of these tests have been specifically validated for the indication proposed here (to separate exposed subjects who are protected from future disease from exposed subjects at risk to develop disease in the future). In summary, the present study has found that validated antibody testing may be helpful in SARS-CoV-2 screening strategies as antibody-positive subjects were found to have no excess risk...
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04411576</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Current and Past SARS-CoV-2 Infection and COVID-19 in Health…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.06.14.151357: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were regularly passaged and tested for presence of mycoplasma contamination (MycoAlert Plus Mycoplasma Detection Kit, Lonza)</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody incubations were performed overnight at 4°C using the following antibodies: rabbit anti-GAPDH 14C10 (0.1 μg/mL, Cell Signaling 2118S), mouse anti-rhodopsin antibody clone 1D4 (1 μg/mL, Novus NBP1-47602) which recognizes the C9-tag added to the Spike proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Cell Signaling Technology Cat# 2118, RRID:AB_561053)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following the primary antibody, the blots were incubated with IRDye 680RD donkey anti-rabbit (0.2 μg/mL, LI-COR 926-68073) or with IRDye 800CW donkey anti-mouse (0.2 μg/mL, LI-COR 926-32212) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-68073, RRID:AB_10954442)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (LI-COR Biosciences Cat# 926-32212, RRID:AB_621847)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike was immunoprecipitated using 2 μg C9 antibodies (Novus NBP1-47602) per sample and incubated on a rotator at 4°C for at least 4 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blotting was performed as described above using mouse anti-rhodopsin antibody clone 1D4 (1 μg/mL, Novus NBP1-47602) which recognizes the C9-tag added to the Spike proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rhodopsin</div><div>suggested: (Novus Cat# NBP1-47602, RRID:AB_10010560)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: A549 cells were obtained from ATCC, HEK293FT cells were obtained from Thermo Scientific, and Huh-7.5 and Caco-2 were a kind gift of B. tenOever (Mt. Sinai).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div><div style="margin-bottom:8px"><div>Huh-7.5</div><div>suggested: RRID:CVCL_7927)</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, for each virus, a T-225 flask of 80% confluent HEK293T cells (Thermo) was transfected in OptiMEM (Thermo) using 25 μg of the transfer plasmid, 20 μg psPAX2, 22 μg spike plasmid, and 175 μl of linear Polyethylenimine (1 mg/ml) (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 lentiviral cloning and ACE2 stable cell line overexpression: To generate pLenti-ACE2-Hygro, we amplified human ACE2 (hACE2) from pcDNA3.1-ACE2 (Addgene 1786) and cloned it into a lentiviral transfer pLEX vector carrying the hygromycin resistance gene using Gibson Assembly Master Mix (NEB E2611L).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7.5-ACE2 and A549-ACE2 cell lines were generated by lentiviral transduction of ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was propagated in Vero E6 cells in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band intensity quantification was performed by first converting Odyssey multichannel TIFFs into 16-bit grayscale image (Fiji) and the then selecting lanes and bands in ImageLab 6.1 (BioRad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each peptide, we computed the difference in predicted affinity between the D614 and G614 variant using R/RStudio and visualized them using the pheatmap R package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis was performed using R/Rstudio 3.6.1 and GraphPad Prism 8 (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.02.03.429555: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins and antibodies: SARS-CoV-2 (438-516) S-RBD((HiS)6 and biotynilated human ACE2 have been purchased from Fisher Scientific (respective references 16534204 and 16545164).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-6X His tag antibody has been purchased from ABCAM (reference ab18184, dilution 1/200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6X</div><div>suggested: (Abcam Cat# ab18184, RRID:AB_444306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti α-tubulin antibody has been purchased from SIGMA (reference T6199, dilution 1/500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti α-tubulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary goat anti-mouse antibody coupled to AlexaFluor 488 has been purchase from Fisher Scientific (Reference Allo2g, dilution 1/400).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound proteins were detected by western blot using anti-His antibody and streptavidin-HRP conjugate (SIGMA, reference GERPN1231).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles were produced by transient transfection of HEK293T(human embryonic kidney cells according to standard protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T(human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA from two different cell clones (human 293T and K562 cells), containing a single integrated copy of the provirus, was used as a normalized cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA from a HEK cell line with one proviral insert (HEK-2C9) was used as a standard for quantification by the ΔCt method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell imaging: For cell imaging 20 000 HEK293T and HEK293T-ACE2 cells were plated on glass coverslips pretreated with poly-L-Lysine solution 0.01% (SIGMA ref P4832) 5 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For quantification of the S-RBD/ACE2 interaction in cellular context 45 000 HEK293T and HEK293T-ACE2 cells were incubated 45 minutes at 37°C in 100µl DMEM and increasing concentrations of RBD recombinant protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with GraphPad Prism 5.01 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sensorgrams curves were plotted using Prism 5.0 software (Graphpad Software, La Jolla, CA) Cells and lentiviral vectors production: Lentivirus vector production was done by the service platform Vect’UB, (INSERM US 005</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epifluorescence microscopy was carried out on a Zeiss Axioimager Z1 driven by Metamorph.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metamorph</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- No funding statement was detected.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.02.05.429566: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Recovered patients and those with an active infection with SARS-CoV-2 were invited to participate and signed a consent letter at the moment of enrollment to the clinical trial NCT04384588.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Inclusion criteria for convalescent patient considered men and women previously confirmed with COVID-19 by PCR test and 21 or more days after symptoms had finished.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins and secondary antibodies: Recombinant SARS-CoV-2 Nucleocapsid Protein with C-terminal His-tag (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the immunodetection, the membranes were separately incubated with either HRP-conjugated secondary antibody anti-human IgG, anti-human IgA or anti-human IgM diluted at 1:20,000 (0.04 μg/ml) in blocking solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Later, each well was incubated at 20°C (±1°C) for 1h with 100 μL of a 20 ng/ml solution of the specific peroxidase-conjugated affiniPure anti-Human isotype antibody, anti-IgG (Fcβ fragment specific) (#709-035-098, Jackson Immuno-Research), anti-IgA (Frα fragment specific) (#109-035-011, Jackson Immuno-Research) and anti-IgM (μ chain) (#709-035-073, Jackson Immuno-Research).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human isotype antibody,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM (μ chain)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence: HeLa cells (ATCC® CCL-2) were transient transfected with a mammalian expression vector expressing a Spike-GFPSpark tag codon optimized fusion SinoBiological VG40589-ACGLN in 10cm plates, 24 h after transfection ~ 8000 cells per well were deposited into 96 well optical plate (Themofisher), after 24 h incubation cells were washed with PBS (phosphate buffered saline solution) 1X 3 times and fixed with 4% paraformaldehyde at room temperature for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pixels were quantified using Fiji Software (v.2.0.0, NIH) and exposition time was used as reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">< Statistical analyses: Statistical analysis was performed using GraphPad Prism software, version 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:We understood the limitations of our work in the number of cases analyzed and the experimental strategy used; however, it provides information for some laboratories with limited resources to apply, exceptionally, basic research tools for monitoring COVID-19 cases during a pandemic.
Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04384588</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID19-Convalescent Plasma for Treating Patients With Activ…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.01.28.21250577: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data (PDB: 6XC2, 6XC4, 7JMP, 7JMO, 6XKQ, and 6XKP) (Supplementary Figure 4) on the three- dimensional structure of six neutralizing antibodies (CC12.1, CC12.3, COVA2-39, COVA2-04, CV07-250, and CV07-270) (Supplementary Figure 4) that bind to the spike glycoprotein of SARS- CoV-2 was used in these studies [6].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV07-250</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CV07-270</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We investigated the binding of the spike glycoprotein Y453F mutant of SARS-CoV-2 to human angiotensin-converting enzyme 2 (ACE2) and determined the affinity of the spike glycoprotein Y453F mutant of SARS-CoV-2 to six neutralizing monoclonal antibodies using the MOE program (three-dimensional protein structure modeling, protein docking analysis: MOLSIS Inc., Tokyo, Japan) and Cn3D macromolecular structure viewer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amount of the bound ACE2, which is proportional to ACE2 inhibition intensity, is then recognized by the Neutralizing Detection Complex containing anti-His antibody and measured through an ELISA-like reaction by reading the absorbance in a microplate spectrophotometer at a wavelength of 450 nm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum from 10 normal (negative for COVID-19) patients and 20 COVID-19 patients with varying immunoglobulin M (IgM) and immunoglobulin G (IgG) antibody levels.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>immunoglobulin G (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVID-19 status was confirmed with RT-PCR, antigen, and/or antibody serology tests.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RT-PCR, antigen,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Adsorption of RBD or RBD Y453F recombinant protein to the solid phase surface of the ELISA plate: HeLa cells were then transfected with pcMV3-2019-nCov-RBD-Flag tag expression vector (2 μg), or the pcMV3-2019-nCov-RBD Y453F-FLag tag expression vector (2 μg) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.02.16.431318: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Furthermore, each cell type enrichment score is differentiated from a population of enrichment scores (suprema) that is obtained in an iterative process in which cell type labels are randomly permutated, yielding an empirical p-value that indicates the significance of enrichment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence detection and protein co-localization: 48 hours post transfection cells were washed with 1x PBS, fixed in 4% paraformaldehyde/1x PBS for 15 min at RT, permeabilized with 0.1 % Triton X-100/1xPBS for 10 min at RT, washed three times with 1x PBS and incubated with 5 % horse serum/1xPBS for 1 h at 20 °C before incubating with the following antibodies (Cell Signaling Laboratories): anti-calnexin (clone C5C9), anti-BiP (clone C50B12), anti-Hsp90a (clone D1A7), anti-ZO1 (clone D7D12), anti-ZO2 (2847), anti-ZO3 (D57G7), anti-claudin 1 (D5H1D), anti-CD2AP (2135), anti-afadin (clone D1Y3Z) or Alexa Fluor 488 anti-DYKDDDDK (flag) tag monoclonal antibody (L5, Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-calnexin</div><div>suggested: (Thermo Fisher Scientific Cat# MA3-027-A488, RRID:AB_2662809)</div></div><div style="margin-bottom:8px"><div>anti-BiP</div><div>suggested: (Cell Signaling Technology Cat# 3177, RRID:AB_2119845)</div></div><div style="margin-bottom:8px"><div>anti-Hsp90a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ZO3 (D57G7), anti-claudin 1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD2AP</div><div>suggested: (Cell Signaling Technology Cat# 2135, RRID:AB_2228922)</div></div><div style="margin-bottom:8px"><div>anti-afadin</div><div>suggested: (Cell Signaling Technology Cat# 13531, RRID:AB_2798249)</div></div><div style="margin-bottom:8px"><div>anti-DYKDDDDK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were separated on NuPAGE 4-12% Bis-Tris gels (Life technologies) before transferring proteins onto Nitrocellulose membranes and incubating with anti-BiP (C50B12, Cell Signaling Laboratories (CSL)), anti-ZO1 (D7D12, CSL), anti-ZO2 (2847, CSL) or Alexa Fluor 488 conjugated anti-DYKDDDDK Tag monoclonal antibody (L5, Sigma) in 5 % BSA, 1x PBS, 0.05 % Tween-20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-BiP (C50B12</div><div>suggested: (Cell Signaling Technology Cat# 3177, RRID:AB_2119845)</div></div><div style="margin-bottom:8px"><div>anti-ZO1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ZO2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Signals were detected either using Radiance Q ECL reagent (Azure Biosystems) after washing and incubation with HRP coupled anti-rabbit antibodies (CSL) or imaged directly using an Azure 600 Western blot imaging system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture, transfection and transduction: HEK293T cells were grown at 37 °C and 5 % CO2 in DMEM supplemented with 10% tetracycline-free fetal bovine serum and 1% Penicillin-Streptomycin (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment ion spectra were searched with Prolucid 66 with the forward and reversed human UniProt database v.07-01-2020, and filtered with DTASelect 67 to a false discovery rate of < 1 %.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot images were quantified in Fiji/ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji/ImageJ</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.08.01.20166553: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Consecutive out-patients diagnosed at the same 4 hospitals prior to March 15th and on a convenience sample of later days were approached for consent to collect serum and saliva at 4–12 weeks PSO.<br>IRB: All samples were collected after Research Ethics Board (REB) review (see Sample section above for the individual REB approval numbers).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">No randomization was performed, since this is an observational study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This observational study focused on monitoring the levels of antibodies to SARS-CoV-2 antigens in serum and saliva of patients with confirmed SARS-CoV-2 infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 4 times, 10 μl of one of the following secondary antibodies (all from Jackson ImmunoResearch) diluted in 1% BLOTTO in PBS-T were added at the indicated concentrations followed by incubation for 2 hr at room temperature: Goat anti-human IgG Fcy – HRP (#109-035-098; 1:40,000 or 0.2 ng per well), Goat anti-human IgM Fc5u – HRP (#109035-129; 1:12,000 or 0.66 ng per well) or Goat anti-human IgA a chain – HRP (#109-035-127; 1:10,000 or 0.8 ng per well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-129, RRID:AB_2337588)</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used for the standard curves were: Human anti-spike S1 IgG (A02038, GenScript), anti-spike S1 IgM (A02046, GenScript) and Ab01680 anti-spike IgA (Ab01680-16, Absolute Antibody), all used at 0.5 to 10ng per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike S1 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A02038</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike S1 IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A02046</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-A02046, RRID:AB_10276779)</div></div><div style="margin-bottom:8px"><div>anti-spike IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human Ig antibody (Southern Biotech, 2010–01) diluted 1:1000 in PBS was added to 96-well Nunc MaxiSorp™ plates (ThermoFisher, 44-2404-21).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human Ig antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-human Ig</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated secondary antibodies against IgA, IgG, and IgM (goat anti-human IgA- and IgG-HRP, Southern Biotech, IgA: 2053–05, IgG: 2044–05, IgM: 2023–05) were added to the appropriate wells at 1:1000 in 2.5% BLOTTO and incubated for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated secondary antibodies against IgA, IgG, and IgM (goat anti-human IgA- and IgG-HRP, Southern Biotech, IgA: 2053–05, IgG: 2044–05, IgM: 2023–05)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HRP-conjugated secondary antibodies against IgA, IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>goat anti-human IgA-</div><div>suggested: (InvivoGen Cat# fab-iga, RRID:AB_11125122)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase (HRP)-conjugated Goat anti human-IgG, IgA, and anti-IgM secondary antibodies (Southern Biotech, IgG: 2044–05, IgA: 2053–05, IgM: 2023–05) were added to wells at dilutions of 1:1000, 1:2000 and 1:1000 in 2.5% BLOTTO, respectively, and incubated for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human-IgG, IgA,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti human-IgG, IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM</div><div>suggested: (SouthernBiotech Cat# 2023-01, RRID:AB_2795619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For serum samples, seven multivariable linear regression models were constructed (one for each of anti-RBD IgA, anti-S IgA, anti-RBD IgG, anti-S IgG, anti-RBD IgM, anti-spike IgM, neutralizing antibody).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RBD IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RBD IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Development and validation of manual colorimetric and automated chemiluminescent assays for monitoring RBD and spike trimers antibodies in serum or plasma. Fig. S2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Effect of heat versus detergent inactivation of saliva samples on the detection of anti-RBD antibodies in a manual, colourimetric ELISA. Fig. S5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To stabilize the spike protein in a trimeric form, the cDNA was cloned in-frame with the human resistin cDNA (aa 23–108) containing a C-terminal FLAG-(His)6 tag (Cricetulus griseus codon bias, GenScript) into a modified cumate-inducible pTT241 expression plasmid and transfected in CHO2353 cells (Stuible et al, manuscript in preparation) followed by methionine sulfoximine selection for 14 days to generate a stable CHO pool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO2353</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stock was expanded using Vero E6 as previously described such that stored aliquots of stock contain 2% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Initial experiments were done with Triton X-100 (Sigma-Aldrich) serially diluted and applied to Vero-E6 cells in 96-well flat bottom plates to determine the minimum concentration required to prevent toxicity to cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike trimer was expressed as follows: the SARS-CoV-2 spike sequence (aa 1–1208 from Genebank accession number MN908947 with the S1/S2 furin site (residues 682–685) mutated [RRAR->GGAS] and K986P / V987P stabilizing mutations was codon-optimized (Cricetulus griseus codon bias) and synthesized by Genscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genebank</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These analyses were performed in Prism (GraphPad), Version 8.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">References and Notes:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Notes</div><div>suggested: None</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.09.09.20191205: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2- specific antibodies were detected using phycoerythrin (PE)-conjugated mouse anti-human pan-IgG, IgG1, IgG2, IgG3, IgA1 or IgA2 (Southern Biotech) at 1.3μg/ml, 25μl per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human pan-IgG, IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2, IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD neutralising human IgG1 antibody (ACROBiosystems, USA) was included as a positive control, in addition to COVID-19 negative plasma and buffer only negative controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies for surface staining included: CD19-ECD (J3-119) (Beckman Coulter), CD20 Alexa700 (2H7), IgM-BUV395 (G20-127), CD21-BUV737 (B-ly4), IgDCy7PE (IA6-2), IgG-BV786 (G18-145) (BD), CD14-BV510 (M5E2), CD3-BV510 (OKT3), CD8a-BV510 (RPA-T8), CD16-BV510 (3G8), CD10-BV510 (HI10a), CD27-BV605 (O323) (Biolegend), IgA-Vio450 (clone) (Miltenyi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BD Biosciences Cat# 740204, RRID:AB_2739954)</div></div><div style="margin-bottom:8px"><div>CD21-BUV737</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD14-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OKT3</div><div>suggested: (BD Biosciences Cat# 566779, RRID:AB_2869862)</div></div><div style="margin-bottom:8px"><div>CD8a-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD10-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27-BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA-Vio450</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following stimulation, cells were washed, stained with Live/dead Blue viability dye (ThermoFisher), and a cocktail of monoclonal antibodies: CD27 BUV737 (L128), CD45RA PeCy7 (HI100), CD20 BUV805 (2H7), (BD Biosciences), CD3 BV510 (SK7), CD4 BV605 (RPA-T4), CD8 BV650 (RPA-T8)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (BD Biosciences Cat# 751682, RRID:AB_2875668)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: (BD Biosciences Cat# 742052, RRID:AB_2871341)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/202042 was passaged in Vero cells and stored at −80C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ectodomain of SARS-CoV-2 (isolate WHU1;residues 1 – 1208) was synthesised with furin cleavage site removed and P986/987 stabilisation mutations45, a C-terminal T4 trimerisation domain, Avitag and His-tag, expressed in Expi293 cells and purified by Ni-NTA affinity and size-exclusion chromatography using a Superose 6 16/70 column (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparison of B and T cell frequencies at first and final sampling was performed using Wilcoxon Rank Sum test in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 52 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2021.02.17.21251933: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work with infectious virus was performed in a Biosafety Level 3 laboratory and approved by the Institutional Biosafety Committee and Environmental Health and Safety. UCLA: Calu3 cells were seeded at 3x104 cells per well in 0.2 ml volumes in 96-well plates.<br>IRB: EHR analysis for UPHS was performed under University of Pennsylvania Institutional Review Board (IRB) protocol #844360 and for MSMC under IRB#20-00338. Outcome: The primary outcome of our case-control EHR study was COVID-19 susceptibility where cases are defined by positive test results from RT-PCR of nasal samples and controls with negative test results.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies to the SARS-CoV-2 N protein were purchased from Invitrogen (#PA1- 41386).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>the SARS-CoV-2 N protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 N protein</div><div>suggested: (ABclonal Cat# A20021, RRID:AB_2862924)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies from Cell Signaling included phospho-Glycogen Synthase (#3891), phospho-S6 (#4858), β-catenin (#9562), phospho-β-catenin (#9561), GAPDH (#2118), PKCα (#2056), PKCδ (#2058), PKCε (#2683), and phospho (Ser) substrate (#2261).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phospho-Glycogen Synthase</div><div>suggested: (Cell Signaling Technology Cat# 3891, RRID:AB_2116390)</div></div><div style="margin-bottom:8px"><div>phospho-S6 (#4858),</div><div>suggested: (Cell Signaling Technology Cat# 4858, RRID:AB_916156)</div></div><div style="margin-bottom:8px"><div>β-catenin</div><div>suggested: (Cell Signaling Technology Cat# 9562, RRID:AB_331149)</div></div><div style="margin-bottom:8px"><div>phospho-β-catenin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (Cell Signaling Technology Cat# 2118, RRID:AB_561053)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other antibodies included antibodies to GSK-3 (Calbiochem #368662), Tau (T14/46 antibodies provided by Virginia Lee, University of Pennsylvania), and β-actin (Sigma #A5441).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSK-3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T14/46</div><div>suggested: (Abcam Cat# T1446, RRID:AB_10704455)</div></div><div style="margin-bottom:8px"><div>β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immunoprecipitation/protein kinase assays, anti-Myc-tag antibody was incubated with Surebeads Protein G megnetic beads (Bio-Rad, #1614023) for 10 min, lysates were then added for an additional 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48 hours post infection (hpi), the cells were fixed with 4% paraformaldehyde and viral infection was examined by immunofluorescent analysis (IFA) using SARS-CoV Spike (S) antibody [BEI Resources: NR-616 Monoclonal Anti-24 SARS-CoV S Protein (Similar to 240C)].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-24 SARS-CoV S Protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture, transfections, and CRISPR/Cas9 knockout: HEK293T cells (ATCC #CRL-1573) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, GIBCO #11965) supplemented with 10% Fetal Bovine Serum (Hyclone #SH30071.03) and 1% penicillin/streptomycin (GIBCO #15140), and were maintained at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two days after transduction, about 1,000 tranduced 293T cells were mixed with 1ml of methylcellulose (MethoCult H4034 Optimum, Stem Cell Technologies) into a 6-well plate and cultured at 37°C and 5% CO2 for two weeks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All work with infectious virus was performed in a Biosafety Level 3 laboratory and approved by the Institutional Biosafety Committee and Environmental Health and Safety. UCLA: Calu3 cells were seeded at 3x104 cells per well in 0.2 ml volumes in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The total number of cells and the number of infected cells were measured using MetaXpress 5.3.3 cell scoring module and the percentage of infected cells was calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaXpress</div><div>suggested: (MetaXpress, RRID:SCR_016654)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To minimize these differences, we used RxNorm – a resource of standardized nomenclature for drug names from the National Library of Medicine45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RxNorm</div><div>suggested: (RxNorm, RRID:SCR_006645)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:While the association of lithium therapy and reduced risk of COVID-19 across three health systems is both signficant and intriguing, observational studies have many limitations. A variety of factors with potential biases cannot be measured even after comparing the cases and controls in a manner that accounts for known confounding factors using a rigorous matching algorithm. For instance, details on medicine usage were derived from records of prescription orders, but information on compliance before SARS-CoV-2 PCR testing is not available. In addition, the collection of a non-random sample population can create a collider bias and lead to distorted associations. For example, the COVID-19 test was restricted particularly in the early pandemic to symptomatic patients so that many asymptomatic patients in the EHR were not tested. These findings should therefore be interpreted carefully and deeper investigation is required in a cohort with a larger sample size. Prior work has shown that lithium and the GSK-3 inhibitor Kenpaullone inhibit N phosphorylation and reduce viral titers in SARS-CoV and JHMV infected Vero6 cells8, 9 and GSK3 knockdown also impairs replication of IBV in Vero cells15. We also show that multiple small molecule GSK-3 inhibitors, including CHIR99021, BIM-I, AR-A014418, Enzastaurin, and Sotrastaurin block SARS-CoV-2 phosphorylation. These pharmacological studies are compelling evidence that GSK-3 is a critical host kinase for N protein, but these drugs may have ...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2021.02.22.432402: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human IgG1 CR3022 antibody (28) (GenBank: ABA54613.1 and ABA54614.1) was expressed from heavy and light chain AbVec expression vectors in Expi293™ cells (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IgG1 CR3022 antibody</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>Human IgG1</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This construct was expressed as a secreted protein by a stable Drosophila S2 cell line (30) and affinity purified using C-tag affinity resin (Thermo Fisher Scientific) followed by a size-exclusion chromatography polishing step in 20 mM Tris, 150 mM NaCl, pH 7.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2</div><div>suggested: DGRC Cat# 150, RRID:CVCL_Z831)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04275245</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Study of Anti-CD147 Humanized Meplazumab for Inject…</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.09.24.311027: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All mouse experiments were approved by the institutional animal care and use committee (IACUC) and were conducted according to international guidelines for animal studies.<br>IRB: Human COVID-19 convalescent serum samples: 41 human convalescent sera samples from recovered COVID-19 patients (table S1) were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.<br>Consent: Human COVID-19 convalescent serum samples: 41 human convalescent sera samples from recovered COVID-19 patients (table S1) were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Rhesus Macaques (3-6 years old) were randomized into 3 groups of 6 animals, and immunized intramuscularly with either PBS as a negative control, or 30 μg S-Trimer adjuvanted with 0.25 mL AS03, or 30 μg S-Trimer adjuvanted with 1.5 mg CpG 1018 plus 0.75 mg alum.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Chengdu Dossy Experimental Animals Co.,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 3 times with PBST, the plates were incubated with rabbit anti-Trimer-Tag antibody (Clover Biopharma) at 37°C for 1 h, followed by washing 3 times with PBST and then a 1:20000 dilution of goat anti-rabbit IgG-HRP (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Trimer-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 3 times with PBST, the plates were incubated with rabbit anti-Trimer-Tag antibody (Clover Biopharma) at 37°C for 1 h, followed by washing 3 times with PBST and then a 1:20000 dilution of goat anti-rabbit IgG-HRP (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Trimer-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, freshly-trypsinized Vero-E6 cells were added to each well at 20000 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Chengdu Dossy Experimental Animals Co.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sprague Dawley (SD) rats immunogenicity studies were performed at JOINN Laboratories Inc. (Suzhou, China), and SD rats (6-9 weeks old) were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd. Studies with SD rats were compliant with the policies of JOINN Laboratories Inc., the Guide for the Care and Use of Laboratory Animals (8th Edition, Institute of Laboratory Animal Resources, Commission on Life Sciences, National Research Council; National Academy Press; Washington, D.C., 2010), and the U.S. Department of Agriculture through the Animal Welfare Act (Public Law 99-198).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vector was then stably transfected into GH-CHO (dhfr -/-) cell line and high expression clones were selected and adapted to SFM-4-CHO (Hyclone) serum free medium and ACE2-Fc was produced in 15 L bioreactors, as described for Endo180-Fc above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dhfr -/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After stepwise gene amplification with increasing concentrations (0.0–10 nM) of MTX (Sigma), the clones producing the highest S-Trimer titer were then adapted to SFM-4CHO serum-free medium (GE BioSciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE BioSciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using the Prism 8.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04405908</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SCB-2019 as COVID-19 Vaccine</td></tr></table>
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.10.09.20209858: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample IDs were composed of six characters generated randomly from the set of alphanumeric characters (a-zA-Z0-9) (random string generator https://www.random.org/strings/), excluding letters O, I, l, Z, Q and numbers 0, 1, 2, 9 to minimize human read errors.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Negative controls taken from patients prior to November 2019 were obtained from Naha Municipal Hospital from intravenous blood, and from a commercial serum pool (Human Serum from human male AB plasma, Sigma Aldrich H4522-100ML</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein purity was verified by SDS-PAGE and confirmed by Western blot with MonoRab™ Anti-His Tag (C-term) Antibody (Nr. 25B6E11, GenScript,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His Tag (C-term</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, another threshold, calculated as 4-times the average blank, which has been demonstrated to be valid for identifying anti-SARS-CoV-2 antibody-positive samples was used instead (6).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Contrast transfer function (CTF) estimation, particle picking and 2D classification were performed with RELION 3.1 (5)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignments: The full-length sequences of SARS-CoV, MERS-CoV S protein (UniProt ID: P59594 and K9N5Q8, respectively) were aligned pairwise using ClustalW2 (8), against the SΔcs sequence (3)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW2</div><div>suggested: (ClustalW2, RRID:SCR_002909)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figure preparation and digital processing: Images of protein gel and Western blot in Figure 1A were acquired by smartphone camera, cropped and adjusted for intensity level in Adobe Photoshop 2020 (Adobe Inc, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs in Figures 2-5 were plotted with GraphPad Prism v8.4.3 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software, USA), using the scatter plot function (Figure 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.08.25.256339: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extract of each lysed clone was applied as a 1:200 dilution (final concentration) in PBSTB (PBS supplemented with 0.1% Tween 20® and 0.2% (w/v) BSA, pH 7.4) together with 20 nM (final concentration) biotinylated spike protein domain, 1:400 (final concentration) of anti-6His-D2 HTRF antibody – FRET acceptor conjugate (Cisbio) and 1:400 (final concentration) of anti-strep-Tb antibody FRET donor conjugate (Cisbio, France) to a well of a 384-well plate and incubated for 120 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>biotinylated spike protein domain</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-6His-D2 HTRF</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-strep-Tb</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies against MERS-S (2), SARS-S or SARS2-S were included as a positive control(47).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MERS-S ( 2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum concentrations were determined by sandwich ELISA using RBD as capture reagent and an anti-His-tag antibody as detection reagent and using a standard curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: Vero E6 cells (African green monkey kidney cells, ATCC® CRL1586™) purchased from ATCC (Manassas, VA 20110 USA) were passaged in cell culture medium DMEM (FG0445) containing 10% FBS and supplements (2mM L-Glutamine, Non-essential amino acids and 100 U/ml Penicillin 100 μg/ml Streptomycin and HEPES, all from Biochrom, Berlin, Germany) at 37°C with CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells were transfected with pCAGGS expression vectors encoding MERS-S, SARS-S or SARS2-S carrying a 16-, 28- or 18-a.a. cytoplasmic tail truncation, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twenty-four hours later, supernatants containing SARS2-S pseudotyped VSV particles were harvested and titrated on African green monkey kidney Vero E6 (ATCC#CRL-1586) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data (relative light unit values) were exported to GraphPad Prism v8.01, and the % neutralization data were normalized to the untreated PsV signal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing: Movie stacks were manually inspected and then imported in Relion version 3.0.1(48).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Drift and gain correction were performed with MotionCor2(49), and GCTF(50) was used to estimate the contrast transfer function for each movie.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, PyMOL (The PyMOL Molecular Graphics System, Version 2.0, Schrödinger, LLC) and BioRender (BioRender.com)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Certara, Princeton, USA) or GraphPadPrism (GraphPad Software, La Jolla,USA) and non-compartmental analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:A number of alternative molecules are being developed to complement and partially overcome this limitation of antibodies. Here we describe the generation of DARPin molecules - one prominent alternative to antibodies(30) amongst others(31–34) - that bind the SARS-CoV-2 spike protein. We tested a library of one trillion DARPin molecules and identified multiple DARPin molecules with different functionalities and binding specificities. By molecular linkage of individual DARPin molecules, we developed multi-DARPin molecules with low picomolar neutralizing activity and demonstrated their protective efficacy against SARS-CoV-2 infection in a hamster model. In particular, reduced lung tissue damage and reduced virus replication in the lower and upper respiratory tract were observed, the latter also being important for reducing virus shedding and transmission. The most advanced of those multi-DARPin molecules, MP0420 or ensovibep, is currently being studied in Phase 1. The most potent neutralizing mono-DARPin molecules were found to target the RBD, blocking the spike-ACE2 interaction necessary for infection. This finding is congruent with the identified epitopes of potent neutralizing antibodies obtained from COVID-19 patients(20, 35-39). Thus, the in vitro approach using DARPin molecules independently confirms that the ACE2 interaction site on the SARS-CoV-2 spike protein is one of the most vulnerable sites to block virus infection in cell culture. The single-chain binding domain nat...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 14 and 30. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.08.26.266825: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression of the proteins was verified by SDS-PAGE and western blotting using a HRP-conjugated anti-Strep-tag antibody (dilution 1/20,000, iba lifesciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For chicken samples, an anti-chicken conjugate (Rabbit anti-Chicken IgY (H+L) Secondary Antibody, HRP; ThermoFisher Scientific) diluted 1/10,000 was applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Chicken IgY</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells were grown in suspension in Expi293 expression medium (ThermoFisher Scientific) at 37 °C, 8 % CO2, and 125 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotin was blocked by adding BioLock (iba lifesciences) as recommended, and the supernatant was purified using Strep-Tactin XT Superflow high capacity resin (iba lifesciences) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLock</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, three sequential sera from a naturally SARS-CoV-2 infected cat were included (ProMED-mail, 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProMED-mail</div><div>suggested: (ProMed-Mail, RRID:SCR_010260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses and visualizations were performed using GraphPad Prism version 8.0 for Windows (GraphPad Software, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.12.09.417741: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pET15D Twinstrep 3C SARS-CoV-2 Nsp3 N179-N1329 6His C856A (DU67898) was made by adding the C856A mutation to clone DU67831 using PCR mutagenesis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C856A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfections, lysis and Co-Immunoprecipitations: A549 human alveolar epithelial cells were transfected with empty vector in triplicate or with vectors expressing SARS CoV-2 Nsp3ΔTM or PLpro fused to a 2xStrep tag at the N-terminus (4 replicates each).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pTXB1 Halo 3C SARS-CoV-2 (2019-nCoV) Nsp1 1-179-Intein CBD (DU67780 was made using NEBuilder (New England Biolabs), amplifying the vector from existing clone DU28033 (pTXB1-HALO-Mxe Intein-CBD) and the Nsp1 1-179 insert from existing clone DU66413 (pGEX6P1 2019-nCoV Nsp1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nsp1 1-179-Intein CBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(PepMap C18 100A - 300µm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PepMap</div><div>suggested: (BioWorks, RRID:SCR_014594)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MaxQuant output protein group text files were processed using Perseus software suite (Tyanova et al, 2016), version 1.6.10.45 was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (Perez-Riverol et al, 2019) partner repository with the dataset identifier PXD022904.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectra were acquired with a RapifleX MALDI-TOF/TOF instrument from Bruker Daltonics equipped with Compass software for FlexSeries 2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Compass</div><div>suggested: (COMPASS, RRID:SCR_015874)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data sets were further processed using Excel or GraphPad Prism (v7.03;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism was utilized for graphical representation of the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.04.25.20079103: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We searched the covid-19 living evidence database [10], which is generated using automated workflow processes [5] to: i) provide daily updates of searches of four electronic databases: Medline Pubmed</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ovid Embase, bioRxiv and medRxiv, using medical subject headings and free text keywords for SARS-CoV-2 infection and covid-19; ii) de-duplicate the records; iii) tag records that are preprints; and iv) allow searches of titles and abstracts using Boolean operators.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One reviewer extracted data using a pre-piloted extraction form in REDCap and a second reviewer verified the extracted data using the query system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:Strengths and weaknesses: A strength of this review is that we used clear definitions and separated review questions to distinguish between SARS-CoV-2 infections that remain asymptomatic throughout their course from those that become symptomatic, and to separate proportions of people with infection from their contribution to transmission in a population. This living systematic review uses methods to minimise bias whilst increasing the speed of the review process [5,6], and will be updated regularly. We only included studies that provided information about follow-up through the course of infection, which allowed reliable assessment about the proportion of asymptomatic people in different settings. In the statistical synthesis of proportions, we used a method that accounts for the binary nature of the data and avoids the normality approximation (weighted logistic regression). Limitation of the review are that most included studies were not designed to estimate the proportion of asymptomatic SARS-CoV-2 infection and definitions of asymptomatic status were often incomplete or absent. The risks of bias, particularly those affecting selection of participants, differed between studies and could result in both underestimation and overestimation of the true proportion of asymptomatic infections. Also, we did not consider the possible impact of false negative RT-PCR results, which might be more likely to occur in asymptomatic infections [116] and would underestimate the proportion of a...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a protocol registration statement.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.05.31.20118554: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human specimens and data: All experiments and analyses involving samples from human donors were conducted with the approval of the local ethics committee (KEK-ZH-Nr. 2015-0561, BASEC-Nr. 2018-01042, and BASEC-Nr. 2020-01731), in accordance with the provisions of the Declaration of Helsinki and the Good Clinical Practice guidelines of the International Conference on Harmonisation.<br>Consent: EDTA plasma from healthy donors was obtained from the Blutspendedienst (blood donation service) Kanton Zürich and Kanton Luzern from donors who signed the consent that their samples can be used for conducting research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Additionally, we added 52 and 70 randomly selected prepandemic samples for the BDS and the USZ cohort respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-throughput serological screening: In order to test the samples for the presence of IgG antibodies directed against SARS-CoV-2 antigens, high-binding 1536-well plates (Perkin Elmer, SpectraPlate 1536 HB) were coated with 1 μg/mL S or RBD or NC in PBS at 37 °C for 1 h, followed by 3 washes with PBS-T (using Biotek El406) and by blocking with 5% milk in PBS-T (using Biotek MultifloFX peristaltic pumps) for 1.5 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the sample incubation for 2 h at RT, the wells were washed five times with wash buffer and the presence of IgGs directed against above-defined SARS-CoV-2 antigens was detected using an HRP-linked anti-human IgG antibody (Peroxidase AffiniPure Goat Anti-Human IgG, Fcγ Fragment Specific, Jackson, 109-035-098, at 1:4000 dilution in sample buffer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The day after, membranes were washed four times with PBS-T and incubated for 1 hours with an anti-human secondary antibody, HRP-conjugated, diluted 1:10000 in 1% SureBlock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human secondary antibody, HRP-conjugated,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a positive control, one membrane was incubated overnight with mouse anti-Histag antibody (ThermoFisher, dilution 1:10000 in 1% SureBlock) and subsequently with anti-mouse secondary antibody, HRP-conjugated (Jackson, dilution 1:10000 in 1% SureBlock).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Histag</div><div>suggested: (RevMAb Biosciences Cat# 54-1161-00, RRID:AB_2716428)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Details of viral proteins used for this study: For high-throughput serology, the following proteins were used: SARS-CoV-2 S (pHL-Sec; aa. 11208, C-terminal 8His-Twin-Strep) and RBD (pOPINTTGNeo; aa. 330-532, C-terminal 6His) pro at the SGC in Oxford and the nucleocapsid protein from AcroBiosystems (AA Met 1 - Ala 419, C-terminal his-tag, NUN-C5227).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 chemiluminescent microparticle immunoassay from Abbott (Abbott Park, IL, USA) detects IgG against the nucleocapsid antigen and was performed on an Architect™ analyser.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For competitive ELISA, we used: The prefusion ectodo of the SARS-CoV-2 S protein (Lausanne, EPFL SV PTECH PTPSP), the RBD from Tren- zyme (C-terminal his-tag, P2020-001) and the nucleocapsid protein from AcroBiosystems (AA Met 1 - Ala 419, C-terminal his-tag, NUN-C5227).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.07.07.20148106: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from all participants in this study and was approved by the following IRBs: 1) IRB# SUNY:269846.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were cultured in complete RPMI 1640 medium (RPMI 1640 supplemented with 10% FBS; Atlanta Biologicals, Lawrenceville, GA), 8% GlutaMAX (Life Technologies), 8% sodium pyruvate, 8% MEM vitamins, 8% MEM nonessential amino acid, and 1% penicillin/streptomycin (all from Corning Cellgro) for 72 hours, collected using %0.05 Trypsin-0.53 mM EDTA (Corning Cellgro) and stained with Biotinylated Human ACE2 / ACEH Protein, Fc,Avitag (Acro Biosystems) then stained with APC anti-human IgG Fc Antibody clone HP6017 (Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">WT and ACE2 over-expressing HEK-293T were also stained with SARS-CoV-2 S1 protein, Mouse IgG2a Fc Tag (Acro Biosystems) followed with APC Goat anti-mouse IgG2a Fc Antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mouse IgG2a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-S-RBD antibody and ACE2-Fc were both tested at a 5 μ/mL starting concentration and in additional 5-fold serial dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antibody detection using ELISA: To evaluate antibodies binding to CoV-2 S-RBD protein, SARS-CoV-2 Spike S1-RBD IgG and IgM ELISA Detection Kit from GenScript was used according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CoV-2 S-RBD protein, SARS-CoV-2 Spike S1-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus neutralization assay: Three-fold serially diluted monoclonal antibodies including anti-SARS-CoV-2 Neutralizing human IgG1 Antibody from Acro Biosystems, NAb#1 (Fig 4c, d), GenScript clone ID 6D11F2, NAb#2 (Fig 4d) and GenScript clone ID 10G6H5, NAb#3 (Fig 4d), Invitrogen clone ID MA5-35939 Nab#4 (Fig 4d), recombinant human ACE2-Fc (Acro Biosystems, sACE2#1 and GenScript, sACE2#2 (Fig 4d) or plasma from COVID-19 convalescent individuals and healthy donors were incubated with RFP-encoding SARS-CoV-2 or GFP-encoding SARS-CoV pseudotyped virus with 0.2 multiplicity of infection (MOI) for 1 hour at 37°C degrees.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35939, RRID:AB_2866551)</div></div><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35939, RRID:AB_2866551)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal inhibitory concentration for plasma (NT50), ACE2-Fc or monoclonal antibodies (IC50) was determined using 4-parameter nonlinear regression (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-Fc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the virus titers, HEK-293T cells were transduced with full length ACE2-IRES-GFP, ACE2-mKO2 fusion construct lentiviruses and analyzed via flow cytometry for their reporter gene expression 72 hours after infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UConn Healthcare workers who tested positive for the virus by PCR were recruited and samples banked for future testing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UConn Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD FACSymphony A5 analyzer and data were analyzed using FlowJo (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generating human ACE2 over-expressing cells: Wildtype ACE2 sequence was obtained from Ensembl Gene Browser (Transcript ID: ENST00000252519.8) and codon optimized with SnapGene by removing restriction enzyme recognition sites that are necessary for subsequent molecular cloning steps, preserving the amino acid sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl Gene Browser</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SnapGene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad Prism 8.0 software (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal inhibitory concentration for plasma (NT50), ACE2-Fc or monoclonal antibodies (IC50) was determined using 4-parameter nonlinear regression (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.07.17.20155937: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Anonymized samples from blood donors (n=100/week) and pregnant women (n=100/week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All personal identifiers were pseudo-anonymized, and all clinical feature data were blinded to the researchers carrying out experiments until data generation was complete.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Anonymized samples from blood donors (n=100/week) and pregnant women (n=100/week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary HRP-conjugated anti-human antibodies were diluted in blocking buffer and incubated with samples for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (all from Southern Biotech) and dilutions used: goat anti-human IgG (2014-05) at 1:10,000; goat anti-human IgM (2020-05) at 1:1000; goat anti-human IgA (2050-05) at 1:6,000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2014-05, RRID:AB_2795580)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: (SouthernBiotech Cat# 2020-05, RRID:AB_2795603)</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We trained the learners on all 733 training samples and used these to predict the probability of anti-SARS-CoV-2 antibodies in blood donors and pregnant volunteers sampled in 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD domain (RVQ – QFG) of SARS-CoV-2 was cloned upstream of a Sortase A recognition site (LPETG) and a 6xHIS tag, and expressed in 293F cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro virus neutralisation assay: Pseudotyped viruses were generated by the co-transfection of HEK293T cells with plasmids encoding the SARS-CoV-2 spike protein harboring an 18 amino acid truncation of the cytoplasmic tail14; a plasmid encoding firefly luciferase; a lentiviral packaging plasmid (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 15,000 HEK293T-ACE2 cells were then added to each well and the plates incubated at 37°C for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This resulted in more similar distributions for 2019 blood donor samples with 2020 blood donors and pregnant volunteers, as well as smaller coefficients of variation amongst PCR+ COVID patients for both SPIKE and RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPIKE</div><div>suggested: (SPIKE, RRID:SCR_010466)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code and data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.07.21.214759: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All plasma samples were obtained under protocols approved by Institutional Review Boards at both institutions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines have been tested negative for contamination with mycoplasma.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding and ACE2 binding inhibition assay: A conformationally stabilized (6P) version of the SARS-CoV-2 S protein(25), appended at its C-terminus with a trimerization domain, a GGSGGn spacer sequence, NanoLuc luciferase, Strep-tag, HRV 3C protease cleavage site and 8XHis (S-6P-NanoLuc) was expressed and purified from the supernatant of 293T Expi cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutants thereof were also expressed and purifies following substitution of sequences encoding the RBD that originated from the unmodified S-expression plasmids For antibody binding assays, 20ng, 40ng, or 80ng S-6P-NanoLuc (or mutants thereof) were mixed with 100ng of antibodies, C121, C135, or C144, \ diluted in LI-COR Intercept blocking buffer, in a total volume of 60μl/well in 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C144</div><div>suggested: (Leinco Technologies Cat# C144, RRID:AB_2828501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ACE2-binding inhibition assays, 20ng of S-6P-NanoLuc was mixed with 100ng of antibodies, C121, C135 or C144, diluted in 3% goat serum/PBS, in a total volume of 50μl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C121</div><div>suggested: (Leinco Technologies Cat# C121, RRID:AB_2828361)</div></div><div style="margin-bottom:8px"><div>C135</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentrations for plasma (NT50), and monoclonal antibodies (IC50) was calculated using 4-parameter nonlinear regression curve fit to raw or normalized infectivity data (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NT50</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK-293T cells and derivatives were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pHIVNLGagPol, pCCNanoLuc2AEGFP and a WT or mutant SARS-CoV-2 expression plasmid (pSARS-CoV-2Δ19) using polyethyleneimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 minutes incubation, the mixture was incubated with 1×105 293T cells, or 293T/ACE2cl.22 cells for 2 hours at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2cl.22</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR products were gel-purified and sequenced either using Sanger-sequencing or NGS as previously described (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of NGS data, the raw paired-end reads were pre-processed to remove adapter sequences and trim low-quality reads (Phred quality score <20) using BBDuk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phred</div><div>suggested: (Phred, RRID:SCR_001017)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Information regarding RBD-specific variant frequencies, their corresponding P-values, and read depth were compiled using the Python programming language (version 3.7) running pandas (1.0.5), numpy (1.18.5), and matplotlib (3.2.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentrations for plasma (NT50), and monoclonal antibodies (IC50) was calculated using 4-parameter nonlinear regression curve fit to raw or normalized infectivity data (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.medrxiv.org www.medrxiv.org
-
SciScore for 10.1101/2020.07.30.20163824: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding was detected using 1:5,000 goat anti-human IgG-HRP conjugated secondary (Jackson Immunoresearch cat# 109-035-098) with TMB substrate (Fisher cat# 34028) for 12 minutes, with the reaction halted via 2 M sulfuric acid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blot Analysis: Serum samples from patients 1F, 8F, 10F, and an uninfected negative control individual were examined for the presence of anti-ACE2 or anti-S antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used for these experiments included α-Actin (Abcam # ab-49900).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-Actin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA plates (Immulon 1B, ThermoFisher cat# 3355) were coated overnight at 4°C with 2 μg/mL SARS-CoV-2 spike RBD-mFc tag (Sino Biological cat# 40592-V05H) produced in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were infected using the diluted sera and virus mixture and were incubated for 1h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Whole cell extracts from A549 and Vero E6 were analyzed via BCA assay per the manufacturer’s recommendations (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lateral Flow Immunoassay Titer Analysis: Combined anti-SARS-CoV-2 IgG/IgM lateral flow immunoassays were obtained from the following manufacturers: Pinnacle Biolabs SARS</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pinnacle Biolabs</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EasyDiagnosis Biomedicine Co., Ltd COVID-19 (SARS-CoV-2) IgM/IgG Antibody Test Kit, reference SA-2-D (EDiagnostics); SafeCare Bio-Tech COVID-19 IgG/IgM Rapid Test Device (WB/S/P) ref NCO-4022 (SafeCare), AcroBiotech 2019-nCoV IgG/IgM Rapid Test Cassette reference INCP-402 (AcroBiotech); LumiQuick Diagnostics Quick Profile 2019 nCoV IgG/IgM Test Card ref 71108B (LumiQuick); Cellex qSARS-COV-2 IgG/IgM Rapid Test (Cellex); CALTH Care Health AllCheck</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiotech</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Krippendorff’s alpha statistic, and percent agreement as calculated by STATA 13 (StataCorp. 2013. Stata Statistical Software:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine sensitivity and specificity of LFI tests in the healthcare setting for saliva and fingerstick blood, receiver-operator characteristic (ROC) curves were generated with GraphPad Prism version 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two by two tables used to determine positive predictive value (PPV), negative predictive value (NPV), sensitivity, and specificity were generated using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.05.21.108506: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, GISAID EPI_ISL_402125) using MAFFT [51] implemented in the rapid phylodynamic alignment pipeline provided by Augur (github.com/nextstrain/augur).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, for both alignments, a maximum likelihood phylogenetic tree was built using IQ-TREE 2.1.0 Covid release (https://github.com/iqtree/iqtree2/releases/tag/v2.1.0) as the tree-building method [52].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the less stringent masking of the alignment, HomoplasyFinder identified a total of 5,793 homoplasies (Figure S5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HomoplasyFinder</div><div>suggested: (HomoplasyFinder, RRID:SCR_017300)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This was done by retrieving the amino acid changes corresponding to all SNPs at these positions using a custom Biopython (v.1.76) script (https://github.com/cednotsed/nucleotide_to_AA_parser.git).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We simulated a 10,000 nucleotide alignment comprising 1,000 accessions using the rtree() simulator available in Ape v5.3 [59] and genSeq from the R package PhyTools v0.7-2.0 [60] using a single rate transition matrix multiplied by a rate of 6×10−4 to approximately match that estimated in [1].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyTools</div><div>suggested: (phytools, RRID:SCR_015502)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your code.
Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:However, we acknowledge this approach has some limitations. We have, for example, relied on admittedly arbitrary choices concerning the number of minimal observations and nodes required to conduct statistical testing. While it seems unlikely this would change our overall conclusions, which are highly consistent for two tested alignments, results for particular mutations should be considered in light of this caveat and may change as more genomes become available. Further, our approach necessarily entails some loss of information and therefore statistical power. This is because our motivation to test independent occurrences means that we do not handle “embedded homoplasies” explicitly: we simply discard them (Figure 2), although inclusion of embedded homoplasies does not change the overall conclusions (Figure S11b). Finally, while our approach is undoubtedly more robust to demographic confounding (such as founder bias), it is impossible to completely remove all the sources of bias that come with the use of available public genomes. In addition, it is of note that the SARS-CoV-2 population has only acquired moderate genetic diversity since its jump into the human population and, consequently, most branches in the phylogenetic tree are only supported by very few mutations. As a result of the low genetic diversity, most nodes in the tree have only low statistical support [41]. This prompted us to apply a series of stringent filters and masking strategies to the alignment (see Meth...
Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-
-
www.biorxiv.org www.biorxiv.org
-
SciScore for 10.1101/2020.06.17.156455: (What is this?)
Please note, not all rigor criteria are appropriate for all manuscripts.
Table 1: Rigor
NIH rigor criteria are not applicable to paper type.Table 2: Resources
<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of protein abundance by western blotting, HA-HRP (Sigma-Aldrich), ACTB-HRP (Santa Cruz), ATM, MAP1LC3B, MAVS, HSPA1A, TGFβ and SQSTM1, phospho-JNK (T183/Y185), JNK, phospho-p38 (T180/Y182), p38 (Cell Signaling), SARS-CoV-2 (Sino Biological) antibodies were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HSPA1A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SQSTM1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>phospho-JNK (T183/Y185)</div><div>suggested: (R and D Systems Cat# AF1205, RRID:AB_2140857)</div></div><div style="margin-bottom:8px"><div>JNK</div><div>suggested: (Thermo Fisher Scientific Cat# 85-86195-11, RRID:AB_2574775)</div></div><div style="margin-bottom:8px"><div>phospho-p38 (T180/Y182)</div><div>suggested: (R and D Systems Cat# MAB8691, RRID:AB_10890618)</div></div><div style="margin-bottom:8px"><div>p38</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and reagents: HEK293T, A549, Vero E6 and HEK293R1 cells and their respective culturing conditions were described previously22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293R1</div><div>suggested: RRID:CVCL_9831)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells were transduced twice, and ACE2-expressing A549 (ACE2-A549) cells were selected with puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus strains, stock preparation, plaque assay and in vitro infection: SARS-CoV-2-MUC-IMB-1 and SARS-CoV-2-GFP strains20 were produced by infecting Vero E6 cells cultured in DMEM medium (10% FCS, 100 ug/ml Streptomycin, 100 IU/ml Penicillin) for 2 days (MOI 0,01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2 cells were infected with SARS-CoV-2-MUC-IMB-1 strain (MOI 3) for the subsequent experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Affinity purification mass spectrometric analyses of SARS-COV-2, SARS-COV and HCoV protein expressing A549 cells: For the determination of SARS-COV-2, SARS-COV and partial HCoV interactomes, four replicate affinity purifications were performed for each HA-tagged viral protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ingenuity knowledge base was used as a reference dataset, only experimentally observed findings were used for confidence filtering, additionally human species and A549-ATCC cell line filters were set.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ATCC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Co-immunoprecipitation and western blot analysis: HEK293T cells were transfected with pWPI plasmid encoding single HA-tagged viral proteins, alone or together with pTO-SII-HA expressing host factor of interest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total amounts of IFN-α/β in cell supernatants were measured by using 293T cells stably expressing the firefly luciferase gene under the control of the mouse Mx1 promoter (Mx1-luc reporter cells)47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293RI cells were seeded, transfected with pCAGGS-flag-RIG-I plus viral protein constructs and stimulated as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293RI</div><div>suggested: RRID:CVCL_9831)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus strains, stock preparation, plaque assay and in vitro infection: SARS-CoV-2-MUC-IMB-1 and SARS-CoV-2-GFP strains20 were produced by infecting Vero E6 cells cultured in DMEM medium (10% FCS, 100 ug/ml Streptomycin, 100 IU/ml Penicillin) for 2 days (MOI 0,01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression constructs for C-terminal HA tagged viral ORFs were synthesised (Twist Bioscience and BioCat) and cloned into pWPI vector as described previously23 with the following modifications: starting ATG codon was added, internal canonical splicing sites were replaced with synonymous mutations and C-terminal HA-tag, followed by amber stop codon, was added to individual viral open reading frames.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To acquire MS data, the data-independent acquisition (DIA) scan mode operated by the XCalibur software (Thermo Fisher) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>XCalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spectra were searched against forward and reverse sequences of the reviewed human proteome including isoforms (UniprotKB, release 10.2019) and SARS-COV-2, SARS-COV and HCoV proteins by the built-in Andromeda search engine31.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniprotKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatic analysis: Unless otherwise specified, the bioinformatic analysis was done in R (version 3.6), Julia (version 1.4) and Python (version 3.8) using a collection of in-house scripts (available upon request).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis of DDA total proteome, phosphoproteome and ubiquitinome data 6 and 24 hours post SARS-CoV-2 infection of A549-ACE2 cells: The output of MaxQuant was analyzed with Perseus (version 1.6.14.0)36 and visualized with R (version 3.6.0) and RStudio (version 1.2.1335).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Annotation of detected protein groups, phosphosites and ubiquitination sites with GOBP, -MF, -CC, KEGG, Pfam, GSEA, Keywords and Corum as well as PhosphoSitePlus kinase-substrate relations and regulatory sites (version May 1st 2020)37 was performed in Perseus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>Pfam</div><div>suggested: (Pfam, RRID:SCR_004726)</div></div><div style="margin-bottom:8px"><div>Corum</div><div>suggested: (CORUM, RRID:SCR_002254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcripts with low mean normalized count that were flagged by the independent filtering procedure of DESeq2 were removed and those with absolute apeglm shrunk log2 fold change > 0.5 and the p-value < 0.05 were considered differentially expressed in distinct conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene Set Enrichment Analysis: We have used Gene Ontology, Reactome and other EnrichmentMap gene sets of human proteins41 as well as protein complexes annotations from IntAct Complex Portal (version 2019.11)42 and CORUM (version 2019)43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EnrichmentMap</div><div>suggested: (EnrichmentMap, RRID:SCR_016052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcription factor – target gene set libraries from ENCODE were used45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ENCODE</div><div>suggested: (Encode, RRID:SCR_015482)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptome, proteome, ubiquitinome and phosphoproteome changes along with unchanged transcripts/proteins/sites were submitted to the core ingenuity pathway analysis (IPA) (www.ingenuity.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ingenuity pathway analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr></table>Results from OddPub: Thank you for sharing your data.
Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.Results from TrialIdentifier: No clinical trial numbers were referenced.
Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
Results from JetFighter: We did not find any issues relating to colormaps.
Results from rtransparent:- Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
- Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
- No protocol registration statement was detected.
<footer>About SciScore
SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
</footer>
-