10,000 Matching Annotations
  1. Aug 2024
    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, the authors combined imaging approaches with molecular and genetic experiments to

      (i) for the first time establish a chromatin regulatory role for SDG7;<br /> (ii) examine its role in H3K36 methylation, along with its homolog SDG8;<br /> (iii) examine its potential role in mediating antagonism to PRC2, thereby mediating transcriptional activation.

      Strengths:

      The manuscript explores interesting and relevant mechanistic hypotheses about chromatin-mediated gene regulation by combining a range of experimental tools and a genome-wide perspective. The writing is very clear. The study makes good connections to existing data and generates datasets that complement existing datasets, providing a valuable resource to the community.

      Weaknesses:

      Some of the claims appear to need further supporting evidence to establish their robustness.

      Review of the main conclusions and supporting evidence:

      (1) SDG7 contributes to H3K36 methylation at several loci along with SDG8:<br /> This conclusion is supported by the genome-wide differences (measured by ChIP-seq) in H3K36me3 and me2 levels observed between WT, the sdg7 and sdg8 single mutants, and the double mutant. The reduction in H3K36 methylation levels observed at a large number of genes in the sdg7 mutant, and the further reduction in H3K36 methylation levels in the double mutant compared to sdg8 (observed at multiple genes) indicates that SDG7 promotes this transcription-associated modification. The significantly larger number of H3K36 hypomethylated genes in the double mutant (3380) compared to either of the single mutants (523 and 605) indicates lower overall H3K36me3 levels in the double mutant.<br /> While direct evidence of SDG7 methyltransferase activity on H3K36 is lacking, the study reports structural comparisons using AlphaFold predictions that suggest the possibility of such a role.

      (2) SDG7 influences gene expression together with SDG8:<br /> This conclusion is supported by a range of phenotypic differences observed between sdg8 and the double mutant sdg7 sdg8. The reported genome-wide differential gene expression between the WT and the double mutant as well as expression differences in specific genes detected by imaging are also consistent with SDG7 and SDG8 together influencing gene expression. However, a role specifically for SDG7 could be further supported by a direct differential expression analysis between the single mutant sdg8 and the double mutant sdg7 sdg8. A role for SDG7 in gene expression is also consistent with its observed effect on H3K36 methylation, which is generally associated with productive transcription.

      (3) SDG8 is exclusively nuclear, but SDG7 localises to the cytosol and the nucleus in meristematic cells:<br /> This conclusion is supported by imaging of fluorescent-tagged SDG8 and SDG7 in the root tip, which shows nuclear localisation of SDG8-GFP, consistent with previous reports, and a combination of nuclear and cytosolic localisation for SDG7-VENUS. However, the study presents only one replicate - more replicates are needed to establish the robustness of this conclusion.

      (4) Distinct binding patterns of SDG7 and SDG8 on chromatin:<br /> This conclusion is supported by the analysis of genome-wide binding patterns of these proteins measured by ChIP-seq (using fluorescent tagged versions). This data indicates that while SDG7 tends to localise to TSS and TES regions of genes, SDG8 tends to be more uniformly spread across gene loci. These patterns suggest that SDG7 and SDG8 may influence H3K36 methylation through distinct mechanisms, but do not indicate what these mechanisms may be.

      (5) SDG7/SDG8 antagonism with PRC2:<br /> a. SDG7 overlaps with PRC2 and its recruiters on chromatin and can bind to PREs<br /> This conclusion is supported by statistically significant overlaps genome-wide between cis-elements at SDG7 binding peaks and those previously reported to be Polycomb associated. This is further supported by the observation of SDG7 binding peaks close to PRC2 subunit binding peaks at known PRC2 targets.<br /> b. SDG7/SDG8 antagonism with PRC2<br /> This conclusion is supported by the observation that the sdg7 sdg8 double mutant phenotypes are partially rescued by disrupting CLF, one of the PRC2 methyltransferases. However, this does not necessarily suggest a direct antagonism with PRC2, but could be part of a more general antagonism between productive transcription (in which H3K36 methylation plays an active role), and PRC2-mediated silencing.<br /> c. SDG7 can evict PRC2 from PREs to overcome H3K27me3-mediated silencing<br /> This conclusion - that SDG7 directly antagonises PRC2 interaction with cis-elements that mediate its targeting - is partly supported by the observation that inducing overexpression of SDG7 (through dexamethasone induction) can cause changes in CLF occupancy and H3K27me3 levels at certain designated PREs. To establish the robustness of these conclusions, it will be necessary to examine designated regions to be used as a negative control and include a non-transgenic control for the SDG-7-HA ChIP. A suitable negative control may be a non-PRE region known to have a CLF peak and high H3K27me3 levels, where the levels would not be expected to change in this experiment.<br /> It remains to be established whether this apparent antagonism of PRC2 by SDG7 is only part of a more general antagonism of PRC2 by productive transcriptional activity, or whether SDG7 can evict PRC2 from PREs independent of transcripts and therefore is a precursor to switching to an active transcriptional state.<br /> Another aspect that would be interesting to examine in the light of recent findings is the single-cell-level behaviour at these genes targeted by SDG7-to examine whether SDG7 induction is causing individual copies of these genes to stochastically switch to an active transcriptional state so that the observed changes in H3K27me3 result from a fraction of copies completely losing silencing rather than all copies losing some H3K27me3.

      (6) H3K36me3 levels are co-regulated by SDG8 and Paf1c, SDG8 associates with Pol II to deliver transcription-coupled H3K36 methylation<br /> This conclusion is supported by analysis of a subset of loci previously reported to be regulated by Paf1c, which also exhibit changes in the sdg7 sdg8 double mutant as well as a clf mutant. This analysis is based on a qualitative examination of ChIP-seq signal at a small number of loci, and therefore provides indirect support for this conclusion. It is, therefore, difficult to draw mechanistic insights from this analysis that go beyond correlation.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors generated analogs consisting of modified neurotensin (NT) peptides capable of binding to low-density lipoprotein (LDL) and NT receptors. Their lead analog was further evaluated for additional validation as a novel therapeutic. The putative mechanism of action for NT in its antiseizure activity is hypothermia, and as therapeutic hypothermia has been demonstrated in epilepsy, NT analogs may confer antiseizure activity and avoid the negative effects of induced hypothermia.

      Strengths:

      The authors demonstrate an innovative approach, i.e. using LDLR as a means of transport into the brain, that may extend to other compounds. They systematically validate their approach and its potential through binding, brain penetration, in vivo antiseizure efficacy, and neuroprotection studies.

      Weaknesses:

      Tolerability studies are warranted, given the mechanism of action and the potential narrow therapeutic index. In vivo studies were used to assess the efficacy of the peptide conjugate analogs in the mouse KA model. However, it would be beneficial to have shown tolerability in naïve animals to better understand the therapeutic potential of this approach.

      Mice may be particularly sensitive to hypothermia. It would be beneficial to show similar effects in a rat model.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, Karashchuk et al. develop a hierarchical control system to control the legs of a dynamic model of the fly. They intend to demonstrate that temporal delays in sensorimotor processing can destabilize walking and that the fly's nervous system may be operating with as long of delays as could possibly be corrected for.

      Strengths:

      Overall, the approach the authors take is impressive. Their model is trained using a huge dataset of animal data, which is a strength. Their model was not trained to reproduce animal responses to perturbations, but it successfully rejects small perturbations and continues to operate stably. Their results are consistent with the literature, that sensorimotor delays destabilize movements.

      Weaknesses:

      The model is sophisticated and interesting, but the reviewer has great concerns regarding this manuscript's contributions, as laid out in the abstract:

      (1) Much simpler models can be used to show that delays in sensorimotor systems destabilize behavior (e.g., Bingham, Choi, and Ting 2011; Ashtiani, Sarvestani, and Badri-Sproewitz 2021), so why create this extremely complex system to test this idea? The complexity of the system obscures the results and leaves the reviewer wondering if the instability is due to the many, many moving parts within the model. The reviewer understands (and appreciates) that the authors tested the impact of the delay in a controlled way, which supports their conclusion. However, the reviewer thinks the authors did not use the most parsimonious model possible, and as such, leave many possible sources for other causes of instability.

      (2) In a related way, the reviewer is not sure that the elements the authors introduced reflect the structure or function of the fly's nervous system. For example, optimal control is an active field of research and is behind the success of many-legged robots, but the reviewer is not sure what evidence exists that suggests the fly ventral nerve cord functions as an optimal controller. If this were bolstered with additional references, the reviewer would be less concerned.

      (3) "The model generates realistic simulated walking that matches real fly walking kinematics...". The reviewer appreciates the difficulty in conducting this type of work, but the reviewer cannot conclude that the kinematics "match real fly walking kinematics". The range of motion of several joints is 30% too small compared to the animal (Figure 2B) and the reviewer finds the video comparisons unpersuasive. The reviewer would understand if there were additional constraints, e.g., the authors had designed a robot that physically could not complete the prescribed motions. However the reviewer cannot think of a reason why this simulation could not replicate the animal kinematics with arbitrary precision, if that is the goal.

    1. Reviewer #2 (Public Review):

      Summary:

      Pyrotinib, a pan-HER tyrosine kinase inhibitor, has shown significant survival benefits in patients with HER2-positive breast cancer. However, diarrhea is a frequent and important adverse event during pyrotinib treatment. Severe diarrhea may require interruption of pyrotinib treatment, thus affecting its anti-tumor effect and becoming a clinical safety issue. This study evaluated the incidence of diarrhea in patients with early-stage HER2-positive breast cancer treated with nab-paclitaxel and pyrotinib using 42- and 21-day loperamide primary prevention strategies. No significant differences were observed between the 21- and 42-day loperamide durations in the prevention of grade 3 and above diarrhea. Considering the economic cost and patient compliance, 21-day loperamide prophylaxis might represent a more pragmatic and appropriate approach for clinical application.

      Strengths:

      This study has a reasonable design, a clear hypothesis and methodology, and clear results, making the conclusion reliable. Most importantly, the findings have practical implications for the clinical management of pyrotinib-induced diarrhea.

      Weaknesses:

      Although the paper does have strengths in the practical implications for the clinical management of pyrotinib-induced diarrhea, there are still many data presentations that are not clear:

      (1) The baseline characteristics mention that at the cut-off date on September 27, 2023, two patients withdrew from the 21-day group due to intolerable diarrhea and received other anti-tumor therapies for liposarcoma on the face. In the 42-day group, one patient was lost to follow-up and two withdrew from the study due to intolerable diarrhea and bone metastases. So, in the study, how many cases are in each group? The numbers of cases indicated in Figures 1 and 2 are inconsistent.

      (2 ) Why does Figure 3a only compare 3 months of data, while Figure 3b compares 12 months of data?

      (3) It is mentioned in lines 222-229 that a combination treatment of nab-paclitaxel plus pyrotinib is 1-3 months, whereas those of pyrotinib alone is 3-12 months. So, what is the exact duration of the combination treatment and pyrotinib alone treatment?

      (4) This study found that no significant differences were observed between 21-day and 42-day loperamide durations in preventing grade 3 and above diarrhea. However, nab-paclitaxel can also cause diarrhea, and the conclusions would be more reliable if a control group that was not given loperamide were added. It is suggested that the authors add relevant data to further confirm the conclusion.

    1. Reviewer #2 (Public Review):

      Summary:

      Colomb et al. investigated here the heparin-binding activity of the HpARI family proteins from H. polygyrus. HpARIs bind to IL-33, a pleiotropic cytokine, and modulate its activities. HpARI1/2 has suppressive functions, while HpARI3 can enhance the interaction between IL-33 and its receptor. This study builds upon their previous observation that HpARI2 binds DNA via its CCP1 domain. Here, the authors tested the CCP1 domain of HpARIs in binding heparan sulfate, an important component of the extracellular matrix, and found that 1/2 bind heparan, but 3 cannot, which is related to their half-lives in vivo.

      Strengths:

      The authors use a comprehensive multidisciplinary approach to assess the binding and their effects in vivo, coupled with molecular modeling.

      Weaknesses:

      (1) Figure 1C should include Western.

      (2) Figure 1E: Why does HpARI1 stop binding DNA at 50%?

      (3) ITC binding experiment with HpARI1?Also, the ITC results from HpARI2 do not seem to saturate, thus it is difficult to really determine the affinity.

      (4) It would be helpful to add docking results from HpARI1.

      (5) Some conclusions are speculative and need to remain in the Discussion. e.g.:<br /> a) That HpARI3 may be able to diffuse farther<br /> b) That DNA/HS may trap HpARI1/2 at the infection site.

    1. Reviewer #2 (Public Review):

      This study significantly advances our understanding of the metabolic reprogramming underlying astrocyte activation in neurological diseases such as multiple sclerosis. By employing an experimental autoimmune encephalomyelitis (EAE) mouse model, the authors discovered a notable nuclear translocation of PKM2, a key enzyme in glycolysis, within astrocytes. Preventing this nuclear import via DASA 58 substantially attenuated primary astrocyte activation, characterized by reduced proliferation, glycolysis, and inflammatory cytokine secretion.

      Moreover, the authors uncovered a novel regulatory mechanism involving the ubiquitin ligase TRIM21, which mediates PKM2 nuclear import. TRIM21 interaction with PKM2 facilitated its nuclear translocation, enhancing its activity in phosphorylating STAT3, NFκB, and c-myc. Single-cell RNA sequencing and immunofluorescence staining further supported the upregulation of TRIM21 expression in astrocytes during EAE.

      Manipulating this pathway, either through TRIM21 overexpression in primary astrocytes or knockdown of TRIM21 in vivo, had profound effects on disease severity, CNS inflammation, and demyelination in EAE mice. This comprehensive study provides invaluable insights into the pathological role of nuclear PKM2 and the ubiquitination-mediated regulatory mechanism driving astrocyte activation.

      The author's use of diverse techniques, including single-cell RNA sequencing, immunofluorescence staining, and lentiviral vector knockdown, underscores the robustness of their findings and interpretations. Ultimately, targeting this PKM2-TRIM21 axis emerges as a promising therapeutic strategy for neurological diseases involving astrocyte dysfunction.

      While the strengths of this piece of work are undeniable, some concerns could be addressed to refine its impact and clarity further.

    1. Reviewer #2 (Public Review):

      The paper by Willems aimed to uncover the neural implementations of threat omissions and showed that the VTA/SN activity was stronger following the omissions of more probable and intense shock stimulation, mimicking a reward PE signal.

      My main concern remains regarding the interpretation of the task as a learning paradigm (extinction) or simply an expectation violation task (difference between instructed and experienced probability), though I appreciate some of the extra analyses in the responses to the reviewers. Looking at both the behavioral and neural data, a clear difference emerges among different US intensities and non-0% vs. 0% contrasts, however, the difference across probabilities was not clear in the figures, potentially partly due to the false instructions subjects received about the shock probabilities.

      The lack of probability related PE demonstration, both in behavior and to a less extent in imaging data, does not fully support the PE axioms (0% and 100% are by themselves interesting categories since the instruction and experience matched well and therefore might need to be interpreted differently from other probabilities).

      As the other reviewers pointed out, the application of instruction together with extinction paradigm complicates the interpretation of results. Also, the trial-by-trial analysis suggestion was responded by the probability x run interaction analysis, which still averaged over trials within each run to estimate a beta coefficient. So my evaluation remains that this is a valuable study to test PE axioms in the human reward and salience systems but authors need to be extremely careful with their wordings as to why this task is not a particularly learning paradigm (or the learning component did not affect their results, which was in conflict with the probability related SCR, pleasantness ratings as well as BOLD signals).

    1. Reviewer #3 (Public Review):<br /> Summary:

      Federer et al. describe the laminar profiles of GABA+ and of PV+ neurons in marmoset V1. They also report on the selectivity and efficiency of expression of a PV-selective enhancer (S5E2) across laminae. Three further viruses were tested, with a view to characterizing the expression profiles of a GABA-selective enhancer (h56d), but these results are preliminary.

      Strengths:

      The derivation of cell-type specific enhancers is key for translating the types of circuit analyses that can be performed in mice - which rely on germline modifications for access to cell-type specific manipulation - in higher-order mammals. Federer et al. further validate the utility of S5E2 as a PV-selective enhancer in NHPs.

      Additionally, the authors characterize the laminar distribution pattern of GABA+ and PV+ cells in V1. This survey may prove valuable to researchers seeking to understand and manipulate the microcircuitry mediating the excitation-inhibition balance in this region of the marmoset brain.

      Weaknesses:

      Enhancer/promoter specificity and efficiency cannot be directly compared, because they were packaged in different serotypes of AAV.

      The three different serotypes of AAV expressing reporter under the h56D promoter were only tested once each, and all in the same animal. There are many variables that can contribute to the success (or failure) of a viral injection, so observations with an n=1 cannot be considered reliable.

      Added after revision:

      The revisions satisfy my concerns. In particular, the new language to qualify the strength of evidence relating to the interpretation of the data relating to the 3 different serotypes of virus used to test h56D is appropriate.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors identified a new chloride-conducting Channelrhodopsin (MsACR1) that can be activated at low light intensities and within the red part of the visible spectrum. Additional engineering of MsACR1 yielded a variant (raACR1) with increased current amplitudes, accelerated kinetics, and a 20nm red-shifted peak excitation wavelength. Stimulation of MsACR1 and raACR1 expressing neurons with 635nm in mice's primary motor cortices inhibited the animals' locomotion.

      Strengths:

      The in vitro characterization of the newly identified ACRs is very detailed and confirms the biophysical properties as described by the authors. Notably, the ACRs are very light sensitive and allow for efficient in vitro inhibition of neurons in the nano Watt/mm^2 range. These new ACRs give neuroscientists and cell biologists a new tool to control chloride flux over biological membranes with high temporal and spatial precision. The red-shifted excitation peaks of these ACRs could allow for multiplexed application with blue-light excited optogenetic tools such as cation-conducting channelrhodopsins or green-fluorescent calcium indicators such as GCaMP.

      Weaknesses:

      (1) The in-vivo characterization of MsACR1 and raACR1 lacks critical control experiments and is, therefore, too preliminary. The experimental conditions differ fundamentally between in vitro and in vivo characterizations. For example, chloride gradients differ within neurons which can weaken inhibition or even cause excitation at synapses, as pointed out by the authors. Notably, the patch pipettes for the in vitro characterization in neurons contained low chloride concentrations that might not reflect possible conditions found in vivo preparations, i.e., increasing chloride gradients from dendrites to synapses.<br /> 2nd review: The authors have addressed this comment in their rebuttal.

      (2) Interestingly, the authors used soma-targeted (st) MsACR1 and raACR1 for some of their in vitro characterization yielding more efficient inhibition and reduction of co-incidental "on-set" spiking. Still, the authors do not seem to have utilized st-variants in vivo.<br /> 2nd review: The authors offered an explanation in their rebuttal and aim to add these experiments later.

      (3) Most importantly, critical in vivo control experiments, such as negative controls like GFP or positive controls like NpHR, are missing. These controls would exclude potential behavioral effects due to experimental artifacts. Moreover, in vivo electrophysiology could have confirmed whether targeted neurons were inhibited under optogenetic stimulations.<br /> Some of these concerns stem from the fact that the pulsed raACR stimulation at 635 nm at 10Hz (Fig. 3E) was far less efficient compared to MsACR1, yet the in vivo comparison yielded very similar results (Fig. 4D).<br /> Also, the cortex is highly heterogeneous and comprises excitatory and inhibitory neurons. Using the synapsin promoter, the viral expression paradigm could target both types and cause differential effects, which has not been investigated further, for example, by immunohistochemistry. An alternative expression system, for example, under VGLUT1 control, could have mitigated some of these concerns.<br /> 2nd review: The authors have not added control experiments in Fig 4 yet but plan to conduct them later. They added a new set of experiments in Fig.5 in which PV neurons were exclusively targeted. However, the authors show in vivo electrophysiology demonstrating the expected inhibition of firing neurons (presumably PV neurons expressing raACR) under 635 nm light and disinhibition (presumably excitatory neurons).

      (4) Furthermore, the authors applied different light intensities, wavelengths, and stimulation frequencies during the in vitro characterization, causing varying spike inhibition efficiencies. The in vivo characterization is notably lacking this type of control. Thus, it is unclear why the 635nm, 2s at 20Hz every 5s stimulation protocol, which has no equivalent in the in vitro characterization, was chosen.<br /> 2nd review: The authors offered a satisfactory explanation.

      In summary, the in vivo experiments did not confirm whether the observed inhibition of mouse locomotion occurred due to the inhibition of neurons or experimental artifacts.<br /> 2nd review: New experiments were added which demonstrate the expected inhibition of raACR expressing PV neurons in vivo.

      In addition, the author's main claim of more efficient neuronal inhibition would require to threshold MsACR1 and raACR1 against alternative methods such as the red-shifted NpHR variant Jaws or other ACRs to give readers meaningful guidance when choosing an inhibitory tool.<br /> The light sensitivity of MsACR1 and raACR1 are impressive and well characterized in vitro. However, the authors only reported the overall light output at the fiber tip for the in vivo experiments: 0.5 mW. Without context, it is difficult to evaluate this value. Calculating the light power density at certain distances from the light fiber or thresholding against alternative tools such as NpHR, Jaws, or other ACRs would allow for a more meaningful evaluation.<br /> 2nd review: The authors added Supl Fig. 8 in which light power density and propagation of photons at 550 nm and 635nm through brain tissue was calculated when emitted from light fibers of varying diameter.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The authors aim at challenging the relevance of cell populations with characteristic selectivity for specific aspects of navigation (e.g. place cells, head direction and border cells) in the processing of spatial information. Their claim is that such cells naturally emerge in any system dealing with the estimation of position in an environment, without the need for a special involvement of these cells in the computations. In particular the work shows how when provided with spatial error signals, networks designed for invariant object recognition spontaneously organize the activity in their hidden layers into a mixture of spatially selective cells, some of them passing classification criteria for place, head direction or border cells. Crucially, these cells are not necessary for position decoding, nor are they the most informative when it comes to the performance of the network in reconstructing spatial position from visual scenes. These results lead the authors to claim that focusing on the classification of specific cell types is hindering rather than helping advancement in the understanding of spatial cognition. In fact they claim that the attention should rather be pointed at understanding highly-dimensional population coding, regardless of its direct interpretability or its appeal to human observers.

      Strengths:<br /> Methodologically the paper is consistent and convincingly support the author claims regarding the role of cell types in coding for spatial aspects of cognition. It is also interesting how the authors leverage on established machine learning systems to provide a sort of counter-argument to the use of such techniques to establish a parallel between artificial and biological neural representations. In the recent past similar applications of artificial neural networks to spatial navigation have been directed at proving the importance of specific neural substrates (take for example Banino et al. 2018 for grid cells), while in this case the same procedure is used to unveil them as epiphenomena, so general and unspecific to be of very limited use in understanding the actual functioning of the neural system. I am quite confident that this stance regarding the role of place cells and co. could gather large sympathy and support in the greater part of the neuroscience community, or at least among the majority of theoretical neuroscientists with some interest in the hippocampus and higher cognition.

      Weaknesses:<br /> My criticism of the paper can be articulated in three main points:<br /> - What about grid cells? Grid cells are notably not showing up in the analyses of the paper. But they surely can be considered as the 'mother' of all tailored spatial cells of the hippocampal formation. Are they falling outside the author's assessment of the importance of this kind of cells? Some discussion of the place grid cells occupy in the vision of the authors would greatly help.<br /> - The network used in the paper is still guided by a spatial error signal, and the network is trained to minimize spatial decoding error. In a sense, although object classfication networks are not designed for spatial navigation, one could say that the authors are in some way hacking this architecture and turning it into a spatial navigation one through learning. I wonder if their case could be strengthened by devising a version of their experiment based on some form of self-supervised or unsupervised learning.<br /> - The last point is more about my perception of the community studying hippocampal functions, rather than being directed at the merits of the paper itself. My question is whether the paper is fighting an already won battle. That is whether the focus on the minute classification of response profiles of cells in the hippocampus is in fact already considered an 'old' approach, very useful for some initial qualitative assessments but of limited power when asked to provide deeper insight into the functioning of hippocampal computations (or computations of any other brain circuit).

    1. Reviewer #2 (Public Review):

      Summary:<br /> Members of a conserved family of flavin-containing monooxygenases (FMOs) are necessary and at least partly sufficient for lifespan extension induced by diet restriction and hypoxia. Of 5 FMOs in C. elegans, fmo-2 has received the majority of attention, but this study identifies that fmo-4 is also an important, positive modulator of lifespan. Based on differential requirements of fmo-2 and fmo-4 in stress resistance and lifespan extension paradigms, the authors conclude that fmo-4 acts through mechanisms that are overlapping, but distinct from fmo-2. Ultimately, the authors place fmo-2 genetically within a pathway involving atf-6, calreticulin, the IP3 receptor, and mitochondrial calcium uniporter, which was previously shown to link ER calcium homeostasis to mitochondrial homeostasis and longevity. Because the known enzymatic activity of FMOs involves oxygenating xenobiotic and endogenous metabolites, these findings highlight a potential new link between redox/metabolic homeostasis and ER-mitochondrial calcium signaling, while revealing that different FMO family members regulate stress resistance and lifespan through distinct mechanisms.

      Strengths:<br /> The authors have used genetics to discover an interesting and unanticipated new link between conserved FMOs and ER calcium pathways known to regulate lifespan.

      The genetic epistasis patterns for lifespan and stress resistance phenotypes are generally clean and compelling.

      Weaknesses:<br /> The effects of carbachol and EDTA on intracellular calcium levels are inferred, especially in the tissues where fmo-4 is acting. Validating that these agents and fmo-4 itself have an impact on calcium in relevant subcellular compartments is important to support conclusions on how fmo-4 regulates and responds to calcium.

      Experiments are generally reliant on RNAi. While in most cases experiments reveal positive results, indicating RNAi efficacy, key conclusions could be strengthened with the incorporation of mutants.

      While FMO-4 is clearly placed in the ER calcium pathway genetically, a putative molecular mechanism by which FMO-4 would alter ER calcium remains unclear. Notably, Tuckowski et al. highlight this gap in the discussion as well.

    1. Reviewer #2 (Public Review):

      (1) Summary<br /> Kleinman and Foster's study investigates the role of dopamine signaling in the ventral tegmental area (VTA) on hippocampal replay and sharp-wave ripples (SWR) in rats exposed to changes in reward magnitude and environmental novelty. The authors utilize chemogenetic silencing techniques to modulate dopamine neuron activity in the VTA while conducting simultaneous electrophysiological recordings from the hippocampal CA1 region. Their findings suggest that VTA dopamine signaling is critical for modulating hippocampal replay in response to changes in reward context and novelty, with specific disruptions observed in replay dynamics when VTA is inhibited, particularly in novel environments.

      (2) Strengths<br /> The research addresses a significant gap in our understanding of the neurobiological underpinnings of memory and spatial learning, highlighting the importance of dopamine-mediated processes. The methodological approach is robust, combining chemogenetic silencing with precise electrophysiological measurements, which allows for a detailed examination of the neural circuits involved. The study provides important insights into how hippocampal replay and SWR are influenced by reward prediction errors, as well as the role of dopamine in these processes. Specifically, the authors note that VTA silencing unexpectedly did not prevent increases in ripple activities where reward was increased, but induced significant aberrant increases in environments where reward levels were unchanged, highlighting a novel dependency of hippocampal replay on dopamine and a VTA-independent reward prediction error signal in familiar environments. These findings are critical for understanding the consolidation of episodic memory and the neural basis of learning.

      (3) Weaknesses<br /> Despite the strengths in methodology and conceptual framework, the study has several weaknesses that could affect the interpretation of the results. There is a need for more rigorous histological validation to confirm the extent and specificity of viral expression and electrode placements, which is crucial for ensuring the accuracy of the findings. Variability in the dosing and timing of chemogenetic interventions could also lead to inconsistencies in the data, suggesting a need for more standardized experimental protocols.

    1. Reviewer #2 (Public Review):

      Summary:

      In this work, Degutis and colleagues addressed an interesting issue related to the concurrent coding of sensory percepts and visual working memory contents in visual cortices. They used generalization analyses to test whether working memory representations change over time, diverge from sensory percepts, and vary across distraction conditions. Temporal generalization analysis demonstrated that off-diagonal decoding accuracies were lower than on-diagonal decoding accuracies, regardless of the presence of intervening distractions, implying that working memory representations can change over time. They further showed that the coding space for working memory contents showed subtle but statistically significant changes over time, potentially explaining the impaired off-diagonal decoding performance. The neural coding of sensory distractions instead remained largely stable. Generalization analyses between target and distractor codes showed overlaps but were not identical. Cross-condition decodings had lower accuracies compared to within-condition decodings. Finally, within-condition decoding revealed more reliable working memory representations in the condition with intervening random noises compared to cross-condition decoding using a trained classifier on data from the no-distraction condition, indicating a change in the VWM format between the noise distractor and no-distractor trials.

      Strengths:

      This paper demonstrates a clever use of generalization analysis to show changes in the neural codes of working memory contents across time and distraction conditions. It provides some insights into the differences between representations of working memory and sensory percepts, and how they can potentially coexist in overlapping brain regions.

      Weaknesses:

      (1) An alternative interpretation of the temporal dynamic pattern is that working memory representations become less reliable over time. As shown by the authors in Figure 1c and Figure 4a, the on-diagonal decoding accuracy generally decreased over time. This implies that the signal-to-noise ratio was decreasing over time. Classifiers trained with data of relatively higher SNR and lower SNR may rely on different features, leading to poor generalization performance. This issue should be addressed in the paper.

      (2) The paper tests against a strong version of stable coding, where neural spaces representing WM contents must remain identical over time. In this version, any changes in the neural space will be evidence of dynamic coding. As the paper acknowledges, there is already ample evidence arguing against this possibility. However, the evidence provided here (dynamic coding cluster, angle between coding spaces) is not as strong as what prior studies have shown for meaningful transformations in neural coding. For instance, the principal angle between coding spaces over time was smaller than 8 degrees, and around 7 degrees between sensory distractors and WM contents. This suggests that the coding space for WM was largely overlapping across time and with that for sensory distractors. Therefore, the major conclusion that working memory contents are dynamically coded is not well-supported by the presented results.

      (3) Relatedly, the main conclusions, such as "VWM code in several visual regions did not generalize well between different time points" and "VWM and feature-matching sensory distractors are encoded in separable coding spaces" are somewhat subjective given that cross-condition generalization analyses consistently showed above chance-level performance. These results could be interpreted as evidence of stable coding. The authors should use more objective descriptions, such as 'temporal generalization decoding showed reduced decoding accuracy in off-diagonals compared to on-diagonals.

    1. Reviewer #2 (Public Review):

      This study provides an in-depth exploration of the impact of X-linked ZDHHC9 gene mutations on cognitive deficits and epilepsy, with a particular focus on the expression and function of ZDHHC9 in myelin-forming oligodendrocytes (OLs). These findings offer crucial insights into understanding ZDHHC9-related X-linked intellectual disability (XLID) and shed light on the regulatory mechanisms of palmitoylation in myelination. The experimental design and analysis of results are convincing, providing a valuable reference for further research in this field. However, upon careful review, I believe the article still needs further improvement and supplementation in the following aspects:

      (1) Regarding the subcellular localization experiment of ZDHHC9 mutants in OL, it is currently limited to in vitro cultured OL, lacking validation in vivo OL or myelin sheath. Additionally, it is necessary to investigate whether the abnormal subcellular localization of ZDHHC9 mutants affects their enzyme activity and palmitoylation modification of substrate proteins.

      (2) The experimental period (P21+21 days) using genetic labeling to track the development of myelinating cells may not be long enough. It is recommended to extend the observation time and analyze at more time points to more comprehensively reflect the impact of Zdhhc9 KO.

      (3) The author speculates that Zdhhc9 may regulate myelination by affecting the membrane localization of specific myelin proteins, but lacks direct experimental evidence to support this. It is suggested to detect the expression and distribution of relevant proteins in the myelin of Zdhhc9 KO mice.

      (4) Although the article mentions the association of Zdhhc9 with intellectual disabilities, it does not involve behavioral analysis of Zdhhc9 KO mice. It is recommended to supplement some behavioral experimental data to support the important role of Zdhhc9 in maintaining normal cognitive function, enhancing the clinical relevance of the article.

      (5) For the abnormal myelination observed in Zdhhc9 KO mice, including unmyelinated large-diameter axons and excessively myelinated small-diameter axons, the article lacks in-depth research and explanation on the exact mechanism and mode of action of ZDHHC9 in regulating myelination.

      (6) The function of ZDHHC9 in OL may be related to the Golgi apparatus, but its exact role in these structures is still unclear. It is suggested to discuss in more detail the role of ZDHHC9 in the Golgi apparatus in the discussion section.

      (7) More experimental support and in-depth research are needed on the detailed mechanism of how ZDHHC9 and Golga7 cooperatively regulate MBP palmitoylation, and how this decrease in palmitoylation level leads to myelination defects.

      In summary, it is recommended that the authors address the above issues through additional experiments and improved discussions to further strengthen the credibility and clinical relevance of the article.

    1. Reviewer #2 (Public Review):

      Summary:

      The current work investigates the neural signature of category representation in infancy. Neural responses during steady-state visually-evoked potentials (ssVEPs) were recorded in four age groups of infants between 3 and 15 months. Stimuli (i.e., faces, limbs, corridors, characters, and cars) were presented at 4.286 Hz with category changes occurring at a frequency of 0.857 Hz. The results of the category frequency analyses showed that reliable responses to faces emerge around 4-6 months, whereas responses to libs, corridors, and characters emerge at around 6-8 months. Additionally, the authors trained a classifier for each category to assess how consistent the responses were across participants (leave-one-out approach). Spatiotemporal responses to faces were more consistent than the responses to the remaining categories and increased with increasing age. Faces showed an advantage over other categories in two additional measures (i.e., representation similarity and distinctiveness). Together, these results suggest a different developmental timing of category representation.

      Strengths:

      The study design is well organized. The authors described and performed analyses on several measures of neural categorization, including innovative approaches to assess the organization of neural responses. Results are in support of one of the two main hypotheses on the development of category representation described in the introduction. Specifically, the results suggest a different timing in the formation of category representations, with earlier and more robust responses emerging for faces over the remaining categories. Graphic representations and figures are very useful when reading the results.

      Weaknesses:

      The role of the adult dataset in the goal of the current work is unclear. All results are reported in the supplementary materials and minimally discussed in the main text. The unique contribution of the results of the adult samples is unclear and may be superfluous.

      It would be useful to report the electrodes included in the analyses and how they have been selected.

    1. Reviewer #2 (Public Review):

      Summary:

      This study aimed to test experimentally a theoretical framework that aims to explain the perception of tinnitus, i.e., the perception of a phantom sound in the absence of external stimuli, through differences in auditory predictive coding patterns. To this aim, the researchers compared the neural activity preceding and following the perception of a sound using MEG in two different studies. The sounds could be highly predictable or random, depending on the experimental condition. They revealed that individuals with tinnitus and controls had different anticipatory predictions. This finding is a major step in characterizing the top-down mechanisms underlying sound perception in individuals with tinnitus.

      Strengths:

      This article uses an elegant, well-constructed paradigm to assess the neural dynamics underlying auditory prediction. The findings presented in the first experiment were partially replicated in the second experiment, which included 80 participants. This large number of participants for an MEG study ensures very good statistical power and a strong level of evidence. The authors used advanced analysis techniques - Multivariate Pattern Analysis (MVPA) and classifier weights projection - to determine the neural patterns underlying the anticipation and perception of a sound for individuals with or without tinnitus. The authors evidenced different auditory prediction patterns associated with tinnitus. Overall, the conclusions of this paper are well supported, and the limitations of the study are clearly addressed and discussed.

      Weaknesses:

      Even though the authors took care of matching the participants in age and sex, the control could be more precise. Tinnitus is associated with various comorbidities, such as hearing loss, anxiety, depression, or sleep disorders. The authors assessed individuals' hearing thresholds with a pure tone audiogram, but they did not take into account the high frequencies (6 kHz to 16 kHz) in the patient/control matching. Moreover, other hearing dysfunctions, such as speech-in-noise deficits or hyperacusis, could have been taken into account to reinforce their claim that the observed predictive pattern was not linked to hearing deficits. Mental health and sleep disorders could also have been considered more precisely, as they were accounted for only indirectly with the score of the 10-item mini-TQ questionnaire evaluating tinnitus distress. Lastly, testing the links between the individuals' scores in auditory prediction and tinnitus characteristics, such as pitch, loudness, duration, and occurrence (how often it is perceived during the day), would have been highly informative.

    1. Reviewer #2 (Public Review):

      Summary:

      Here the authors show a novel direct neuronal reprogramming model using a very pure culture system of oligodendrocyte progenitor cells and demonstrate hallmarks of corticospinal neurons to be induced when using Neurogenin2, a dominant-negative form of Olig2 in combination with the CSN master regulator Fezf2.

      Strengths:

      This is a major achievement as the specification of reprogrammed neurons towards adequate neuronal subtypes is crucial for repair and still largely missing. The work is carefully done and the comparison of the neurons induced only by Neurogenin 2 versus the NVOF cocktail is very interesting and convincingly demonstrates a further subtype specification by the cocktail.

      Weaknesses:

      As carefully as it is done in vitro, the identity of projection neurons can best be assessed in vivo. If this is not possible, it could be interesting to co-culture different brain regions and see if these neurons reprogrammed with the cocktail, indeed preferentially send out axons to innervate a co-cultured spinal cord versus other brain region tissue.

    1. Reviewer #2 (Public Review):

      Summary:

      Zhang and colleagues use a combination of behavioral, neural, and computational analyses to test an active inference model of exploration in a novel reinforcement learning task.

      Strengths:

      The paper addresses an important question (validation of active inference models of exploration). The combination of behavior, neuroimaging, and modeling is potentially powerful for answering this question.

      I appreciate the addition of details about model fitting, comparison, and recovery, as well as the change in some of the methods.

      Weaknesses:

      The authors do not cite what is probably the most relevant contextual bandit study, by Collins & Frank (2018, PNAS), which uses EEG.

      The authors cite Collins & Molinaro as a form of contextual bandit, but that's not the case (what they call "context" is just the choice set). They should look at the earlier work from Collins, starting with Collins & Frank (2012, EJN).

      Placing statistical information in a GitHub repository is not appropriate. This needs to be in the main text of the paper. I don't understand why the authors refer to space limitations; there are none for eLife, as far as I'm aware.

      In answer to my question about multiple comparisons, the authors have added the following: "Note that we did not attempt to correct for multiple comparisons; largely, because the correlations observed were sustained over considerable time periods, which would be almost impossible under the null hypothesis of no correlations." I'm sorry, but this does not make sense. Either the authors are doing multiple comparisons, in which case multiple comparison correction is relevant, or they are doing a single test on the extended timeseries, in which case they need to report that. There exist tools for this kind of analysis (e.g., Gershman et al., 2014, NeuroImage). I'm not suggesting that the authors should necessarily do this, only that their statistical approach should be coherent. As a reference point, the authors might look at the aforementioned Collins & Frank (2018) study.

      I asked the authors to show more descriptive comparison between the model and the data. Their response was that this is not possible, which I find odd given that they are able to use the model to define a probability distribution on choices. All I'm asking about here is to show predictive checks which build confidence in the model fit. The additional simulations do not address this. The authors refer to figures 3 and 4, but these do not show any direct comparison between human data and the model beyond model comparison metrics.

    1. Reviewer #2 (Public Review):

      Summary:

      In this interesting and original study, Feng and colleagues set out to address the effect of manipulating endothelin signaling on nerve regeneration, focusing on the crosstalk between endothelial cells (ECs) in dorsal root ganglia (DRG), which secrete ET-1 and satellite glial cells (SGCs) expressing ETBR receptor. The main finding is that ETBR signaling is a default brake on axon growth, and inhibiting this pathway promotes axon regeneration after nerve injury and counters the decline in regenerative capacity that occurs during aging. ET-1 and ETBR are mapped in ECs and SGCs, respectively, using scRNA-seq of DRGs from adult or aged mice. Although their expression does not change upon injury, it is modulated during aging, with a reported increase in plasma levels of ET-1 (a potent vasoconstrictive signal). Using in vitro explant assays coupled with pharmacological inhibition in mouse models of nerve injury, the authors demonstrate that ET-1/ETBR curbs axonal growth, and the ETAR/ETBR antagonist Bosentan boosts regrowth during the early phase of repair. In addition, Bosentan restores the ability of aged DRG neurons to regrow after nerve lesions. Despite Bosentan inhibiting both endothelin receptors A and B, comparison with an ETAR-specific antagonist indicates that the effects can be attributed to the ET-1/ETBR pathway. In the DRGs, ETBR is mostly expressed by SGCs (and a subset of Schwann cells) a cell type that previous studies, including work from this group, have implicated in nerve regeneration. SGCs ensheath and couple with DRG neurons through gap junctions formed by Cx43. Based on their own findings and evidence from the literature, the pro-regenerative effects of ETBR inhibition are in part attributed to an increase in Cx43 levels, which are expected to enhance neuron-SGC coupling. Finally, gene expression analysis in adult vs aged DRGs predicts a decrease in fatty acid and cholesterol metabolism, for which previous work by the authors has shown a requirement in SGCs to promote axon regeneration.

      Strengths:

      The study is well-executed and the main conclusion that "ETBR signaling inhibits axon regeneration after nerve injury and plays a role in age-related decline in regenerative capacity" (line 77) is supported by the data. Given that Bosentan is an FDA-approved drug, the findings may have therapeutic value in clinical settings where peripheral nerve regeneration is suboptimal or largely impaired, as it often happens in aged individuals. In addition, the study highlights the importance of vascular signals in nerve regeneration, a topic that has gained traction in recent years. Importantly, these results further emphasize the contribution of long-neglected SGCs to nerve tissue homeostasis and repair. Although the study does not reach a complete mechanistic understanding, the results are robust and are expected to attract the interest of a broader readership.

      Weaknesses:

      Despite these positive comments provided above, the following points should be considered:

      (1) This study examines the contribution of the ET-1 pathway in the ganglia, and in vitro assays are consistent with the idea that important signaling events take place there. Nevertheless, it remains to be determined whether the accelerated axon regrowth observed in vivo depends also on cellular crosstalk mediated by ET-1 at the lesion site. Are ECs along the nerve secreting ET-1? What cells are present in the nerve stroma that could respond and participate in the repair process? Would these interactions be sensitive to Bosentan? It may be difficult to dissect this contribution, but it should at least be discussed.

      (2) It is suggested that the permeability of DRG vessels may facilitate the release of "vascular-derived signals" (lines 82-84). Is it possible that the ET-1/ETBR pathway modulates vascular permeability, and that this, in turn, contributes to the observed effects on regeneration?

      (3) Is the affinity of ET-3 for ETBR similar to that of ET-1? Can it be excluded that ET-3 expressed by fibroblasts is relevant for controlling SGC responses upon injury/aging?

      (4) ETBR inhibition in dissociated (mixed) cultures uncovers the restraining activity of endothelin signaling on axon growth (Figure 2C). Since neurons do not express ET-1 receptors, based on scRNA-seq analysis, these results are interpreted as an indication that basal ETBR signaling in SGC curbs the axon growth potential of sensory neurons. For this to occur in dissociated cultures, however, one should assume that SGC-neuron association is present, similar to in vivo, or to whole DRG cultures (Figure 2C). Has this been tested? In both in vitro experimental settings (dissociated and whole DRG cultures) how is ETBR stimulated over up to 7 days of culture? In other words, where does endothelin come from in these cultures (which are unlikely to support EC/blood vessel growth)? Is it possible that the relevant ligand here derives from fibroblasts (see point #6)? Or does it suggest that ETBR can be constitutively active (i.e., endothelin-independent signaling)? Is there any chance that endothelin is present in the culture media or Matrigel?

      (5) The discovery that ET-1/ETBR signaling in SGC curtails the growth capacity of axons at baseline raises questions about the physiological role of this pathway. What happens when ETBR signaling is prevented over a longer period of time? This could be addressed with pharmacological inhibitors, or better, with cell-specific knock-out mice. The experiments would certainly be of general interest, although not within the scope of this story. Nevertheless, it could be worth discussing the possibilities.

      (6) Assessing Cx43 levels by measuring the immunofluorescence signal (Figure 5E-F) is acceptable, particularly when the aim is to restrict the analysis to SGCs. The modulation of Cx43 expression by ET-1/ETBR plays an important part in the proposed model. Therefore, a complementary analysis of Cx43 expression by quantitative RT-PCR on sorted SGCs would be a valuable addition to the immunofluorescence data. Is this attainable?

      (7) The conclusions "We thus hypothesize that ETBR inhibition in SGCs contributes to axonal regeneration by increasing Cx43 levels, gap junction coupling or hemichannels and facilitating SGC-neuron communication" (lines 303-305) are consistent with the findings but seem in contrast with the effect of aging on gap junction coupling reported by others and cited in line 210: "the number of gap junctions and the dye coupling between these cells increases (Huang et al., 2006)". I am confused by what distinguishes a potential, and supposedly beneficial, increase in coupling after ETBR inhibition, from what is observed in aging.

      (8) I find it difficult to reconcile the results in Figure 5F with the proposed model since (1) injury increases Cx43 levels in both adult and aged mice, (2) the injured aged/vehicle group has a similar level to the uninjured adult group, (3) upon injury, aged+Bosentan is much lower than adult+Bosentan (significance not tested). It seems hard to explain the effect of Bosentan only through the modulation of Cx43 levels. Whether the increase in Cx43 levels following ETBR inhibition actually results in higher SGC-neuron coupling has not been assessed experimentally.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors demonstrate heightened susceptibility of Terc-KO mice to S. aureus-induced pneumonia, perform gene expression analysis from the infected lungs, find an elevated inflammatory (NLRP3) signature in some Terc-KO but not control mice, and some reduction in T cell signatures. Based on that, They conclude that disregulated inflammation and T-cell dysfunction play a major role in these phenomena.

      Strengths:

      The strengths of the work include a problem not previously addressed (the role of the Terc component of the telomerase complex) in certain aspects of resistance to bacterial infection and innate (and maybe adaptive) immune function.

      Weaknesses:

      The weaknesses outweigh the strengths, dominantly because conclusions are plagued by flaws in experimental design, by lack of rigorous controls, and by incomplete and inadequate approaches to testing immune function. These weaknesses are as follows

      (1) Terc-KO mice are a genomic knockout model, and therefore the authors need to carefully consider the impact of this KO on a wide range of tissues. This, however, is not the case. There are no attempts to perform cell transfers or use irradiation chimera or crosses that would be informative.

      (2) Throughout the manuscript the authors invoke the role of telomere shortening in aging, and according to them, their Terc-KO mice should be one potential model for aging. Yet the authors consistently describe major differences between young Terc-KO and naturally aging old mice, with no discussion of the implications. This further confuses the biological significance of this work as presented.

      (3) Related to #2, group design for comparisons lacks a clear rationale. The authors stipulate that Terc-KO will mimic natural aging, but in fact, the only significant differences seen between groups in susceptibility to S. aureus are, contrary to the authors' expectation, between young Terc-KO and naturally old mice (Figures 1A and B, no difference between young Terc-KO and young wt); or there are no significant differences at all between groups (Figures 1, C, D,).<br /> Another example of inadequate group design is when the authors begin dividing their Terc-KO groups by clinical score into animals with or without "systemic infection" (the condition where a bacterium spreads uncontrollably across the many organs and via blood, which should be properly called sepsis), and then compare this sepsis group to other groups (Supplementary Figures 1G; Figure 2; lines 374-376 and 389-391). This gives them significant differences in several figures, but because they did not clearly indicate where they applied this stratification in the figure legends, the data are somewhat confusing. Most importantly, methodologically it is highly inappropriate to compare one mouse with sepsis to another one without. If Terc-KO mice with sepsis are a comparator group, then their controls have to be wild-type mice with sepsis, who are dealing with the same high bacterial load across the body and are presumably forced to deploy the same set of immune defenses.

      (4) The authors conclude that disregulated inflammation and T-cell dysfunction play a major role in S. aureus susceptibility. This may or may not be an important observation, because many KO mice are abnormal for a variety of reasons, and until such reasons are mechanistically dissected, the physiological importance of the observation will remain unclear. Two points are important here. First, there is no natural counterpart to a Terc-KO, which is a complete loss of a key non-enzymatic component of the telomerase complex starting in utero. Second, the authors truly did not examine the key basic features of their model, including the features of basic and induced inflammatory and immune responses. This analysis could be done either using model antigens in adjuvants, defined innate immune stimuli (e.g. TLR, RLR, or NLR agonists), or microbial challenge. The only data provided along these lines are the baseline frequencies of total T cells in the spleen of the three groups of mice examined (not statistically significant, Figure 4B). We do not know if the composition of naïve to memory T cell subsets may have been different, and more importantly, we have no data to evaluate whether recruitment of the immune response (including T cells) to the lung upon microbial challenge is similar or different. So, what are the numbers and percentages of T cells and alveolar macrophages in the lung following S. aureus challenge and are they even comparable or are there issues in mobilizing the T cell response to the site of infection? If, for example, Terc-KO mice do not mobilize enough T cells to the lung during infection, that would explain the paucity in many T-cell-associated genes in their transcriptomic set that the authors report. That in turn may not mean dysfunction of T cells but potentially a whole different set of defects in coordinating the response in Terc-KO mice.

      (5) Related to that, immunological analysis is also inadequate. First, the authors pull signatures from the total lung tissue, which is both imprecise and potentially skewed by differences, not in gene expression but in types of cells present and/or their abundance, a feature known to be affected by aging and perhaps by Terc deficiency during infection. Second, to draw any conclusions about immune responses, the authors would have to track antigen-specific T cells, which is possible for a wide range of microbial pathogens using peptide-MHC multimers. This would allow highly precise analysis of phenomena the authors are trying to conclude about. Moreover, it would allow them to confirm their gene expression data in populations of physiological interest

      Third, the authors co-incubate AM and T cells with S. aureus. There is no information here about the phenotype of T cells used. Were they naïve, and how many S. aureus-specific T cells did they contain? Or were they a mix of different cell types, which we know will change with aging (fewer naïve and many more memory cells of different flavors), and maybe even with a Terc-KO? Naïve T cells do not interact with AM; only effector and memory cells would be able to do so, once they have been primed by contact with dendritic cells bringing antigen into the lymphoid tissues, so it is unclear what the authors are modeling here. Mature primed effector T cells would go to the lung and would interact with AM, but it is almost certain that the authors did not generate these cells for their experiment (or at least nothing like that was described in the methods or the text).

      (6) Overall, the authors began to address the role of Terc in bacterial susceptibility, but to what extent that specifically involves inflammation and macrophages, T cell immunity, or aging remains unclear at present.

    1. Reviewer #2 (Public Review):

      Chambers et al. (2024) present a systematic and unbiased approach to explore the evolutionary potential of the human antiviral protein kinase R (PKR) to evade inhibition by a poxviral antagonist while maintaining one of its essential functions.

      The authors generated a library of 426 single-nucleotide polymorphism (SNP)-accessible non-synonymous variants of PKR kinase domain and used a yeast-based heterologous virus-host system to assess PKR variants' ability to escape antagonism by the vaccinia virus pseudo-substrate inhibitor K3. The study identified determinant sites in the PKR kinase domain that harbor K3-resistant variants, as well as sites where variation leads to PKR loss of function. The authors found that multiple K3-resistant variants are readily available throughout the domain interface and are enriched at sites under positive selection. They further found some evidence of PKR resilience to viral antagonist diversification. These findings highlight the remarkable adaptability of PKR in response to viral antagonism by mimicry.

      Significance of the findings:

      The findings are important with implications for various fields, including evolutionary biology, virus-host interfaces, genetic conflicts, and antiviral immunity.

      Strength of the evidence:

      Convincing methodology using state-of-the-art mutational scanning approach in an elegant and simple setup to address important challenges in virus-host molecular conflicts and protein adaptations.

      Strengths:

      ● Systematic and Unbiased Approach:<br /> The study's comprehensive approach to generating and characterizing a large library of PKR variants provides valuable insights into the evolutionary landscape of the PKR kinase domain. By focusing on SNP-accessible variants, the authors ensure the relevance of their findings to naturally occurring mutations.

      ● Identification of Key Sites:<br /> The identification of specific sites in the PKR kinase domain that confer resistance or susceptibility to a poxvirus pseudosubstrate inhibition is a significant contribution.

      ● Evolutionary Implications:<br /> The authors performed meticulous comparative analyses throughout the study between the functional variants from their mutagenesis screen ("prospective") and the evolutionarily-relevant past adaptations ("retrospective").

      ● Experimental Design:<br /> The use of a yeast-based assay to simultaneously assess PKR capacity to induce cell growth arrest and susceptibility/resistance to various VACV K3 alleles is an efficient approach. The combination of this assay with high-throughput sequencing allows for the rapid characterization of a large number of PKR variants.

      Areas for Improvement:

      ● Validation of the screen:<br /> The results would be strengthened by validating results from the screen on a handful of candidate PKR variants, either using a similar yeast heterologous assay, or - even more powerfully - in another experimental system assaying for similar function (cell translation arrest) or protein-protein interaction.

      ● Evolutionary Data:<br /> Beyond residues under positive selection, the screen would allow the authors to also perform a comparative analysis with PKR residues under purifying selection. Because they are assessing one of the most conserved ancestral functions of PKR (i.e. cell translation arrest), it may also be of interest to discuss these highly conserved sites.

      ● Mechanistic Insights:<br /> While the study identifies key sites and residues involved in vaccinia K3 resistance, it could benefit from further investigation into the underlying molecular mechanisms. The study's reliance on a single experimental approach, deep mutational scanning, may introduce biases and limit the scope of the findings. The authors may acknowledge these limitations in the Discussion.

      ● Viral Diversity:<br /> The study focuses on the viral inhibitor K3 from vaccinia. Expanding the analysis to include other viral inhibitors, or exploring the effects of PKR variants on a range of viruses would strengthen and expand the study's conclusions. Would the identified VACV K3-resistant variants also be effective against other viral inhibitors (from pox or other viruses)? or in the context of infection with different viruses? Without such evidence, the authors may check the manuscript is specific about the conclusions.

      Overall Assessment:

      The systematic approach, identification of key sites, and evolutionary implications are all notable strengths. While there is room for further investigation into the mechanistic details and broader viral diversity, the findings are robust and already provide important advancements. The manuscript is well-written and clear, and the figures are informative. Specific minor comments are further shared below.

      Minor revisions addressing the areas for improvement mentioned above are recommended.

    1. Reviewer #2 (Public Review):

      Wang et al. investigated the role of dynein axonemal heavy chain 3 (DNAH3) in male infertility. They found that variants of DNAH3 were present in four infertile men, and the deficiency of DNAH3 in sperm affects sperm mobility. Additionally, they showed that Dnah3 knockout male mice are infertile. Furthermore, they demonstrated that DNAH3 influences inner dynein arms by regulating several DNAH proteins. Importantly, they showed that intracytoplasmic sperm injection (ICSI) can rescue the infertility in Dnah3 knockout mice and two patients with DNAH3 variants.

      Strengths:

      The conclusions of this paper are well-supported by data.

      Weaknesses:

      The sample/patient size is small; however, the findings are consistent with those of a recent study on DNAH3 in male infertility involving 432 patients.

    1. Reviewer #2 (Public Review):

      Summary:

      The study combines computational modeling of choice behavior with an economic, effort-based decision-making task to assess how willingness to exert physical effort for a reward varies as a function of individual differences in apathy and anhedonia, or depression, as well as chronotype. They find an overall reduction in effort selection that scales with apathy, anhedonia and depression. They also find that later chronotypes are less likely to choose effort than earlier chronotypes and, interestingly, an interaction whereby later chronotypes are especially unwilling to exert effort in the morning versus the evening.

      Strengths:

      This study uses state-of-the-art tools for model fitting and validation and regression methods which rule out multicollinearity among symptom measures and Bayesian methods which estimate effects and uncertainty about those estimates. The replication of results across two different kinds of samples is another strength. Finally, the study provides new information about the effects not only of chronotype but also chronotype by timepoint interactions which are previously unknown in the subfield of effort-based decision-making.

      Weaknesses:

      The study has few weaknesses. The biggest drawback is that it does not provide evidence for the idea that a match between chronotype and delay matters is especially relevant for people with depression or continuous measures like anhedonia and apathy. It is unclear whether disorders further interact with chronotype and time of day to determine a bias against effort. On the other hand, the study does provide evidence that future studies should consider such interactions when examining questions about effort expenditure in psychiatric disorders.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors describe a form of synaptic plasticity at synapses from granule cells onto Purkinje cells in the mouse cerebellum, which is specific to synapses from granule cells close to the cell body but not to distal ones. This plasticity is induced by the paired or associative stimulation of the two types of synapses because it is not observed with stimulation of one type of synapse alone. In addition, this form of plasticity is dependent on the order in which the stimuli are presented and is dependent on NMDA receptors, metabotropic glutamate receptors and to some degree on GABAA receptors.

      Strengths:

      The focus of the authors on the properties of two different synapse-types on cerebellar Purkinje cells is interesting and relevant, given previous results that ascending and parallel fiber synapses might be functionally different and undergo different forms of plasticity (although it hasn't been proven here that the two types of synapses are indeed ascending vs parallel fiber synapses). Nevertheless, the interaction between proximal vs. distal stimulation driven synapse types during plasticity is important for understanding cerebellar function. The demonstration of timing and order-dependent potentiation of only one pathway, and not another, after associative stimulation of both pathways, changes our understanding of potential plasticity mechanisms. In addition, this observation opens up many new questions on underlying intracellular mechanisms as well as on its relevance for cerebellar learning.

      Weaknesses:

      A concern with this study is that all recordings demonstrate "rundown", a progressive decrease in the amplitude of the EPSC, starting during the baseline period and continuing after the plasticity-induction stimulus. The issues that are causing rundown are not known and may or may not be related to the cellular processes involved in synaptic plasticity. This concern applies in particular to all the experiments where there is a decrease in synaptic strength. However, a key finding of this paper is the associative potentiation of one pathway, which is clearly different from all conditions where there is a decrease in synaptic strength and raises confidence in the authors' conclusions.

      In addition, there is some inconsistency with previous results; specifically, that no PF-LTP was induced by PF-alone repeated stimulation.

      It remains for future work to identify what these two synapse types, distinguished by the stimulation location, actually are, and where they are on the Purkinje cell dendritic tree. What this specific timing rule is important for is also something that remains to be discovered. Its potential relevance for plasticity and learning will depend on what information these AA vs PF synapses carry, and why their association is meaningful for the circuit and for a behavior. Overall, this study opens up many new questions for the field.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors used 2-photon Ca2+-imaging to study the activity of ventral tegmental area (VTA) and locus coeruleus (LC) axons in the CA1 region of the dorsal hippocampus in head-fixed male mice moving on linear paths in virtual reality (VR) environments.

      The main findings were as follows:<br /> - In a familiar environment, activity of both VTA axons and LC axons increased with the mice's running speed on the Styrofoam wheel, with which they could move along a linear track through a VR environment.<br /> - VTA, but not LC, axons showed marked reward position-related activity, showing a ramping-up of activity when mice approached a learned reward position.<br /> - In contrast, activity of LC axons ramped up before initiation of movement on the Styrofoam wheel.<br /> - In addition, exposure to a novel VR environment increased LC axon activity, but not VTA axon activity.

      Overall, the study shows that the activity of catecholaminergic axons from VTA and LC to dorsal hippocampal CA1 can partly reflect distinct environmental, behavioral and cognitive factors. Whereas both VTA and LC activity reflected running speed, VTA, but not LC axon activity reflected approach of a learned reward and LC, but not VTA, axon activity reflected initiation of running and novelty of the VR environment.

      I have no specific expertise with respect to 2-photon imaging, so cannot evaluate the validity of the specific methods used to collect and analyse 2-photon calcium imaging data of axonal activity.

      Strengths:

      (1) Using a state-of-the-art approach to record separately the activity of VTA and LC axons with high temporal resolution in awake mice moving through virtual environments, the authors provide convincing evidence that activity of VTA and LC axons projecting to dorsal CA1 reflect partly distinct environmental, behavioral and cognitive factors.

      (2) The study will help a) to interpret previous findings on how hippocampal dopamine and norepinephrine or selective manipulations of hippocampal LC or VTA inputs modulate behavior and b) to generate specific hypotheses on the impact of selective manipulations of hippocampal LC or VTA inputs on behavior.

      Comments on revised version:

      I thank the authors for including a sample size justification.

      The justification is based on previous studies using similar sample sizes to characterize behavioral correlates of LC and VTA activity and on practical reasons. I note that to improve reproducibility, it would be preferable to have predefined target sample sizes based on predefined plans for statistical analysis.

    1. Reviewer #3 (Public Review):

      Summary:

      Well-illustrated new material is documented for Acanthomeridion, a formerly incompletely known Cambrian arthropod. The formerly known facial sutures are proposed be associated with ventral plates that the authors homologise with the free cheeks of trilobites (although also testing alternative homologies). An update of a published phylogenetic dataset permits reconsideration of whether dorsal ecdysial sutures have a single or multiple origins in trilobites and their relatives.

      Strengths:

      Documentation of an ontogenetic series makes a sound case that the proposed diagnostic characters of a second species of Acanthomeridion are variation within a single species. New microtomographic data shed light on appendage morphology that was not formerly known. The new data on ventral plates and their association with the ecdysial sutures are valuable in underpinning homologies with trilobites.

      I think the revision does a satisfactory job of reconciling the data and analyses with the conclusions drawn from them. Referee 1's valid concerns about whether a synonymy of Acanthomeridion anacanthus is justified have been addressed by the addition of a length/width scatterplot in Figure 6. Referee 2's doubts about homology between the librigenae of trilobites and ventral plates of Acanthomeridion have been taken on board by re-running the phylogenetic analyses with a coding for possible homology between the ventral plates and the doublure of olenelloid trilobites. The authors sensibly added more trilobite terminals to the matrix (including Olenellus) and did analyses with and without constraints for olenelloids being a grade at the base of Trilobita. My concerns about counting how many times dorsal sutures evolved on a consensus tree have been addressed (the authors now play it safe and say "multiple" rather than attempting to count them on a bushy topology). The treespace visualisation (Figure 9) is a really good addition to the revised paper.

      Weaknesses:

      The question of how many times dorsal ecdysial sutures evolved in Artiopoda was addressed by Hou et al (2017), who first documented the facial sutures of Acanthomeridion and optimised them onto a phylogeny to infer multiple origins, as well as in a paper led by the lead author in Cladistics in 2019. Du et al. (2019) presented a phylogeny based on an earlier version of the current dataset wherein they discussed how many times sutures evolved or were lost based on their presence in Zhiwenia/Protosutura, Acanthomeridion and Trilobita. The answer here is slightly different (because some topologies unite Acanthomeridion and trilobites). This paper is not a game-changer because these questions have been asked several times over the past seven years, but there are solid, worthy advances made here.

      I'd like to see some of the most significant figures from the Supplementary Information included in the main paper so they will be maximally accessed. The "stick-like" exopods are not best illustrated in the main paper; their best imagery is in Figure S1. Why not move that figure (or at least its non-redundant panels) as well as the reconstruction (Figure S7) to the main paper? The latter summarises the authors' interpretation that a large axe-shaped hypostome appears to be contiguous with ventral plates. The specimens depict evidence for three pairs of post-antennal cephalic appendages but it's a bit hard to picture how they functioned if there's no room between the hypostome and ventral plates. Also, a comment is required on the reconstruction involving all cephalic appendages originating against/under the hypostome rather the first pair being paroral near the posterior end of the hypostome and the rest being post-hypostomal as in trilobites.

    1. Reviewer #2 (Public Review):

      Summary:

      The study describes differences in responses to sounds and whisker deflections as well as combinations of these stimuli in different neurochemically defined subsections of the lateral and dorsal cortex of the inferior colliculus in anesthetised and awake mice.

      Strengths:

      A major achievement of the work lies in obtaining the data in the first place as this required establishing and refining a challenging surgical procedure to insert a prism that enabled the authors to visualise the lateral surface of the inferior colliculus. Using this approach, the authors were then able to provide the first functional comparison of neural responses inside and outside of the GABA-rich modules of the lateral cortex. The strongest and most interesting aspects of the results, in my opinion, concern the interactions of auditory and somatosensory stimulation. For instance, the authors find that a) somatosensory-responses are strongest inside the modules and b) somatosensory-auditory suppression is stronger in the matrix than in the modules. This suggests that, while somatosensory inputs preferentially target the GABA-rich modules, they do not exclusively target GABAergic neurons within the modules (given that the authors record exclusively from excitatory neurons we wouldn't expect to see somatosensory responses if they targeted exclusively GABAergic neurons) and that the GABAergic neurons of the modules (consistent with previous work) preferentially impact neurons outside the modules, i.e. via long-range connections.

    1. Reviewer #3 (Public Review):

      Summary:

      The manuscript by Ma et al. describes a multi-model (pig, mouse, organoid) investigation into how fecal transplants protect against E. coli infection. The authors identify A. muciniphila and B. fragilis as two important strains and characterize how these organisms impact the epithelium by modulating host signaling pathways, namely the Wnt pathway in lgr5 intestinal stem cells.

      Strengths:

      The strengths of this manuscript include the use of multiple model systems and follow up mechanistic investigations to understand how A. muciniphila and B. fragilis interacted with the host to impact epithelial physiology.

      Weaknesses:

      After an additional revision, the bioinformatics section of the methods has changed significantly from previous versions and now indicates a third sequencer was used instead: Ion S5 XL. Important parameters required to replicate analysis have still not been provided. Inspection of the SRA data indicates a mix of Illumina MiSeq and Illumina HiSeq 2500. It is now unclear which sequencing technology was used as authors have variably reported 4 different sequencers for these samples. Appropriate metadata was not provided in the SRA, although some groups may be inferred from sample names. These changing descriptions of the methodologies and ambiguity in making the data available create concerns about rigor of study and results.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript provides a detailed analysis of B-cell lymphomagenesis in mice lacking an alternative exon in region encoding the C-terminal (regulatory) domain of the p53 protein and thus enable to assemble the so-called p53AS isoform. This isoform differs from canonical p53 by the replacement of roughly 30 c-terminal residues by about 10 residues encoded by the alternative exon. There is biochemical and biological evidence that p53AS retains strong transcriptional and somewhat enhanced suppressive activities, with mouse models expressing protein constructs similar to p53AS showing signs of increased p53 activity leading to rapid and lethal anemia. However, the precise role of the alternative p53AS variant has not been addressed so far in a mouse model aimed at demonstrating whether the lack of this particular p53 isoform (trp53ΔAS/ΔAS mice) may cause a specific pathological phenotype.

      Results show that lack of AS expression does not noticeably affect p53 the patterns of protein expression and transcriptional activity but reveals a subtle pathogenic phenotype, with trp53ΔAS/ΔAS males, but not females, tending to develop more frequently and earlier B-cell lymphoma than WT. Next, the authors then introduced ΔAS in transgenic Eμ-Myc mice that show accelerated lymphomagenesis. They show that lack of AS caused increased lethality and larger tumor lymph nodes in p53ΔAS Eμ-Myc males compared to their p53WT Eμ-Myc male counterparts, but not in females. Comparative transcriptomics identified a small set of candidate, differentially expressed gene, including Ackr4 (atypical chemokine receptor 4), which was significantly expressed in the spleens of ΔAS compared to WT controls. Ackr4 encodes a dummy receptor acting as an interceptor for multiple chemokines and thus may negatively regulate a chemokine/cytokine signalling axis involved in lymphomagenesis, which is down-regulated by estrogen signalling. Using in vitro cell models, the authors provide evidence that Ackr4 is a transcriptional target for p53 and that its p53-dependent activation is repressed by 17b-oestradiol. Finally, seeking evidence for a relevance for this gene in human lymphomagenesis, the authors analyse Burkitt lymphoma transcriptomic datasets and show that high ACKR4 expression correlated with better survival in males, but not in females

    1. Reviewer #2 (Public Review):

      Summary:

      The authors tried to identify novel adult functions of the classical Drosophila juvenile-adult transition axis (i.e. ptth-ecdysone). Surprisingly, larval ptth-expressing neurons expressed the sex-specific doublesex gene, thus belonging to the sexual dimorphic circuit. Lack of ptth during late larval development caused enhanced female sexual receptivity, effect rescued by supplying ecdysone in the food. Among many other cellular players, pC1 neurons control receptivity by encoding the mating status of females. Interestingly, during metamorphosis a subtype of pC1 neurons required Ecdysone Receptor A in order to regulate such female receptivity. A transcriptomic analysis using pC1-specific Ecdyone signaling down-regulation gives some hints of possible downstream mechanisms.

      Strengths:

      The manuscript showed solid genetic evidence that lack of ptth during development caused enhanced copulation rate in female flies, which includes ptth mutant rescue experiments by over-expressing ptth as well as by adding ecdysone-supplemented food. They also present elegant data dissecting the temporal requirements of ptth-expressing neurons by shifting animals from non-permissive to permissive temperatures, in order to inactivate neuronal function (although not exclusively ptth function). They showed that EcR-A is up-regulated in ptth mutant background. By combining different drivers together with EcR-A RNAi and torso RNAi lines authors also identified the Ecdysone receptor and torso requirements of a particular subtype of pC1 neurons during metamorphosis. Convincing live calcium imaging showed no apparent effect of EcR-A in neural activity, although some effect on morphology is uncovered. Finally, bulk RNAseq shows differential gene expression after EcR-A down-regulation.

      Weaknesses:

      The paper has three main weaknesses. The first one refers to temporal requirements of ptth and ecdysone signaling. Whereas ptth is necessary during larval development, ecdysone effect appears during pupal development. ptth induces ecdysone synthesis during larval development but there is no published evidence about a similar role for ptth during pupal stages. The down-regulation of EcR-A by RNAi requires at least 8 h to be complete, whereas the activation of ptth neurons in larva stages is immediate. Furthermore, larval and pupal ecdysone functions are different (triggering metamorphosis vs tissue remodeling). The second caveat is the fact that ptth and ecdysone/torso loss-of-function experiments render opposite effects (enhancing and decreasing copulation rates, respectively). The most plausible explanation is that both functions are independent of each other, also suggested by differential temporal requirements. Finally, in order to identify the effect in the transcriptional response of down-regulating EcR-A in a very small population of neurons, a scRNAseq study should have been performed instead of bulk RNAseq.

      In summary, despite the authors providing convincing evidence that ptth and ecdysone signaling pathways are involved in female receptivity, the main claim that ptth regulates this process through ecdysone is not supported by results. More likely, they'd rather be independent processes.

    1. Reviewer #2 (Public Review):

      Summary:<br /> This research offers a comprehensive analysis of the regenerative process in sea cucumbers and builds upon decades of previous research. The approach involves a detailed examination using single-cell sequencing, making it a crucial reference paper while shedding new light on regeneration in this organism.

      Strengths:<br /> Detailed analysis of single-cell sequencing data and high-quality RNA localization images provide significant new insights into regeneration in sea cucumbers and, more broadly, in animals.

      Weaknesses:<br /> The spatial context of the RNA localization images is not well represented, making it difficult to understand how the schematic model was generated from the data. In addition, multiple strong statements in the conclusion should be better justified and connected to the data provided.

    1. Reviewer #2 (Public Review):

      Summary

      This study provides a detailed analysis and dissociation between two effects of activation of lateral inhibitory circuits in the olfactory bulb on ongoing single mitral/tufted cell (MTC) spiking activity, namely enhanced synchronization in the gamma frequency range or lateral inhibition of firing rate.

      The authors use a clever combination of single-cell recordings, optogenetics with variable spatial stimulation of MTCs and sensory stimulation in vivo, and established mathematical methods to describe changes in autocorrelation/synchronization of a single MTC's spiking activity upon activation of lateral glomerular MTC ensembles. This assay is rounded off by a gain-of-function experiment in which the authors enhance granule cell (GC) excitation to establish a causal relation between GC activation and enhanced synchronization to gamma (they had used this manipulation in their previous paper Dalal & Haddad 2022, but use a smaller illumination spot here for spatially restricted activation).

      Strengths

      This study is of high interest for olfactory processing - since it shows directly that interactions between only two selected active receptor channels are sufficient to enhance the synchronization of single neurons to gamma in one channel (and thus by inference most likely in both). These interactions are distance-independent over many 100s of µms and thus can allow for non-topographical inhibitory action across the bulb, in contrast to the center-surround lateral inhibition known from other sensory modalities.

      In my view, parallels between vision and olfaction might have been overemphasized so far, since the combinatorial encoding of olfactory stimuli across the glomerular map might require different mechanisms of lateral interaction versus vision. This result is indicative of such a major difference.

      Such enhanced local synchronization was observed in a subset of activated channel pairs; in addition, the authors report another type of lateral interaction that does involve the reduction of firing rates, drops off with distance and most likely is caused by a different circuit-mediated by PV+ neurons (PVN; the evidence for which is circumstantial).

      Weaknesses/Room for improvement

      Thus this study is an impressive proof of concept that however does not yet allow for broad generalization. Therefore the framing of results should be slightly more careful in my opinion.

      Along this line, the conclusions regarding two different circuits underlying lateral inhibition vs enhanced synchronization are not quite justified by the data, e.g.

      (1) The authors mention that their granule cell stimulation results in a local cold spot (l. 527 ff) - how can they then said to be not involved in the inhibition of firing rate (bullet point in Highlights)? Please elaborate further. In l.406 they also state that GCs can inhibit MTCs under certain conditions. The argument, that this stimulation is not physiological, makes sense, but still does not rule out anything. You might want to cite Aghvami et al 2022 on the very small amplitude of GC-mediated IPSPs, also McIntyre and Cleland 2015.

      (2) Even from the shown data, it appears that laterally increased synchronization might co-occur with lateral suppression (See also comment on Figures 1d,e and Figure S1c)

      (3) There are no manipulations of PVN activity in this study, thus there is no direct evidence for the substrate of the second circuit.

      (4) The manipulation of GC activity was performed in a transgenic line with viral transfection, which might result in a lower permeation of the population compared to the line used for optogenetic stimulation of MTCs.

      In some instances, the authors tend to cite older literature - which was not yet aware of the prominent contribution of EPL interneurons including PVN to recurrent and lateral inhibition of MT cells - as if roles that then were ascribed to granule cells for lack of better knowledge can still be unequivocally linked to granule cells now. For example, they should discuss Arevian et al (2006), Galan et al 2006, Giridhar et al., Yokoi et al. 1995, etc in the light of PVN action.

      Therefore it is also not quite justified to state that their result regarding the role of GCs specifically for synchronization, not suppression, is "in contrast to the field" (e.g. l.70 f.,, l.365, l. 400 ff).

      Why did the authors choose to use the term "lateral suppression", often interchangeably with lateral inhibition? If this term is intended to specifically reflect reductions of firing rates, it might be useful to clearly define it at first use (and cite earlier literature on it) and then use it consistently throughout.

      A discussion of anesthesia effects is missing - e.g. GC activity is known to be reportedly stronger in awake mice (Kato et al). This is not a contentious point at all since the authors themselves show that additional excitation of GCs enhances synchrony, but it should be mentioned.

      Some citations should be added, in particular relevant recent preprints - e.g. Peace et al. BioRxiv 2024, Burton et al. BioRxiv 2024 and the direct evidence for a glutamate-dependent release of GABA from GCs (Lage-Rupprecht et al. 2020).

      The introduction on the role of gamma oscillations in sensory systems (in particular vision) could be more elaborated.

    1. Reviewer #2 (Public Review):

      Summary:

      To evaluate whether somatic mutations in cancer genomes are enriched with mutations in polyadenylation signal regions, the authors analyzed 1000 genomes data and PCAWG data as a control and experimental set, respectively. They observed increased enrichment of somatic mutations that may affect the function of polyA signals and confirmed that these mutations may influence the expression of the gene through a minigene expression experiment.

      Strengths:

      This study provides a systematic evaluation of polyA signal, which makes it valuable. Overall, the analytic approach and results are solid and supported by experimental validation.

      Weaknesses:

      (1) This study uses APARENT2 as a tool to evaluate functional alteration in polyA signal sequences. Based on the original paper and the results shown in this paper, the algorithm appears to be of high quality. However, the whole study is dependent on the output of APARENT2. Therefore, it would be nice to<br /> (a) run and show a positive control run, which can show that the algorithm works well, and<br /> (b) describe the rationale for selecting this algorithm in the main text.

      (2) Are there recurrent somatic mutation calls (= exactly the same mutation across different tumor samples) in the poly(A) region of certain genes?

      (3) The authors nicely showed that the minigene with A>G mutation altered gene expression. Maybe one can reach a similar conclusion by analyzing a cancer dataset that has mutation and gene expression data? That is, genes with or without polyA mutations show different expression levels.

    1. Reviewer #2 (Public Review):

      Summary:

      Disruption of the nicotinamide adenine dinucleotide (NAD) de novo Synthesis Pathway, by which L-tryptophan is converted to NAD results in multi-organ malformations which collectively has been termed Congenital NAD Deficiency Disorder (CNDD).

      While NAD de novo synthesis is primarily active in the liver postnatally, the site of activity prior to and during organogenesis is unknown. However, mouse embryos are susceptible to CNDD between E7.5-E12.5, before the embryo has developed a functional liver. Therefore, NAD de novo synthesis is likely active in another cell or tissue during this time window of susceptibility.

      The body of work presented in this paper continues the corresponding author's lab investigation of the cause and effects of NAD Deficiency and the primary goal was to determine the cell or tissue responsible for NAD de novo synthesis during early embryogenesis.

      The authors conclude that visceral yolk sac endoderm is the source of NAD de novo synthesis, which is essential for mouse embryonic development, and furthermore that the dynamics of NAD synthesis are conserved in human equivalent cells and tissues, the perturbation of which results in CNDD.

      Strengths:

      Overall, the primary findings regarding the source of NAD synthesis, the temporal requirement, and conservation between rodent and human species are quite novel and important for our understanding of NAD synthesis and its function and role in CNDD.

      The authors used UHPLC-MS/MS to quantify NAD+ and NAD-related metabolites and showed convincingly that the NAD salvage pathway can compensate for the loss of NAD synthesis in Haao-/- embryos, then determined that Haao activity was present in the yolk sac prior to hepatic development identifying this organ as the site of de novo NAD synthesis. Dietary modulation between E7.5-10.5 was sufficient to induce CNDD phenotypes, narrowing the window of susceptibility, and then re-analysis of RNA-seq datasets suggested the endoderm was the cell source of NAD synthesis.

      Weaknesses:

      Page 4 and Table S4. The descriptors for malformations of organs such as the kidney and vertebrae are quite vague and uninformative. More specific details are required to convey the type and range of anomalies observed as a consequence of NAD deficiency.

      Can the authors define whether the role of the NAD pathway in a couple of tissue or organ systems is the same? By this I mean is the molecular or cellular effect of NAD deficiency is the same in the vertebrae and organs such as the kidney. What unifies the effects on these specific tissues and organs and are all tissues and organs affected? If some are not, can the authors explain why they escape the need for the NAD pathway?

      Page 5 and Figure 6C. The expectation and conclusion for whether specific genes are expressed in particular cell types in scRNA-seq datasets depend on the number of cells sequenced, the technology (methodology) used, the depth of sequencing, and also the resolution of the analysis. It is therefore essential to perform secondary validation of the analysis of scRNA-seq data. At a minimum, the authors should perform in situ hybridization or immunostaining for Tdo2, Afmid, Kmo, Kynu, Haao, Qprt, and Nadsyn1 or some combination thereof at multiple time points during early mouse embryogenesis to truly understand the spatiotemporal dynamics of expression and NAD synthesis.

      Absolute functional proof of the yolk sac endoderm as being essential and required for NAD synthesis in the context of CNDD might require conditional deletion of Haoo in the yolk sac versus embryo using appropriate Cre driver lines or in the absence of a conditional allele, could be performed by tetraploid embryo-ES cell complementation approaches. But temporal dietary intervention can also approximate the same thing by perturbing NAD synthesis Shen the yolk sac is the primary source versus when the liver becomes the primary source in the embryo.

    1. Reviewer #2 (Public Review):

      Summary:

      Jia and colleagues developed a fluorescence resonance energy transfer (FRET)-based biosensor to study programmed cell death in the zebrafish spinal cord. They applied this tool to study the death of zebrafish spinal motor neurons.

      Strengths:<br /> Their analysis shows that the tool is a useful biosensor of motor neuron apoptosis in living zebrafish.

      Weaknesses:<br /> However, they have ignored significant literature describing the death of an identified zebrafish motor neuron, expression of the mnx gene in interneurons that are closely related to motor neurons, the increase in number of zebrafish motor neurons over developmental time, and potential differences between the limb-innervating motor neurons whose death has been characterized in chicks and rodents and the body wall-innervating motor neurons whose death they characterized using their biosensor. Thus, although their new tool is likely to be useful in the future, it does not provide new insights into zebrafish motor neuron programmed cell death.

    1. Reviewer #2 (Public Review):

      Summary:

      This study investigated the effects of transcutaneous auricular vagus nerve stimulation (taVNS) on cardiovascular dynamics in subarachnoid hemorrhage (SAH) patients. The researchers conducted a randomized clinical trial with 24 SAH patients, comparing taVNS treatment to a Sham treatment group (20 minutes per day twice a day during the ICU stay). They monitored electrocardiogram (ECG) readings and vital signs to assess acute as well as middle-term changes in heart rate, heart rate variability, QT interval, and blood pressure between the two groups. The results showed that repetitive taVNS did not significantly alter heart rate, corrected QT interval, blood pressure, or intracranial pressure. However, it increased overall heart rate variability and parasympathetic activity after 5-10 days of treatment compared to the sham treatment. Acute taVNS led to an increase in heart rate, blood pressure, and peripheral perfusion index without affecting corrected QT interval, intracranial pressure, or heart rate variability. The acute post-treatment elevation in heart rate was more pronounced in patients who showed clinical improvement. In conclusion, the study found that taVNS treatment did not cause adverse cardiovascular effects, suggesting it is a safe immunomodulatory treatment for SAH patients. The mild acute increase in heart rate post-treatment could potentially serve as a biomarker for identifying SAH patients who may benefit more from taVNS therapy.

      Strengths:

      The paper is overall well written, and the topic is of great interest. The methods are solid and the presented data are convincing.

      Weaknesses:

      (1) It should be clearly pointed out that the current paper is part of the NAVSaH trial (NCT04557618) and presents one of the secondary outcomes of that study while the declared first outcomes (change in the inflammatory cytokine TNF-α in plasma and cerebrospinal fluid between day 1 and day 13, rate of radiographic vasospasm, and rate of requirement for long-term CSF diversion via a ventricular shunt) are available as a pre-print and currently under review (doi: 10.1101/2024.04.29.24306598.). The authors should better stress this point as well as the potential association of the primary with the secondary outcomes.

      (2) The references should be implemented particularly concerning other relevant papers (including reviews and meta-analysis) of taVNS safety, particularly from a cardiovascular standpoint, such as doi: 10.1038/s41598-022-25864-1 and doi: 10.3389/fnins.2023.1227858).

      (3) The dose-response issue that affects both VNS and taVNS applications in different settings should be mentioned (doi: 10.1093/eurheartjsupp/suac036.) as well as the need for more dose-finding preclinical as well as clinical studies in different settings (the best stimulation protocol is likely to be disease-specific).

      Overall, the present work has the important potential to further promote the usage of taVNS even on critically ill patients and might set the basis for future randomized studies in this setting.

    1. Reviewer #2 (Public Review):

      Gekko et al investigate the impact of perturbing mitochondrial during early embryo development, through modulation of the mitochondrial fission protein Drp1 using Trim-Away technology. They aimed to validate a role for mitochondrial dynamics in modulating chromosomal segregation, mitochondrial inheritance and embryo development and achieve this through the examination of mitochondrial and endoplasmic reticulum distribution, as well as actin filament involvement, using targeted plasmids, molecular probes and TEM in pronuclear stage embryos through the first cleavages divisions. Drp1 deletion perturbed mitochondrial distribution, leading to asymmetric partitioning of mitochondria to the 2-cell stage embryo, prevented appropriate chromosomal segregation and culminated in embryo arrest. Resultant 2-cell embryos displayed altered ATP, mtDNA and calcium levels. Microinjection of Drp1 mRNA partially rescued embryo development. A role for actin filaments in mitochondrial inheritance is described, however the actin-based motor Myo19 does not appear to contribute.

      Overall, this study builds upon their previous work and provides further support for the role of mitochondrial dynamics in mediating chromosomal segregation and mitochondrial inheritance. In particular, Drp1 is required for redistribution of mitochondria to support symmetric partitioning and support ongoing development.

      Strengths:<br /> The study is well designed, the methods appropriate and the results clearly presented. The findings are nicely summarised in a schematic.

      Understanding the role of mitochondria in binucleation and mitochondrial inheritance is of clinical relevance for patients undergoing infertility treatment, particularly those undergoing mitochondrial replacement therapy.

      Weaknesses:

      The authors first describe the redistribution of mitochondria during normal development, followed by alterations induced by Drp1 depletion. It would be useful to indicate the time post-hCG for imaging of fertilised zygotes (first paragraph of the results/Figure 1) to compare with subsequent Drp1 depletion experiments.

      It is noted that Drp1 protein levels were undetectable 5h post-injection, suggesting earlier times were not examined, yet in Figure 3A it would seem that aggregation has occurred within 2 hours (relative to Figure 1).

      Mitochondria appear to be slightly more aggregated in Drp1 fl/fl embryos than in control, though comparison with untreated controls does not appear to have been undertaken. There also appears to be some variability in mitochondrial aggregation patterns following Drp1 depletion (Figure 2-suppl 1 B) which are not discussed.

      The authors use western blotting to validate the depletion of Drp1, however do not quantify band intensity. It is also unclear whether pooled embryo samples were used for western blot analysis.

      Likewise, intracellular ROS levels are examined however quantification is not provided. It is therefore unclear whether 'highly accumulated levels' are of significance or related to Drp1 depletion.

      In previous work, Drp1 was found to have a role as a spindle assembly checkpoint (SAC) protein. It is therefore unclear from the experiments performed whether aggregation of mitochondria separating the pronuclei physically (or other aspects of mitochondrial function) prevents appropriate chromosome segregation or whether Drp1 is acting directly on the SAC.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript describes a very eloquent study of disrupted stimulus -secretion coupling in salivary acinar cells in the early stages of an animal model (DMXAA) of Sjogren's syndrome (SS). The study utilizes a range of technically innovative in vivo imaging of Ca signaling, in vivo salivary secretion, patch clamp electrophysiology to assess TMEM16a activity, immunofluorescence and electron microscopy and a range of morphological and functional assays of mitochondrial function. Results show that in mice with DMXAA-induced Sjogren's syndrome, there was a reduced nerve stimulation induced salivary secretion, yet surprisingly the nerve stimulation induced Ca signaling was enhanced. There was also a reduced carbachol (CCh)-induced activation of TMEM16a currents in acinar cells from DMXAA-induced SS mice, whereas the intrinsic Ca-activated TMEM16a currents were unaltered, further supporting that stimulus-secretion coupling was impaired. Consistent with this, high resolution STED microscopy revealed that there was a loss of close physical spatial coupling between IP3Rs and TMEM16a, which may contribute to the impaired stimulus-secretion coupling. Furthermore, the authors show that the mitochondria were both morphologically and functionally impaired, suggesting that bioenergetics may be impaired in salivary acinar cells of DMXAA-induced SS mice.

      Strengths:

      Overall, this is an outstanding manuscript, that will have a huge impact on the field. The manuscript is beautifully well-written with a very clear narrative. The experiments are technically innovative, very well executed and with a logical design The data are very well presented and appropriately analyzed and interpreted.

      Review of Revised Manuscript:

      The authors have now addressed all my comments and concerns in the revised manuscript to my satisfaction.

    1. Reviewer #2 (Public Review):

      Summary:<br /> Bone resorption by osteoclasts plays an important role in bone modeling and homeostasis. The multinucleated mature osteoclasts have higher bone-resorbing capacity than their mononuclear precursors. The previous work by authors has identified that increased cell-surface level of La protein promotes fusion of mononuclear osteoclast precursor cells to form fully active multinucleated osteoclasts. In the present study, the authors further provided convincing data obtained from cellular and biochemical experiments to demonstrate that the nuclear localized La protein where it regulates RNA metabolism was oxidized by redox signaling during osteoclast differentiation and the modified La protein was translocated to osteoclast surface where it associated with other proteins and phospholipids to trigger cell-cell fusion process. The work provides novel mechanistic insights into osteoclast biology and provides a potential therapeutic target to suppress excessive bone resorption in metabolic bone diseases such as osteoporosis and arthritis.

      Strengths:<br /> Increased intracellular ROS induced by osteoclast differentiation cytokine RANKL has been widely studied in enhancing RANKL signaling during osteoclast differentiation. The work provides novel evidence that redox signaling can post-translationally modify proteins to alter the translocation and functions of critical regulators in the late stage of osteoclastogenesis. The results and conclusions are mostly supported by the convincing cellular and biochemical assays,

      Weaknesses:<br /> Lack of in vivo studies in animal models of bone diseases such as postmenopausal osteoporosis, inflammatory arthritis, and osteoarthritis reduces the translational potential of this work.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors observed an aggravated vascular endothelial dysfunction upon overexpressing circHMGCS1 and inhibiting miR-4521. This study discovered that circHMGCS1 promotes arginase 1 expression by sponging miR-4521, which accelerated the impairment of vascular endothelial function.

      Strengths:

      The study is systematic and establishes the regulatory role of the circHMGCS1-miR-4521 axis in diabetes-induced cardiovascular diseases.

      Weaknesses:

      (1) The authors show direct evidence of interaction between circHMGCS1 and miR-4521 by pulldown assay. However, the changes in miRNA expression opposite to the levels of target circRNA could be through Target RNA-Directed MicroRNA Degradation. Since the miRNA level is downregulated, the downstream target gene is expected to be upregulated even in the absence of circRNA.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors set out to demonstrate a mechanistic link between Fcgamma receptor (IIIA) glycosylation and IgG binding affinity and signaling - resulting in antibody-dependent cellular cytotoxicity - ADCC. The work builds off prior findings from this group about the general impact of glycosylation on FcR (Fc receptor)-IgG binding.

      Strengths:

      The structural data (NMR) is highly compelling and very significant to the field. A demonstration of how IgG interacts with FcgRIIIA in a manner sensitive to glycosylation of both the IgG and the FcR fills a critical knowledge gap. The approach to demonstrate the selective impact of glycosylation at N162 is also excellent and convincing. The manuscript/study is, overall, very strong.

      Weaknesses:

      There are a number of minor weaknesses that should be addressed.

      (1) Since S164A is the only mutant in Figure 1 that seems to improve affinity, even if minimally, it would be a nice reference to highlight that residue in the structural model in panel B.

      (2) It is confusing why some of the mutants in the study are not represented in Figure 1 panel A. Those affinities and mutants should be incorporated into panel A so the reader can easily see where they all fall on the scale. T167Y in particular needs to be shown, as it is one of few mutants that fall between what seems to be ADCC+ and ADCC- lines. Also, that mutant seems to have a stronger affinity compared to wt (judged by panel D), yet less ADCC than wt. This would imply that the relationship between affinity and activity is not as clean as stated, though it is clearly important. Comments about this would strengthen the overall manuscript.

      (3) This statement feels out of place: "In summary, this result demonstrates that the sensitivity to antibody fucosylation may be eliminated through FcγRIIIa engineering while preserving antibody-binding affinity." In Figure 2, the authors do indeed show that mutations in FcgRIIIa can alter the impact of IgG core fucosylation, but implying that receptor engineering is somehow translatable or as impactful therapeutically as engineering the antibody itself deflates the real basic science/biochemical impact of understanding these interactions in molecular detail. Not everything has to be immediately translatable to be important.

      (4) The findings reported in Figure 2, panel C are exciting. Controls for the quality of digestion at each step should be shown (perhaps in supplementary data).

      (5) Figure 3 is confusing (mislabeled?) and does not show what is described in the Results. First, there is a F158V variant in the graph but a V158F variant in the text. Please correct this. Second, this variant (V158F/F158V) does not show the 2-fold increase in ADCC with kifunesine as stated. Finally, there are no statistical evaluations between the groups (+/- kif; +/- fucose). The differences stated are not clearly statistically significant given the wide spread of the data. This is true even for the wt variant.

      (6) The kifunensine impact is somewhat confusing. They report a major change in ADCC, yet similar large changes with trimming only occur once most of the glycan is nearly gone (Figure 2). Kifunensine will tend to generate high mannose and possibly a few hybrid glycans. It is difficult to understand what glycoforms are truly important outside of stating that multi-branched complex-type N-glycans decrease affinity.

      (7) This is outside of the immediate scope, but I feel that the impact would be increased if differences in NK cell (and thus FcgRIIIA) glycosylation are known to occur during disease, inflammation, age, or some other factor - and then to demonstrate those specific changes impact ADCC activity via this mechanism.

    1. Reviewer #2 (Public Review):

      Through RNA analysis, Xie et al found LncRNA Snhg3 was one of the most down-regulated Snhgs by high fat diet (HFD) in mouse liver. Consequently, the authors sought to examine the mechanism through which Snhg3 is involved in the progression of metabolic dysfunction-associated fatty liver diseases (MASLD) in HFD-induced obese (DIO) mice. Interestingly, liver-specific Sngh3 knockout reduced, while Sngh3 over-expression potentiated fatty liver in mice on a HFD. Using the RNA pull-down approach, the authors identified SND1 as a potential Sngh3 interacting protein. SND1 is a component of the RNA-induced silencing complex (RISC). The authors found that Sngh3 increased SND1 ubiquitination to enhance SND1 protein stability, which then reduced the level of repressive chromatin H3K27me3 on PPARg promoter. The upregulation of PPARg, a lipogenic transcription factor, thus contributed to hepatic fat accumulation.

      The authors propose a signaling cascade that explains how LncRNA sngh3 may promote hepatic steatosis. Multiple molecular approaches have been employed to identify molecular targets of the proposed mechanism, which is a strength of the study. There are, however, several potential issues to consider before jumping to the conclusion.

      (1) First of all, it's important to ensure the robustness and rigor of each study. The manuscript was not carefully put together. The image qualities for several figures were poor, making it difficult for the readers to evaluate the results with confidence. The biological replicates and numbers of experimental repeats for cell-based assays were not described. When possible, the entire immunoblot imaging used for quantification should be presented (rather than showing n=1 representative). There were multiple mis-labels in figure panels or figure legends (e.g., Fig. 2I, Fig. 2K and Fig. 3K). The b-actin immunoblot image was reused in Fig. 4J, Fig. 5G and Fig. 7B with different exposure times. These might be from the same cohort of mice. If the immunoblots were run at different times, the loading control should be included on the same blot as well.

      (2) The authors can do a better job in explaining the logic for how they came up with the potential function of each component of the signaling cascade. Sngh3 is down-regulated by HFD. However, the evidence presented indicates its involvement in promoting steatosis. In Fig. 1C, one would expect PPARg expression to be up-regulated (when Sngh3 was down-regulated). If so, the physiological observation conflicts with the proposed mechanism. In addition, SND1 is known to regulate RNA/miRNA processing. How do the authors rule out this potential mechanism? How about the hosting snoRNA, Snord17? Does it involve in the progression of NASLD?

      (3) The role of PPARg in fatty liver diseases might be a rodent-specific phenomenon. PPARg agonist treatment in humans may actually reduce ectopic fat deposition by increasing fat storage in adipose tissues. The relevance of the finding to human diseases should be discussed.

    1. Reviewer #2 (Public Review):

      Summary:

      With this work, the authors tried to expand and integrate the concept of realized niche in the context of movement ecology by using fine-scale GPS data of 55 juvenile Golden eagles in the Alps. Authors found that ontogenic changes influence the percentage of area flyable to the eagles as individuals exploit better geographic uplifts that allow them to reduce the cost of transport.

      Strengths:

      Authors made insightful work linking changes in ontogeny and energy landscapes in large soaring birds that may not only advance the understanding of how changes in the life cycle affect the exploitability of aerial space but also offer valuable tools for the management and conservation of large soaring species in the changing world.

      Weaknesses:

      Future research may test the applicability of the present work by including more individuals and/or other species from other study areas.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript uses single-molecule fluorescence resonance energy transfer (smFRET) to identify differences in the molecular mechanisms of CXCR4 and ACKR3, two 7-transmembrane receptors that both respond to the chemokine CXCL12 but otherwise have very different signaling profiles. CXCR4 is highly selective for CXCL12 and activates heterotrimeric G proteins. In contrast, ACKR3 is quite promiscuous and does not couple to G proteins, but like most G protein-coupled receptors (GPCRs), it is phosphorylated by GPCR kinases and recruits arrestins. By monitoring FRET between two positions on the intracellular face of the receptor (which highlights the movement of transmembrane helix 6 [TM6], a key hallmark of GPCR activation), the authors show that CXCR4 remains mostly in an inactive-like state until CXCL12 binds and stabilizes a single active-like state. ACKR3 rapidly exchanges among four different conformations even in the absence of ligands, and agonists stabilize multiple activated states.

      Strengths:

      The core method employed in this paper, smFRET, can reveal dynamic aspects of these receptors (the breadth of conformations explored and the rate of exchange among them) that are not evident from static structures or many other biophysical methods. smFRET has not been broadly employed in studies of GPCRs. Therefore, this manuscript makes important conceptual advances in our understanding of how related GPCRs can vary in their conformational dynamics.

      Weaknesses:

      (1) The cysteine mutations in ACKR3 required to site-specifically install fluorophores substantially increase its basal and ligand-induced activity. If, as the authors posit, basal activity correlates with conformational heterogeneity, the smFRET data could greatly overestimate the conformational heterogeneity of ACKR3.

      (2) The probes used cannot reveal conformational changes in other positions besides TM6. GPCRs are known to exhibit loose allosteric coupling, so the conformational distribution observed at TM6 may not fully reflect the global conformational distribution of receptors. This could mask important differences that determine the ability of intracellular transducers to couple to specific receptor conformations.

      (3) While it is clear that CXCR4 and ACKR3 have very different conformational dynamics, the data do not definitively show that this is the main or only mechanism that contributes to their functional differences. There is little discussion of alternative potential mechanisms.

      (4) The extent to which conformational heterogeneity is a characteristic feature of ACKRs that contributes to their promiscuity and arrestin bias is unclear. The key residue the authors find promotes ACKR3 conformational heterogeneity is not conserved in most other ACKRs, but alternative mechanisms could generate similar heterogeneity.

      (5) There are no data to confirm that the two receptors retain the same functional profiles observed in cell-based systems following in vitro manipulations (purification, labeling, nanodisc reconstitution).

    1. Reviewer #2 (Public Review):

      Summary:

      The authors build a colossal anatomical model of juvenile rat non-barrel primary somatosensory cortex, including inputs from the thalamus. This enhances past models by incorporating information on the shape of the cortex and estimated densities of various types of excitatory and inhibitory neurons across layers. This is intended to enable an analysis of the micro- and mesoscopic organisation of cortical connectivity and to be a base anatomical model for large-scale simulations of physiology.

      Strengths:

      • The authors incorporate many diverse data sources on morphology and connectivity.

      • This paper takes on the challenging task of linking micro- and mesoscale connectivity.

      • By building in the shape of the cortex, the authors were able to link cortical geometry to connectivity. In particular, they make an unexpected prediction that cortical conicality affects the modularity of local connectivity, which should be testable.

      • The author's analysis of the model led to the interesting prediction that layer 5 neurons connect local modules, which may be testable in the future, and provide a basis to link from detailed anatomy to functional computations.

      • The visualisation of the anatomy in various forms is excellent.

      • A subnetwork of the model is openly shared (but see question below).

      Weaknesses:

      • Why was non-barrel S1 of the juvenile rat cortex selected as the target for this huge modelling effort? This is not explained.

      • There is no effort to determine how specific or generalisable the findings here are to other parts of the cortex.

      • Although there is a link to physiological modelling in another paper, there is no clear pathway to go from this type of model to understand how the specific function of the modelled areas may emerge here (and not in other cortical areas).

      • In a few places the manuscript could be improved by being more specific in the language, for example:<br /> - "our anatomy-based approach has been shown to be powerful", I would prefer instead to read about specific contributions of past papers to the field, and how this builds on them.<br /> - similarly: "ensuring that the total number of synapses in a region-to-region pathway matches biology." Biology here is a loose term and implies too much confidence in the matching to some ground truth. Please instead describe the source of the data, including the type of experiment.

      • Some of the decisions seem a little ad-hoc, and the means to assess those decisions are not always available to the reader e.g.<br /> - pg. 10. "Based on these results, we decided that the local connectome sufficed to model connectivity within a region.". What is the basis for this decision? Can it be formalised?<br /> - "In the remaining layers the results of the objective classification were used to validate the class assignments of individual pyramidal cells. We found the objective classification to match the expert classification closely (i.e., for 80-90% of the morphologies). Consequently, we considered the expert classification to be sufficiently accurate to build the model." The description of the validation is a little informal. How many experts were there? What are their initials? Was inter-rater or intra-rater reliability assessed? What are these numbers? The match with Kanari's classification accuracy should be reported exactly. There are clearly experts among the author list, but we are all fallible without good controls in place, and they should be more explicit about those controls here, in my opinion.<br /> - "Morphology selection was then performed as previously (Markram et al., 2015), that is, a morphology was selected randomly from the top 10% scorers for a given position." A lot of the decisions seem a little ad-hoc, without justification other than this group had previously done the same thing. For example, why 10% here? Shouldn't this be based on selecting from all of the reasonable morphologies?

      • I would like to know if one of the key results relating to modularity and cortical geometry can be further explored. In particular, there seem to be sharp changes in the data at the end of the modelled cortical regions, which need to be explored or explained further.

      • The shape of the juvenile cortex - a key novelty of this work - was based on merely a scalar reduction of the adult cortex. This is very surprising, and surely an oversimplification. Huge efforts have gone into modelling the complex nonlinear development of the cortex, by teams including the developing Human Connectome Project. For such a fundamental aspect of this work, why isn't it possible to reconstruct the shape of this relatively small part of the juvenile rat cortex?

      • The same relative laminar depths are used for all subregions. This will have a large impact on the model. However, relative laminar depths can change drastically across the cortex (see e.g. many papers by Palomero-Gallagher, Zilles, and colleagues). The authors should incorporate the real laminar depths, or, failing that, show evidence to show that the laminar depth differences across the subregions included in the model are negligible.

      • The authors perform an affine mapping between mouse and rat cortex. This is again surprising. In human imaging, affine mappings are insufficient to map between two individual brains of the same species and nonlinear transformations are instead used. That an affine transformation should be considered sufficient to map between two different species is then very surprising. For some models, this may be fine, but there is a supposed emphasis here on biological precision in terms of anatomical location.

      • One of the most interesting conclusions, that the connectivity pattern observed is in part due to cooperative synapse formation, is based on analyses that are unfortunately not shown.

      • Open code:<br /> - Why is only a subvolume available to the community?<br /> - Live nature of the model. This is such a colossal model, and effort, that I worry that it may be quite difficult to update in light of new data. For example, how much person and computer time would it take to update the model to account for different layer sizes across subregions? Or to more precisely account for the shape of the juvenile rat cortex?

    1. Reviewer #2 (Public Review):

      Summary of the manuscript:

      The authors present MGPfactXMBD, a novel model-based manifold-learning framework designed to address the challenges of interpreting complex cellular state spaces from single-cell RNA sequences. To overcome current limitations, MGPfactXMBD factorizes complex development trajectories into independent bifurcation processes of gene sets, enabling trajectory inference based on relevant features. As a result, it is expected that the method provides a deeper understanding of the biological processes underlying cellular trajectories and their potential determinants.

      MGPfactXMBD was tested across 239 datasets, and the method demonstrated similar to slightly superior performance in key quality-control metrics to state-of-the-art methods. When applied to case studies, MGPfactXMBD successfully identified critical pathways and cell types in microglia development, validating experimentally identified regulons and markers. Additionally, it uncovered evolutionary trajectories of tumor-associated CD8+ T cells, revealing new subtypes with gene expression signatures that predict responses to immune checkpoint inhibitors in independent cohorts.

      Overall, MGPfactXMBD represents a relevant tool in manifold learning for scRNA-seq data, enabling feature selection for specific biological processes and enhancing our understanding of the biological determinants of cell fate.

      Summary of the outcome:

      The novel method addresses core state-of-the-art questions in biology related to trajectory identification. The design and the case studies are of relevance.

      However, in my opinion, the manuscript requires several clarifications and updates.

      Also, how the methods compare with existing Deep Learning based approaches such as TIGON is a question mark. If a comparison would be possible, it should be conducted; if not, it should be clarified why.

      Strengths:

      (1) Relevant methodology for a current field of research.

      (2) Relevant case studies with relevant outcomes.

      Weaknesses:

      (1) In general, the manuscript may be improved by making the text more accessible to the Journal's audience: (i) intuitive explanation of some concepts; (ii) review the flow of some explanations.

      (2) Additionally, several parts require more details on how the methods work, especially the case studies.

      (3) Finally, there are missing references to published work and possibly some additional comparisons to make.

    1. Reviewer #2 (Public Review):

      This paper examines the reproducibility of results reported by the Murphy lab regarding transgenerational inheritance of a learned avoidance behavior in C. elegans. It has been well established by multiple labs that worms can learn to avoid the pathogen pseudomonas aeruginosa (PA14) after a single exposure. The Murphy lab has reported that learned avoidance is transmittable to 4 generations and dependent on a small RNA expressed by PA14 that elicits the transgenerational silencing of a gene in C. elegans. The Hunter lab now reports that although they can reproduce inheritance of the learned behavior by the first generation (F1), they cannot reproduce inheritance in subsequent generations.

      This is an important study that will be useful for the community. Although they fail to identify a "smoking gun", the study examines several possible sources for the discrepancy, and their findings will be useful to others interested in using these assays. The preference assay appears to work in their hands in as much as they are able to detect the learned behavior in the P0 and F1 generations, suggesting that the failure to reproduce the transgenerational effect is not due to trivial mistakes in the protocol. An obvious reason, however, to account for the differing results is that the culture conditions used by the authors are not permissive for the expression of the small RNA by PA14 that the MUrphy lab identified as required for transgenerational inheritance. It would seem prudent for the authors to determine whether this small RNA is present in their cultures, or at least acknowledge this possibility. The authors should also note that their protocol was significantly different from the Murphy protocol (see comments below) and therefore it remains possible that protocol differences cumulatively account for the different results.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The authors improve the work of Jallais et al. (2022) by including a novel module capable of automatically learning feature selection from different acquisition protocols inside a supervised learning framework. Combining the module above with an estimation framework for estimating the posterior distribution of model parameters, they obtain rich probabilistic information (uncertainty and degeneracy) on the parameters in a reasonable computation time.

      The main contributions of the work are:<br /> (1) The whole framework allows the user to avoid manually defining summary statistics, which may be slow and tedious and affect the quality of the results.<br /> (2) The authors tested the proposal by tackling three different biophysical models for brain tissue and using data with characteristics commonly used by the diffusion-MR-microstructure research community.<br /> (3) The authors validated their method well with the state-of-the-art.

      The main weakness is:<br /> (1) The methodology was tested only on scenarios with a signal-to-noise ratio (SNR) equal to 50. It is interesting to show results with lower SNR and without noise that the method can detect the model's inherent degenerations and how the degeneration increases when strong noise is present. I suggest expanding the Figure in Appendix 1 to include this information.

      The authors showed the utility of their proposal by computing complex parameter descriptors automatically in an achievable time for three different and relevant biophysical models.

      Importantly, this proposal promotes tackling, analyzing, and considering the degenerated nature of the most used models in brain microstructure estimation.

    1. Reviewer #2 (Public Review):

      The transient receptor potential mucolipin 1 (TRPML1) functions as a lysosomal organelle ion channel whose variants are associated with lysosomal storage disorder mucolipidosis type IV. Understanding sites that allosterically control the TRPML1 channel function may provide new molecular moieties to target with prototypic drugs.

      Gan et al provide the first high-resolution cryo-EM structures of the TRPML1 channel (Y404W) in the open state without any activating ligands. This new structure demonstrates how a mutation at a site some distance away from the pore can influence the channel's conducting state. However, the authors do not provide a structural analysis of the Y404W pore which would validate their open-state claims. Nonetheless, Gan et al provide compelling electrophysiology evidence which supports the proposed Y404W gain of function effect. The authors propose an allosteric mechanism with the following molecular details- the Y404 to W sidechain substitution provides extra van der Waals contacts within the pocket surrounded by helices of the VSD-like domain and causes S4 bending which in turn opens to the pore through the S4-S5 linker. Conversely, the author functionally demonstrates that an alanine mutation at this site causes a loss of function. Although the authors do not provide a structure of the Y404A mutation, they propose that the alanine substitution disrupts the sidechain packing and likely destabilizes the open conformation. TRPM1 channels are regulated by PIP2 species, which is related to their cell function. In the membrane of lysosomes, PI(3,5)P2 activates the channel, whereas PI(4,5)P2 found in the plasma membrane has inhibitory effects. To understand its lipid regulation, the authors solved a cryo-EM structure of TRPM1 bound to PI(4,5)P2 in its presumed closed state. Again, while the provided functional evidence suggests that PI(4,5)P2 occupancy inhibits TRPML1 current, the authors do not provide analysis of the pore which would support their closed state assertion. Within this same structure, the authors observe a density that may be attributed to sphingomyelin (or possibly phosphocholine). Using electrophysiology of WT and the Y404W channels, the authors report sphingomyelins antagonist effect on TRPML1 currents under low luminal (external) pH. Taken together, the results described in Gan et al provide compelling evidence for a gating (open, closed) mechanism of the TRPML1 pore which can be allosterically regulated by altered packing and lipid interactions within the VSDL.

    1. Reviewer #2 (Public Review):

      Summary:

      The study demonstrates that Znhit1 regulates male meiosis, with deletion causing pachytene failure associated with defective expression of pachytene genes and subtle effects on X-Y pairing and DSB repair. The authors attribute this phenotype to the defective incorporation of the Znhit1 target H2A.Z into chromatin.

      Strengths:

      The paper and the figures are well presented and the narrative is clear. Evidence that the conditional deletion strategy removes Znhit1 is strong, with multiple orthogonal approaches used. Most of the meiotic phenotyping is well performed, and the omics analysis clearly identifies a dramatic effect on the meiotic gene expression program. The link to H2A.Z and A-MYB adds a mechanistic angle to the study.

      Weaknesses:

      (1) Current literature demonstrates that meiotic mutants arrest at one of two stages: midpachytene (stage IV of the seminiferous cycle) or metaphase I (stage XII of the seminiferous cycle). This study documents that in the Znhit1 KO the midpachytene marker H1t appears normally, but that cells arrest before diplotene. If this is true, then arrest must occur during late pachytene, which based on my knowledge has never been documented for a meiotic KO. To resolve this, the authors should present stronger histological substaging evidence to support their claim.

      (2) The authors overlooked the possible effects of Znhit1 deletion on MSCI. Defective MSCI is a well-established cause of pachytene arrest. Actually, the fact that they see X-Y pairing failure should alert them even more strongly to this possibility because MSCI failure is often associated with defective X-Y pairing. This could be easily addressed by examination of their RNAseq data.

      (3) The recombination assays need attention.<br /> - In the text the authors state that they studied RPA2 and DMC1, but the figures show RPA2 and RAD51.<br /> - The RPA counts are not quantitated.<br /> - The conclusion that crossover formation fails (based on MLH1 staining) is not justified. This marker does not appear in wt males until late pachytene, so if cells in this mutant are dying before that stage, MLH1 cannot be assessed.<br /> - The authors state that gH2AZ persists in the KO, but I'm not convinced that they are comparing equivalent stages in the wt and KO. In Figure 3C, the pachytene cell is late, whereas in the mutant the pachytene cell is early or mid (when residual gH2AX is expected, even in wt males).<br /> - Previous work (PMID: 23824539) has shown that antibodies reportedly detecting pATM in the sex body are non-specific. I therefore advise caution with the data shown in Figure 3D.

      (4) RNAseq data. The authors show convincingly that Znhit1 activates genes that are normally upregulated at the zyg-pachytene transition. They should repeat the analysis for genes normally upregulated at the prelep- lep and lep-zyg transition to show that this effect is really pachytene-gene specific.

      (5) I am puzzled that the title and overall gist of the study focuses on H2A.Z, when it is Znhit1 that has been deleted.

    1. Reviewer #2 (Public Review):

      Summary:

      In this work, the authors attempt to noninvasively image metabolic aspects of the tumor microenvironment in vivo, in 2 mouse models of glioblastoma. The tumor lesion and its surrounding appearance are extensively characterized using histology to validate/support any observations made with the metabolic imaging approach. The metabolic imaging method builds on a previously used approach by the authors and others to measure the kinetics of deuterated glucose metabolism using dynamic 2H magnetic resonance spectroscopic imaging (MRSI), supported by de-noising methods.

      Strengths:

      Extensive histological evaluation and characterization.

      Measurement of the time course of isotope labeling to estimate absolute flux rates of glucose metabolism.

      Weaknesses:

      The de-noising method appears essential to achieve the high spatial resolution of the in vivo imaging to be compatible with the dimensions of the tumor microenvironment, here defined as the immediately adjacent rim of the mouse brain tumors. There are a few challenges with this approach. Often denoising methods applied to MR spectroscopy data have merely a cosmetic effect but the actual quantification of the peaks in the spectra is not more accurate than when applied directly to original non-denoised data. It is not clear if this concern is applicable to the denoising technique applied here. However, even if this is not an issue, no denoising method can truly increase the original spatial resolution at which data were acquired. A quick calculation estimates that the spatial resolution of the 2H MRSI used here is 30-40 times too low to capture the much smaller tumor rim volume, and therefore there is concern that normal brain tissue and tumor tissue will be the dominant metabolic signal in so-called tumor rim voxels. This means that the conclusions on metabolic features of the (much larger) tumor are much more robust than the observations attributed to the (much smaller) tumor microenvironment/tumor rim.

      To achieve their goal of high-level metabolic characterization the authors set out to measure the deuterium labeling kinetics following an intravenous bolus of deuterated glucose, instead of the easier measurement of steady-state after the labeling has leveled off. These dynamic data are then used as input for a mathematical model of glucose metabolism to derive fluxes in absolute units. While this is conceptually a well-accepted approach there are concerns about the validity of the included assumptions in the metabolic model, and some of the model's equations and/or defining of fluxes, that seem different than those used by others.

    1. Reviewer #2 (Public Review):

      This study from Dr. Emura and colleagues addresses the relevance of AGS3 mutations in the execution of asymmetric cell divisions promoting the formation of the micromere during sea-searching development. To this aim, the authors use quantitative imaging approaches to evaluate the localisation of AGS3 mutants truncated at the N-terminal region or at the C-terminal region, and correlate these distributions with the formation of micromere and correct development of embryos to the pluteus stage. The authors also analyse the capacity of these mutated proteins to rescue developmental defects observed upon AGS3 depletion by morpholino antisense nucleotides (MO). Collectively these experiments revealed that the C-terminus of AGS3, coding for four GoLoco motifs binding to cortical Gaphai proteins, is the molecular determinant for cortical localisation of AGS3 at the micromeres and correct pluteus development. Further genetic dissections and expression of chimeric AGS3 mutants carrying shuffled copies of the GoLoco motifs or four copies of the same motifs revealed that the position of GoLoco1 is essential for AGS3 functioning. To understand whether the AGS3-GoLoco1 evolved specifically to promote asymmetric cell divisions, the authors analyse chimeric AGS3 variants in which they replaced the sea urchin GoLoco region with orthologs from other echinoids that do not form micromeres, or from Drosophila Pins or human LGN. These analyses corroborate the notion that the GoLoco1 position is crucial for asymmetric AGS3 functions. In the last part of the manuscript, the authors explore whether SpAGS3 interacts with the molecular machinery described to promote asymmetric cell division in eukaryotes, including Insc, NuMA, Par3, and Galphai, and show that all these proteins colocalize at the nascent micromere, together with the fate determinant Vasa. Collectively this evidence highlighted how evolutionarily selected AGS3 modifications are essential to sustain asymmetric divisions and specific developmental programs associated with them.

    1. Reviewer #2 (Public Review):

      Summary:

      In this work, the authors show that the camelid single-chain antibody sdAb42 selectivity inhibits Trypanosome pyruvate kinase (PYK) but not human PYK. Through the determination of the crystal structure and biophysical experiments, the authors show that the nanobody binds to the inactive T-state of the enzyme, and in silico analysis shows that the binding site coincides with an allosteric hotspot, suggesting that nanobody binding may affect the enzyme active site. Binding to the T-state of the enzyme is further supported by non-linear inhibition kinetics. PYK is an important enzyme in the glycolytic pathway, and inhibition is likely to have an impact on organisms such a trypanosomes, that heavily rely on glycolysis for their energy production. The nanobody was generated against Trypanosoma congolense PYK, but for technical reasons the authors progressed to testing its impact on cell viability in Trypanosoma brucei brucei. First, they show that sdA42 is able to inhibit Tbb PYK, albeit with lower potency. Cell-based experiments next show that expression of sdA42 has a modest, and dose-dependent effect on the growth rate of Tbb. The authors conclude that their data indicates that targeting this allosteric site affects cell growth and is a valuable new option for the development of new chemotherapeutics for trypanosomatid diseases.

      Strengths:

      The work clearly shows that sdA42A inhibits Trypanosome and Leishmania PYK selectively, with no inhibition of the human orthologue. The crystal structure clearly identifies the binding site of the nanobody, and the accompanying analysis supports that the antibody acts as an allosteric inhibitor of PYK, by locking the enzyme in its apo state (T-state).

      Weaknesses:

      (1) The most impactful claim of this work is that sdAb42-mediated inhibition of PYK negatively affects parasite growth and that this presents an opportunity to develop novel chemotherapeutics for trypanosomatid diseases. For the following reasons I think this claim is not sufficiently supported:

      - The authors do not provide evidence of target-engagement in cells, i.e. they do not show that sdA42A binds to, or inhibits, Tbb PYK in cells and/or do not provide a functional output consistent with PYK inhibition (e.g. effect on ATP production). Measuring the extent of target engagement and inhibition is important to draw conclusions from the modest effect on growth.

      - The authors do not explore the selectivity of sdA42A in cells. Potentially sdA42A may cross-react with other proteins in cells, which would confound interpretation of the results.

      - sdA42A only affects minor growth inhibition in Tbb. The growth defect is used as the main evidence to support targeting this site with chemotherapeutics, however based on the very modest effect on the parasites, one could reasonably claim that PYK is actually not a good drug target. The strongest effect on growth is seen for the high expressor clone in Figure 4a, however here the uninduced cells show an unusual profile, with a sudden increase in growth rate after 4 days, something that is not seen for any of the other control plots. This unexplained observation accentuates the growth difference between induced and uninduced, and the growth differences seen in all other experiments, including those with the highest expressors (clones 54 and 55) are much more modest. The loss of expression of sdA42A over time is presented as a reason for the limited effect, and used to further support the hypothesis that targeting the allosteric site is a suitable avenue for the development of new drugs. However, strong evidence for this is missing.

      - For chemotherapeutic interventions to be possible, a ligandable site is required. There is no analysis provided of the antibody binding site to indicate that small molecule binding is indeed feasible.

      (2) The authors comment on the modest growth inhibition, and refer to the need to achieve over 88% reduction in Vmax of PYK to see a strong effect, something that may or may not be achieved in the cell-based model (no target-engagement or functional readout provided). The slow binding model and switch of species are also raised as potential explanations. While these may be plausible explanations, they are not tested which leaves us with limited evidence to support targeting the allosteric site on PYK.

      (3) The evidence to support an allosteric mechanism is derived from structural studies, including the in silico allosteric network predictions. Unfortunately, standard enzyme kinetics mode of inhibition studies are missing. Such studies could distinguish uncompetitive from non-competitive behaviour and strengthen the claim that sdAb42 locks the enzyme complex in the apo form.

      (4) As general comment, the graphical representation of the data could be improved in line with recent recommendations: https://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.1002128, https://elifesciences.org/inside-elife/5114d8e9/webinar-report-transforming-data-visualisation-to-improve-transparency-and-reproducibility.

      - Bar-charts for potency are ideally presented as dot plots, showing the individual data points, or box plots with datapoints shown.

      - Images in Figure 7 show significant heterogeneity of nanobody expression, but the extent of this can not be gleaned from Figure 7B. It would be much better to use box plots or violin plots for each cell line on this figure panel. The same applies to Figure 10.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Meng et al. describes a potential role for the coronavirus helicase NSP13 in the regulation of YAP-TEAD activity. The authors present data that NSP13 expression in cells reduces YAP-induced TEAD luciferase reporter activity and that NSP13 transduction in cardiomyocytes blocks hyperactive YAP-mutant phenotypes in vivo. Mechanisms by which viral proteins (particularly those from coronavirus) intersect with cellular signaling events is an important research topic, and the intersection of NSP13 with YAP-TEAD transcriptional activity (independent of upstream Hippo pathway mediated signals) offers new knowledge that is of interest to a broad range of researchers.

      Strengths:

      The manuscript presents convincing data mapping the effects of NSP13 on YAP-TEAD reporter activity in the helicase domain. Moreover, the in vivo data demonstrating that NSP13 expression in YAP5SA mouse cardiomyocytes increased survival animal rates, and restored cardiac function is striking and is supportive of the model presented.

      Weaknesses:

      Limitations to the study are the reliance on TEAD-reporter assays to show specific effects of NPS13 on YAP-TEAD activity, incomplete characterization of the interesting in vivo findings that are presented, and a lack of follow-up to the proposed mechanisms identified from the IP-MS experiments.

      Specific comments and suggestions for improvement of the manuscript:

      (1) NSP13 has been reported to block, in a helicase-dependent manner, episomal DNA transcription (PMID: 37347173), raising questions about the effects observed on the data shown from the HOP-Flash and 8xGTIIC assays. It would be valuable to demonstrate the specificity of the proposed effect of NSP13 on TEAD activation by YAP (versus broad effects on reporter assays) and also to show that NSP13 reduces the function of endogenous YAP-TEAD transcriptional activity (i.e., does ectopic NSP13 expression reduce the expression of YAP induced TEAD target genes in cells).

      (2) While the IP-MS experiment may have revealed new regulators of TEAD activity, the data presented are preliminary and inconclusive. No interactions are validated and beyond slight changes in TEAD reporter activity following knockdown, no direct links to YAP-TEAD are demonstrated, and no link to NPS13 was shown. Also, no details are provided about the methods used for the IP-MS experiment, raising some concerns about potential false positive associations within the data.

    1. Reviewer #2 (Public Review):

      In this manuscript, Yang et al. present a modeling framework to understand the pattern of response biases and variance observed in delayed-response orientation estimation tasks. They combine a series of modeling approaches to show that coupled sensory-memory networks are in a better position than single-area models to support experimentally observed delay-dependent response bias and variance in cardinal compared to oblique orientations. These errors can emerge from a population-code approach that implements efficient coding and Bayesian inference principles and is coupled to a memory module that introduces random maintenance errors. A biological implementation of such operation is found when coupling two neural network modules, a sensory module with connectivity inhomogeneities that reflect environment priors, and a memory module with strong homogeneous connectivity that sustains continuous ring attractor function. Comparison with single-network solutions that combine both connectivity inhomogeneities and memory attractors shows that two-area models can more easily reproduce the patterns of errors observed experimentally.

      Strengths:

      The model provides an integration of two modeling approaches to the computational bases of behavioral biases: one based on Bayesian and efficient coding principles, and one based on attractor dynamics. These two perspectives are not usually integrated consistently in existing studies, which this manuscript beautifully achieves. This is a conceptual advancement, especially because it brings together the perceptual and memory components of common laboratory tasks.

      The proposed two-area model provides a biologically plausible implementation of efficient coding and Bayesian inference principles, which interact seamlessly with a memory buffer to produce a complex pattern of delay-dependent response errors. No previous model had achieved this.

      Weaknesses:

      The correspondence between the various computational models is not clearly shown. It is not easy to see clearly this correspondence because network function is illustrated with different representations for different models. In particular, the Bayesian model of Figure 2 is illustrated with population responses for different stimuli and delays, while the attractor models of Figure 3 and 4 are illustrated with neuronal tuning curves but not population activity.

      The proposed model has stronger feedback than feedforward connections between the sensory and memory modules (J_f = 0.1 and J_b = 0.25). This is not the common assumption when thinking about hierarchical processing in the brain. The manuscript argues that error patterns remain similar as long as the product of J_f and J_b is constant, so it is unclear why the authors preferred this network example as opposed to one with J_b = 0.1 and J_f = 0.25.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Hou et al is a short technical report which details the potential use of a recently developed FRET based biosensor for gamma-secretase activity (Houser et al 2020) for in vivo imaging in the mouse brain. Gamma-secretase plays a crucial role in Alzheimer's disease pathology and therefore developing methodologies for precise in vivo measurements would be highly valuable to better understand AD pathophysiology in animal models.

      The current version of the sensor utilizes a pair of far-red fluorescent proteins fused to a substrate of the enzyme. Using live imaging, it was previously demonstrated it is possible to monitor gamma-secretase activity in cultured cells. Notably, this is a variant of a biosensor that was previously described using CFP-YFP variants FRET pair (Maesako et al, iScience. 2020). The main claim and hypothesis for the manuscript is that IR excitation and emission has considerable advantages in terms of depth of penetration, as well as reduction in autofluorescence. These properties would make this approach potentially suitable to monitor cellular level dynamics of Gama-secretase in vivo.

      The authors use confocal microscopy and show it is possible to detect fluorescence from single cortical cells. The paper described in detail technical information regarding imaging and analysis. The data presented details analysis of FRET ratio (FR) measurements within populations of cells. The authors claim it is possible to obtain reliable measurements at the level of individual cells. They compare the FR values across cells and mice and find a spatial correlation among neighboring cells. This is compared with data obtained after inhibition of endogenous gamma-secretase activity, which abolishes this correlation.

      Strengths:

      The authors describe in detail their experimental design and analysis for in vivo imaging of the reporter. The idea of using a far-red FRET sensor for in vivo imaging is novel and potentially useful to circumvent many of the pitfalls associated with intensity-based FRET imaging in complex biological environments (such as autofluorescence and scattering).

      Weaknesses:

      There are several critical points regarding the validation of this approach:

      (1) Regarding the variability and spatial correlation- the dynamic range of the sensor previously reported in vitro is in the range of 20-30% change (Houser et al 2020) whereas the range of FR detected in vivo is between cells is significantly larger in this MS. This raises considerable doubts for specific detection of cellular activity<br /> (2) One direct way to test the dynamic range of the sensor in vivo, is to increase or decrease endogenous gamma-secretase activity and to ensure this experimental design allows to accurately monitor gamma-secretase activity. In the previous characterization of the reporter (Hauser et al 2020), DAPT application and inhibition of gamma-secretase activity results in increased FR (Figures 2 and 3 of Houser et al). This is in agreement with the design of the biosensor, since FR should be inversely correlated with enzymatic activity. Here, the authors repeated the experiment, and surprisingly found an opposite effect, in which DAPT significantly reduced FR.<br /> The authors maintain that this result could be due to differences in cell-types, However, this experiment was previously performed in cultures cortical neurons and many different cell types, as noted by the authors in their rebuttal.<br /> Instead, I would argue that these results further highlight the concerns of using FR in vivo, since based on their own data, there is no way to interpret this quantification. If DAPT reduces FR, does this mean we should now interpret the results of higher FR corresponds to higher g-sec activity? Given a number of papers from the authors claiming otherwise, I do not understand how one can interpret the results as indicating a cell-specific effect.<br /> In conclusion, without any ground truth, it is impossible to assess and interpret what FR measurements of this sensor in vivo mean. Therefore, the use of this approach as a way to study g-sec activity in vivo seems premature.

    1. Reviewer #2 (Public Review):

      Summary:

      Etcheverry et al. present two computational frameworks for exploring the functional capabilities of gene regulatory networks (GRNs). The first is a framework based on intrinsically motivated exploration, here used to reveal the set of steady states achievable by a given gene regulatory network as a function of initial conditions. The second is a behaviorist framework, here used to assess the robustness of steady states to dynamical perturbations experienced along typical trajectories to those steady states. In Figs. 1-5, the authors convincingly show how these frameworks can explore and quantify the diversity of behaviors that can be displayed by GRNs. In Figs. 6-9, the authors present applications of their framework to the analysis and control of GRNs, but the support presented for their case studies is often incomplete.

      Following revision, my overall perspective of the paper remains unchanged. The first half of the paper provides solid evidence to support an important conceptual framework. The evidence presented for the use cases in the latter half is incomplete; as the authors note, they are preliminary and meant to be built on in future work. I have included my first round comments below.

      Strengths:

      Overall, the paper presents an important development for exploring and understanding GRNs/dynamical systems broadly, with solid evidence supporting the first half of their paper in a narratively clear way.

      The behaviorist point of view for robustness is potentially of interest to a broad community, and to my knowledge introduces novel considerations for defining robustness in the GRN context.

      Some specific weaknesses, mostly concerning incomplete analyses in the second half of the paper:

      (1) The analysis presented in Fig. 6 is exciting but preliminary. Are there other appropriate methods for constructing energy landscapes from dynamical trajectories in gene regulatory networks? How do the results in this particular case study compare to other GRNs studied in the paper?

      Additionally, it is unclear whether the analysis presented in Fig. 6C is appropriate. In particular, if the pseudopotential landscapes are constructed from statistics of visited states along trajectories to the steady state, then the trajectories derived from dynamical perturbations do not only reflect the underlying pseudo-landscape of the GRN. Instead, they also include contributions from the perturbations themselves.

      (2) In Fig. 7, I'm not sure how much is possible to take away from the results as given here, as they depend sensitively on the cohort of 432 (GRN, Z) pairs used. The comparison against random networks is well-motivated. However, as the authors note, comparison between organismal categories is more difficult due to low sample size; for instance, the "plant" and "slime mold" categories each only has 1 associated GRN. Additionally, the "n/a" category is difficult to interpret.

      (3) In Fig. 8, it is unclear whether the behavioral catalog generated is important to the intervention design problem of moving a system in one attractor basin to another. The authors note that evolutionary searches or SGD could also be used to solve the problem. Is the analysis somehow enabled by the behavioral catalog in a way that is complementary to those methods? If not, comparison against those methods (or others e.g. optimal control) would strengthen the paper.

      (4) The analysis presented in Fig. 9 also is preliminary. The authors note that there exist many algorithms for choosing/identifying the parameter values of a dynamical system that give rise to a desired time series. It would be a stronger result to compare their approach to more sophisticated methods, as opposed to random search and SGD. Other options from the recent literature include Bayesian techniques, sparse nonlinear regression techniques (e.g. SINDy), and evolutionary searches. The authors note that some methods require fine-tuning in order to be successful, but even so, it would be good to know the degree of fine-tuning which is necessary compared to their method. [second round: the authors have included a comparison against CMA-ES, an evolutionary algorithm]

    1. Reviewer #2 (Public Review):

      The work by Yun et al. explores an important question related to post-copulatory sexual selection and sperm competition: Can females actively influence the outcome of insemination by a particular male by modulating storage and ejection of transferred sperm in response to contextual sensory stimuli? The present work is exemplary for how the Drosophila model can give detailed insight in basic mechanism of sexual plasticity, addressing the underlying neuronal circuits on a genetic, molecular and cellular level.

      Using the Drosophila model, the authors show that the presence of other males or mated females after mating shortens the ejaculate-holding period (EHP) of a female, i.e. the time she takes until she ejects the mating plug and unstored sperm. Through a series of thorough and systematic experiments involving the manipulation of olfactory and chemogustatory neurons and genes in combination with exposure to defined pheromones, they uncover two pheromones and their sensory cells for this behavior. Exposure to the male specific pheromone 2MC shortens EHP via female Or47b olfactory neurons, and the contact pheromone 7-T, present males and on mated females, does so via ppk23 expressing gustatory foreleg neurons. Both compounds increase cAMP levels in a specific subset of central brain receptivity circuit neurons, the pC1b,c neurons. By employing an optogenetically controlled adenyl cyclase, the authors show that increased cAMP levels in pC1b,c neurons increase their excitability upon male pheromone exposure, decrease female EHP and increase the remating rate. This provides convincing evidence for the role of pC1b,c neurons in integrating information about the social environment and mediating not only virgin, but also mated female post-copulatory mate choice.

      Understanding context and state-dependent sexual behavior is of fundamental interest. Mate behavior is highly context-dependent. In animals subjected to sperm competition, the complexities of optimal mate choice have attracted a long history of sophisticated modelling in the framework of game theory. These models are in stark contrast to how little we understand so far about the biological and neurophysiological mechanisms of how females implement post-copulatory or so-called "cryptic" mate choice and bias sperm usage when mating multiple times.

      The strength of the paper is decrypting "cryptic" mate choice, i.e. the clear identification of physiological mechanisms and proximal causes for female post-copulatory mate choice. The discovery of peripheral chemosensory nodes and of neurophysiological mechanisms in central circuit nodes will provide a fruitful starting point to fully map the circuits for female receptivity and mate choice during the whole gamut of female life history.

    1. Reviewer #2 (Public Review):

      We appreciate the authors revision of this manuscript and toning down some of the statements regarding "contradictory" results. We still have some concerns about the major claims of this paper which lead us to suggest this paper undergo more revision as follows since, in its present form, we fear this paper is misleading for the field in two areas. here is a brief outline:

      (1) Despite acknowledging that the injections only occurred in the anteromedial aspect of the tubercle, the authors still assert broad conclusions regarding where the tubercle projects and what the tubercle does. for instance, even the abstract states "both D1 and D2 neurons of the OT project primarily to the VP and minimally elsewhere" without mention that this is the "anteromedial OT". Every conclusion needs to specify this is stemming from evidence in just the anteromedial tubercle, as the authors do in some parts of the the discussion.

      (2) The authors now frame the 2P imaging data that D1 neuron activity reflects "increased contrast of identity or an intermediate and multiplexed encoding of valence and identity". I struggle to understand what the authors are actually concluding here. Later in discussion, the authors state that they saw that OT D1 and D2 neurons "encode odor valence" (line 510). We appreciate the authors note that there is "poor standardization" when it comes to defining valence (line 521). We are ok with the authors speculating and think this revision is more forthcoming regarding the results and better caveats the conclusions. I suggest in abstract the authors adjust line 14/15 to conclude that, "While D1 OT neurons showed larger responses to rewarded odors, in line with prior work, we propose this might be interpreted as identity encoding with enhanced contrast." [eliminating "rather than valence encoding" since that is a speculation best reserved for discussion as the authors nicely do.

      The above items stated, one issue comes to mind, and that is, why of all reasons would the authors find that the anteromedial aspect of the tubercle is not greatly reflecting valence. the anteromedial aspect of the tubercle, over all other aspects of the tubercle, is thought my many to more greatly partake in valence and other hedonic-driven behaviors given its dense reception of VTA DAergic fibers (as shown by Ikemoto, Kelsch, Zhang, and others). So this finding is paradoxical in contrast to if the authors would had studied the anterolateral tubercle or posterior lateral tubercle which gets less DA input.

    1. Reviewer #2 (Public Review):

      Summary:

      The study entitled "Different coexistence patterns between apex carnivores and mesocarnivores based on temporal, spatial, and dietary niche partitioning analysis in Qilian Mountain National Park, China" by Cong et al. addresses the compelling topic of carnivores' coexistence in a biodiversity hotspot in China. The study is interesting given it considers all three components affecting sympatric carnivores' distribution and co-occurrence, namely the temporal, the spatial, and the dietary partition within the carnivore guild. The authors have found that spatial co-occurrence is generally low, which represents the major strategy for coexistence, while there is temporal and dietary overlap. I also appreciated the huge sampling effort carried out for this study by the authors: they were able to deploy 280 camera trapping sites (which became 322 in the result section?) and collect a total of 480 scat samples. However, I have some concerns about the study on the non-consideration of the human dimension and potential anthropogenic disturbance that could affect the spatial and temporal distribution of carnivores, the choice of the statistical model to test co-occurrence, and the lack of clearly stated ecological hypotheses.

      Strengths:

      The strengths of the study are the investigation of all three major strategies that can mitigate carnivores' coexistence, therefore, the use of multiple monitoring techniques (both camera trapping and DNA metabarcoding) and the big dataset produced that consists of a very large sampled area with a noteworthy number of camera tap stations and many scat samples for each species.

      Weaknesses:

      I think that some parts of the manuscript should be written better and more clearly. A clear statement of the ecological hypotheses that could affect the partitioning among the carnivore guild is lacking. I think that the human component (thus anthropogenic disturbance) should have been considered more in the spatial analyses given it can influence the use of the environment by some carnivores. Additionally, a multi-species co-occurrence model would have been a more robust approach to test for spatial co-occurrence given it also considers imperfect detection.

      Temporal and dietary results are solid and this latter in particular highlights a big predation pressure on some prey species such as the pika. This implies important conservation and management implications for this species, and therefore for the trophic chain, given that i) the pika population should be conserved and ii) a potential poisoning campaign against small mammals could be incredibly dangerous also for mesocarnivores feeding on them due to secondary poisoning.

    1. Reviewer #2 (Public Review):

      Among ionotropic glutamate receptors, kainate receptors (KAR) are still the object of intense investigation to understand their role in normal and pathological excitatory synaptic transmission. Like other receptors, KAR appear under different splicing variants and their respective physiological function is still debated. In this manuscript, Dhingra et al explored the impact of the presence and of the absence of Exon9 of the GluK1 receptors on the pharmacological, biophysi cal and structural properties of the receptors. They further investigated how it is impacted by the association of KAR with their cognate auxiliary subunit Neto 1 and 2. This study represents a large body of work and data. The authors addressed the issue in a very systematic and rigorous manner.

      First, by exploring RNAseq database, authors showed that GluK1 transcripts containing the exon 9 are present in many brain structures and especially in the cerebellum suggesting that a large part of GluK1 contains effectively this exon9.<br /> Using HEK cells as an expression system, they characterized many gating and biophysical properties of GluK1 receptors containing or not the exon9. Evaluated parameters were desensitization, relative potency of glutamate versus kainate, and polyamine block.

      It is known that the association of GluK1 with auxiliary proteins Neto1/2 modulates the properties of the receptors. Authors investigated systematically whether Neto1 and 2 similarly alter GluK1 properties in function of the presence of exon9. This study provides many quantitative data that could be reused for modeling the role of kainate receptors. Given the change shown by the authors, the presence of exon in GluK1 is noticeable and likely should have an impact of synaptic transmission.<br /> Interestingly, authors used a mutational approach to identify critical residues encoded by exon9 that are responsible for the functional differences between the two splice variants. In many cases, the replacement of a single amino acid leads to the absence of current confirming the crucial role of the segment of the receptor. However, it made the comparison and the identification of critical residues more challenging.

      Authors attempted to establish the structure GluK1 receptors comprising the exon9 using different preparation methods. They succeeded in obtaining structures with equivalent or lower resolution compared with previous reports on GluK1 and GluK2 receptors. However, the organization of the peptide coded by exon is poorly defined and limited possible analyses. Despite this, they could observe that the presence of the exon9 does not alter significantly the structure of GluK1.

    1. Reviewer #2 (Public Review):

      Summary:

      Multi-copy gene systems are expected to evolve slower than single-copy gene systems because it takes longer for genetic variants to fix in the large number of gene copies in the entire population. Paradoxically, their evolution is often observed to be surprisingly fast. To explain this paradox, the authors hypothesize that the rapid evolution of multi-copy gene systems arises from stronger genetic drift driven by homogenizing forces within individuals, such as gene conversion, unequal crossover, and replication slippage. They formulate this idea by combining the advantages of two classic population genetic models -- adding the V(k) term (which is the variance in reproductive success) in the Haldane model to the Wright-Fisher model. Using this model, the authors derived the strength of genetic drift (i.e., reciprocal of the effective population size, Ne) for the multi-copy gene system and compared it to that of the single-copy system. The theory was then applied to empirical genetic polymorphism and divergence data in rodents and great apes, relying on comparison between rRNA genes and genome-wide patterns (which mostly are single-copy genes). Based on this analysis, the authors concluded that neutral genetic drift could explain the rRNA diversity and evolution patterns in mice but not in humans and chimpanzees, pointing to a positive selection of rRNA variants in great apes.

      Strengths:

      Overall, the new WFH model is an interesting idea. It is intuitive, efficient, and versatile in various scenarios, including the multi-copy gene system and other cases discussed in the companion paper by Ruan et al.

      Weaknesses:

      Despite being intuitive at a high level, the model is a little unclear, as several terms in the main text were not clearly defined and connections between model parameters and biological mechanisms are missing. Most importantly, the data analysis of rRNA genes is extremely over-simplified and does not adequately consider biological and technical factors that are not discussed in the model. Even if these factors are ignored, the authors' interpretation of several observations is unconvincing, as alternative scenarios can lead to similar patterns. Consequently, the conclusions regarding rRNA genes are poorly supported. Overall, I think this paper shines more in the model than the data analysis, and the modeling part would be better presented as a section of the companion theory paper rather than a stand-alone paper. My specific concerns are outlined below.

      (1) Unclear definition of terms

      Many of the terms in the model or the main text were not clearly defined the first time they occurred, which hindered understanding of the model and observations reported. To name a few:

      (i) In Eq(1), although C* is defined as the "effective copy number", it is unclear what it means in an empirical sense. For example, Ne could be interpreted as "an ideal WF population with this size would have the same level of genetic diversity as the population of interest" or "the reciprocal of strength of allele frequency change in a unit of time". A few factors were provided that could affect C*, but specifically, how do these factors impact C*? For example, does increased replication slippage increase or decrease C*? How about gene conversion or unequal cross-over? If we don't even have a qualitative understanding of how these processes influence C*, it is very hard to make interpretations based on inferred C*. How to interpret the claim on lines 240-241 (If the homogenization is powerful enough, rRNA genes would have C*<1)? Please also clarify what C* would be, in a single-copy gene system in diploid species.

      (ii) In Eq(1), what exactly is V*(K)? Variance in reproductive success across all gene copies in the population? What factors affect V*(K)? For the same population, what is the possible range of V*(K)/V(K)? Is it somewhat bounded because of biological constraints? Are V*(K) and C*(K) independent parameters, or does one affect the other, or are both affected by an overlapping set of factors?

      (iii) In the multi-copy gene system, how is fixation defined? A variant found at the same position in all copies of the rRNA genes in the entire population?

      (iv) Lines 199-201, HI, Hs, and HT are not defined in the context of a multi-copy gene system. What are the empirical estimators?

      (v) Line 392-393, f and g are not clearly defined. What does "the proportion of AT-to-GC conversion" mean? What are the numerator and denominator of the fraction, respectively?

      (2) Technical concerns with rRNA gene data quality

      Given the highly repetitive nature and rapid evolution of rRNA genes, myriads of things could go wrong with read alignment and variant calling, raising great concerns regarding the data quality. The data source and methods used for calling variants were insufficiently described at places, further exacerbating the concern.

      (i) What are the accession numbers or sample IDs of the high-coverage WGS data of humans, chimpanzees, and gorillas from NCBI? How many individuals are in each species? These details are necessary to ensure reproducibility and correct interpretation of the results.

      (ii) Sequencing reads from great apes and mice were mapped against the human and mouse rDNA reference sequences, respectively (lines 485-486). Given the rapid evolution of rRNA genes, even individuals within the same species differ in copy number and sequences of these genes. Alignment to a single reference genome would likely lead to incorrect and even failed alignment for some reads, resulting in genotyping errors. Differences in rDNA sequence, copy number, and structure are even greater between species, potentially leading to higher error rates in the called variants. Yet the authors provided no justification for the practice of aligning reads from multiple species to a single reference genome nor evidence that misalignment and incorrect variant calling are not major concerns for the downstream analysis.

      (vi) It is unclear how variant frequency within an individual was defined conceptually or computed from data (lines 499-501). The population-level variant frequency was calculated by averaging across individuals, but why was the averaging not weighted by the copy number of rRNA genes each individual carries? How many individuals are sampled for each species? Are the sample sizes sufficient to provide an accurate estimate of population frequencies?

      (vii) Fixed variants are operationally defined as those with a frequency>0.8 in one species. What is the justification for this choice of threshold? Without knowing the exact sample size of the various species, it's difficult to assess whether this threshold is appropriate.

      (viii) It is not explained exactly how FIS, FST, and divergence levels of rRNA genes were calculated from variant frequency at individual and species levels. Formulae need to be provided to explain the computation.

      (3) Complete ignorance of the difference in mutation rate difference between rRNA genes and genome-wide average

      Nearly all data analysis in this paper relied on comparison between rRNA genes with the rest (presumably single-copy part) of the genome. However, mutation rate, a key parameter determining the diversity and divergence levels, was completely ignored in the comparison. It is well known that mutation rate differs tremendously along the genome, with both fine and large-scale variation. If the mutation rate of rRNA genes differs substantially from the genome average, it would invalidate almost all of the analysis results. Yet no discussion or justification was provided.

      Related to mutation rate: given the hypermutability of CpG sites, it is surprising that the evolution/fixation rate of rRNA estimated with or without CpG sites is so close (2.24% vs 2.27%). Given the 10 - 20-fold higher mutation rate at CpG sites in the human genome, and 2% CpG density (which is probably an under-estimate for rDNA), we expect the former to be at least 20% higher than the latter.

      Among the weaknesses above, concern (1) can be addressed with clarification, but concerns (2) and (3) invalidate almost all findings from the data analysis and cannot be easily alleviated with a complete revamp work.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript elucidated the cryo-electron microscopic structure of a PSI supercomplex incorporating fucoxanthin chlorophyll a/c-binding proteins (FCPs), designated as PSI-FCPI, isolated from the diatom Thalassiosira pseudonana CCMP1335. Combining structural, sequence, and phylogenetic analyses, the authors provided solid evidence to reveal the evolutionary conservation of protein motifs crucial for the selective binding of individual FCPI subunits and provided valuable information about the molecular mechanisms governing the assembly and selective binding of FCPIs in diatoms.

      Strengths:

      The manuscript is well-written and presented clearly as well as consistently. The supplemental figures are also of high quality.

      Weaknesses:

      Only minor comments (provided in recommendations for authors) to help improve the manuscript.

    1. Reviewer #2 (Public Review):

      Summary:

      Here, the authors studied the molecular mechanisms by which the chemoreceptor cluster and flagella motor of Pseudomonas aeruginosa (PA) are spatially organized in the cell. They argue that FlhF is involved in localizing the receptors-motor to the cell pole, and even without FlhF, the two are colocalized. FlhF is known to cause the motor to localize to the pole in a different bacterial species, Vibrio cholera, but it is not involved in receptor localization in that bacterium. Finally, the authors argue that the functional reason for this colocalization is to insulate chemotactic signaling from other signaling pathways, such as cyclic-di-GMP signaling.

      Strengths:

      The experiments and data look to be high-quality.

      Weaknesses:

      However, the interpretations and conclusions drawn from the experimental observations are not fully justified in my opinion.

      I see two main issues with the evidence provided for the authors' claims.

      (1) Assumptions about receptor localization:

      The authors rely on YFP-tagged CheY to identify the location of the receptor cluster, but CheY is a diffusible cytoplasmic protein. In E. coli, CheY has been shown to localize at the receptor cluster, but the evidence for this in PA is less strong. The authors refer to a paper by Guvener et al 2006, which showed that CheY localizes to a cell pole, and CheA (a receptor cluster protein) also localizes to a pole, but my understanding is that colocalization of CheY and CheA was not shown. My concern is that CheY could instead localize to the motor in PA, say by binding FliM. This "null model" would explain the authors' observations, without colocalization of the receptors and motor.

      Verifying that CheY and CheA are colocalized in PA would be a very helpful experiment to address this weakness.

      (2) Argument for the functional importance of receptor-motor colocalization at the pole:

      The authors argue that colocalization of the receptors and motors at the pole is important because it could keep phosphorylated CheY, CheY-p, restricted to a small region of the cell, preventing crosstalk with other signaling pathways. Their evidence for this is that overexpressing CheY leads to higher intracellular cdG levels and cell aggregation.

      Say that the receptors and motors are colocalized at the pole. In E. coli, CheY-p rapidly diffuses through the cell. What would prevent this from occurring in PA, even with colocalization?

      Elevating CheY concentration may increase the concentration of CheY-p in the cell, but might also stress the cells in other unexpected ways. It is not so clear from this experiment that elevated CheY-p throughout the cell is the reason that they aggregate, or that this outcome is avoided by colocalizing the receptors and motor at the same pole.

      If localization of the receptor array and motor at one pole were important for keeping CheY-p levels low at the opposite pole, then we should expect cells in which the receptors and motor are not at the pole to have higher CheY-p at the opposite pole. According to the authors' argument, it seems like this should cause elevated cdG levels and aggregation in the delta flhF mutants with wild-type levels of CheY. But it does not look like this happened.

      Instead of varying CheY expression, the authors could test their hypothesis that receptor-motor colocalization at the pole is important for preventing crosstalk by measuring cdG levels in the flhF mutant, in which the motor (and maybe the receptor cluster) are no longer localized in the cell pole.

    1. Reviewer #2 (Public Review):

      Summary:<br /> A strong case is presented to establish that the endoplasmic reticulum carbohydrate binding protein malectin is an important factor for coronavirus propagation. Malectin was identified as a coronavirus nsp2 protein interactor using quantitative proteomics and its importance in the viral life cycle was supported by using a functional genetic screen and viral assays. Malectin binds diglucosylated proteins, an early glycoform thought to transiently exist on nascent chains shortly after translation and translocation; yet a role for malectin has previously been proposed in later quality control decisions and degradation targeting. These two observations have been difficult to reconcile temporally. In agreement with results from the Locher lab, the malectin-interactome shown here includes a number of subunits of the oligosaccharyltransferase complex (OST). These results place malectin in close proximity to both the co-translational (STT3A or OST-A) and post-translational (STT3B or OST-B) complexes. It follows that malectin knockdown was associated with coronavirus Spike protein hypoglycosylation.

      Strengths:<br /> Strengths include using multiple viruses to identify interactors of nsp2 and quantitative proteomics along with multiple viral assays to monitor the viral life cycle.

      Weaknesses:<br /> Malectin knockdown was shown to be associated with Spike protein hypoglycosylation. This was further supported by malectin interactions with the OSTs. However, no specific role of malectin in glycosylation was discussed or proposed.

      Given the likelihood that malectin plays a role in the glycosylation of heavily glycosylated proteins like Spike, it is unfortunate that only 5 glycosites on Spike were identified using the MS deamidation assay when Spike has a large number of glycans (~22 sites). The mass spec data set would also include endogenous proteins. Were any heavily glycosylated endogenous proteins hypoglycosylated in the MS analysis in Fig 5D?

      The inclusion of the nsp4 interactome and its partial characterization is a distraction from the storyline that focuses on malectin and nsp2.

    1. Reviewer #2 (Public Review):

      The study by Chen, Deng et al. aims to develop an efficient viral transneuronal tracing method that allows efficient retrograde tracing in the larval zebrafish. The authors utilize pseudotyped-rabies virus that can be targeted to specific cell types using the EnvA-TvA systems. Pseudotyped rabies virus has been used extensively in rodent models and, in recent years, has begun to be developed for use in adult zebrafish. However, compared to rodents, the efficiency of the spread in adult zebrafish is very low (~one upstream neuron labeled per starter cell). Additionally, there is limited evidence of retrograde tracing with pseudotyped rabies in the larval stage, which is the stage when most functional neural imaging studies are done in the field. In this study, the authors systematically optimized several parameters of rabies tracing, including different rabies virus strains, glycoprotein types, temperatures, expression construct designs, and elimination of glial labeling. The optimal configurations developed by the authors are up to 5-10 fold higher than more typically used configurations.

      The results are solid and support the conclusions. However, the methods should be described in more detail to allow other zebrafish researchers to apply this method in their own work.

      Additionally, some findings are presented anecdotally, i.e., without quantification or sufficient detail to allow close examinations. Lastly, there is concern that the reagents created by the authors will not be easily accessible to the zebrafish community.

      (1) The titer used in each experiment was not stated. In the methods section, it is stated that aliquots are stored at 2x10e8. Is it diluted for injection? Are all of the experiments in the manuscripts with the same titer?

      2) The age for injection is quite broad (3-5 dpf in Fig 1 and 4-6 dpf in Fig 2). Given that viral spread efficiency is usually more robust in younger animals, describing the exact injection age for each experiment is critical.

      (3) More details should be provided for the paired electrical stimulation-calcium imaging study. How many GC cells were tested? How many had corresponding PC cell responses? What is the response latency? For example, images of stimulated and recorded GCs and PCs should be shown.

      (4) It is unclear how connectivity between specific PC and GC is determined for single neuron connectivity. In other images (Figure 4C), there are usually multiple starter cells and many GCs. It was not shown that the image resolution can establish clear axon-dendritic contacts between cell pairs.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors of this manuscript aim to develop a novel animal model to accurately simulate the retinal ischemic process in retinal artery occlusion (RAO). A unilateral pterygopalatine ophthalmic artery occlusion (UPOAO) mouse model was established using silicone wire embolization combined with carotid artery ligation. This manuscript provided data to show the changes of major classes of retinal neural cells and visual dysfunction following various durations of ischemia (30 minutes and 60 minutes) and reperfusion (3 days and 7 days) after UPOAO. Additionally, transcriptomics was utilized to investigate the transcriptional changes and elucidate changes in the pathophysiological process in the UPOAO model post-ischemia and reperfusion. Furthermore, the authors compared transcriptomic differences between the UPOAO model and other retinal ischemic-reperfusion models, including HIOP and UCCAO, and revealed unique pathological processes.

      Strengths:

      The UPOAO model represents a novel approach for studying retinal artery occlusion. The study is very comprehensive.

      Weaknesses:

      Originally, some statements were incorrect and confusing. However, the authors have made clarifications in the revised manuscript to avoid confusion.

    1. Reviewer #2 (Public Review):

      Summary:

      In their work, the Authors study local mechanics in an invaginating epithelial tissue. The work, which is mostly computational, relies on the Cellular Potts model. The main result shows that an increased apical "contractility" is not sufficient to properly drive apical constriction and subsequent tissue invagination. The Authors propose an alternative model, where they consider an alternative driver, namely the "apical surface elasticity".

      Strengths:

      It is surprising that despite the fact that apical constriction and tissue invagination are probably most studied processes in tissue morphogenesis, the underlying physical mechanisms are still not entirely understood. This work supports this notion by showing that simply increasing apical tension is perhaps not sufficient to locally constrict and invaginate a tissue.

      Weaknesses:

      Although the Authors have improved and clarified certain aspects of their results as suggested by the Reviewers, the presentation still mostly relies on showing simulation snapshots. Snapshots can be useful, but when there are too many, the results are hard to read. The manuscript would benefit from more quantitative plots like phase diagrams etc.

    1. Reviewer #2 (Public Review):

      This paper describes the results of a set of complementary and convergent experiments aimed at describing roles for the non-selective cation channels NALCN and TRPC6 in mediating subthreshold inward depolarizing currents and action potential generation in VTA DA neurons under normal physiological conditions. In general, the authors have responded satisfactorily to reviewer comments, and the revised manuscript is improved.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper investigates the neural underpinnings of an interactive speech task requiring verbal coordination with another speaker. To achieve this, the authors recorded intracranial brain activity from the left hemisphere in a group of drug-resistant epilepsy patients while they synchronised their speech with a 'virtual partner'. Crucially, the authors were able to manipulate the degree of success of this synchronisation by programming the virtual partner to either actively synchronise or desynchronise their speech with the participant, or else to not vary its speech in response to the participant (making the synchronisation task purely one-way). Using such a paradigm, the authors identified different brain regions that were either more sensitive to the speech of the virtual partner (primary auditory cortex), or more sensitive to the degree of verbal coordination (i.e. synchronisation success) with the virtual partner (secondary auditory cortex and IFG). Such sensitivity was measured by (1) calculating the correlation between the index of verbal coordination and mean power within a range of frequency bands across trials, and (2) calculating the phase-amplitude coupling between the behavioural and brain signals within single trials (using the power of high-frequency neural activity only). Overall, the findings help to elucidate some of the left hemisphere brain areas involved in interactive speaking behaviours, particularly highlighting the high-frequency activity of the IFG as a potential candidate supporting verbal coordination.

      Strengths:

      This study provides the field with a convincing demonstration of how to investigate speaking behaviours in more complex situations that share many features with real-world speaking contexts e.g. simultaneous engagement of speech perception and production processes, the presence of an interlocutor, and the need for inter-speaker coordination. The findings thus go beyond previous work that has typically studied solo speech production in isolation, and represent a significant advance in our understanding of speech as a social and communicative behaviour. It is further an impressive feat to develop a paradigm in which the degree of cooperativity of the synchronisation partner can be so tightly controlled; in this way, this study combines the benefits of using pre-recorded stimuli (namely, the high degree of experimental control) with the benefits of using a live synchronisation partner (allowing the task to be truly two-way interactive, an important criticism of other work using pre-recorded stimuli). A further key strength of the study lies in its employment of stereotactic EEG to measure brain responses with both high temporal and spatial resolution, an ideal method for studying the unfolding relationship between neural processing and this dynamic coordination behaviour.

      Weaknesses:

      One major limitation of the current study is the lack of coverage of the right hemisphere by the implanted electrodes. Of course, electrode location is solely clinically motivated, and so the authors did not have control over this. However, this means that the current study neglects the potentially important role of the right hemisphere in this task. The right hemisphere has previously been proposed to support feedback control for speech (likely a core process engaged by synchronous speech), as opposed to the left hemisphere which has been argued to underlie feedforward control (Tourville & Guenther, 2011). Indeed, a previous fMRI study of synchronous speech reported the engagement of a network of right hemisphere regions, including STG, IPL, IFG, and the temporal pole (Jasmin et al., 2016). Further, the release from speech-induced suppression during a synchronous speech reported by Jasmin et al. was found in the right temporal pole, which may explain the discrepancy with the current finding of reduced leftward high-frequency activity with increasing verbal coordination (suggesting instead increased speech-induced suppression for successful synchronisation). The findings should therefore be interpreted with the caveat that they are limited to the left hemisphere, and are thus likely missing an important aspect of the neural processing underpinning verbal coordination behaviour.

      A further limitation of this study is that its findings are purely correlational in nature; that is, the results tell us how neural activity correlates with behaviour, but not whether it is instrumental in that behaviour. Elucidating the latter would require some form of intervention such as electrode stimulation, to disrupt activity in a brain area and measure the resulting effect on behaviour. Any claims therefore as to the specific role of brain areas in verbal coordination (e.g. the role of the IFG in supporting online coordinative adjustments to achieve synchronisation) are therefore speculative.

    1. Reviewer #2 (Public Review):

      Summary:

      Neurons in motor-related areas have increasingly been shown to carry also other, non-motoric signals. This creates a problem of avoidance of interference between the motor and non-motor-related signals. This is a significant problem that likely affects many brain areas. The specific example studied here is interference between saccade-related activity and slow-changing arousal signals in the superior colliculus. The authors identify neuronal activity related to saccades and arousal. Identifying saccade-related activity is straightforward, but arousal-related activity is harder to identify. The authors first identify a potential neuronal correlate of arousal using PCA to identify a component in the population activity corresponding to slow drift over the recording session. Next, they link this component to arousal by showing that the component is present across different brain areas (SC and PFC), and that it is correlated with pupil size, an external marker of arousal. Having identified an arousal-related component in SC, the authors show next that SC neurons with strong motor-related activity are less strongly affected by this arousal component (both SC and PFC). Lastly, they show that SC population activity patterns related to saccades and pupil size form orthogonal subspaces in the SC population.

      Strengths:

      A great strength of this research is the clear description of the problem, its relationship with the performed analysis, and the interpretation of the results. the paper is very well written and easy to follow.

      An additional strength is the use of fairly sophisticated analysis using population activity.

      Weaknesses:

      (1) The greatest weakness in the present research is the fact that arousal is a functionally less important non-motoric variable. The authors themselves introduce the problem with a discussion of attention, which is without any doubt the most important cognitive process that needs to be functionally isolated from oculomotor processes. Given this introduction, one cannot help but wonder, why the authors did not design an experiment, in which spatial attention and oculomotor control are differentiated. Absent such an experiment, the authors should spend more time explaining the importance of arousal and how it could interfere with oculomotor behavior.

      (2) In this context, it is particularly puzzling that one actually would expect effects of arousal on oculomotor behavior. Specifically, saccade reaction time, accuracy, and speed could be influenced by arousal. The authors should include an analysis of such effects. They should also discuss the absence or presence of such effects and how they affect their other results.

      (3) The authors use the analysis shown in Figure 6D to argue that across recording sessions the activity components capturing variance in pupil size and saccade tuning are uncorrelated. however, the distribution (green) seems to be non-uniform with a peak at very low and very high correlation specifically. The authors should test if such an interpretation is correct. If yes, where are the low and high correlations respectively? Are there potentially two functional areas in SC?

    1. Reviewer #2 (Public Review):

      Summary:

      Goal of the study. The authors tried to pinpoint the origins of transient and sustained responses measured at retinal ganglion cells (rgcs), which is the output layer of the retina. Response characteristics of rgcs are used to group them into different types. The diversity of rgc types represents the ability of the retina to transform visual inputs into distinct output channels. They find that the physical dimensions of bipolar cell's synaptic ribbons (specialized release sites/active zones) vary across the different types of cone on-bpcs, in ways that they argue could facilitate transient or sustained release. This diversity of release output is what they argue underlies the differences in on-rgcs response characteristics, and ultimately represents a mechanism for creating parallel cone-driven channels.

      Strengths:

      The major strengths of the study are the anatomical approaches employed and the use of the "glutamate sniffer" to assay synaptic glutamate levels. The outline of the study is elegant and reflects the strengths of the authors.

      Weaknesses:

      The major weakness is that the ambitious outline is not matched with a complete set of results, and the set of physiological protocols is disjointed, not sufficient to bridge the systems-level question with the presynaptic release question.

      Major comments on the results and suggestions.

      The ribbon model of release has been explored for decades and needs to be further adapted to systems-level work. The study under consideration by Kuo et al. takes on this task. Unfortunately, the experimental design does not permit a level of control over presynaptic/bpc behavior that is comparable to earlier studies, nor do they manipulate release in ways that test the ribbon model (i.e., paired recordings or Ribeye-ko). Furthermore, the data needs additional evaluation, and the presentation and interpretations should draw on published biophysical and molecular studies.

      To build a ribbon-centric context, consider recent literature that supports the assertion that ribbons play a role in forming AZ release sites and facilitating exocytosis. Reference Ribeye-ko studies. For example, ribbonless bpcs show an 80% reduction in release (Maxeiner et al EMBO J 2016), the ribbonless retina exhibits signaling deficits at the output layer (Okawa et al ...Rieke, ..Wong Nat Comm 2019), and ribbonless rods show an 80% reduction the readily releasable pool (RRP) of SVs (Grabner Moser, elife 2021). In addition, the authors could refer to whole-cell membrane capacitance studies on mammalian rods, cones, and bpcs, because the size of the RRP of SVs scales with the dimensions and numbers of ribbons (total ribbon footprint). For comparison, bipolars see the review by Wan and Heidelberger 2011. For a comparison of mammalian rods and cones, see, rods: Grabner and Moser (2021 eLife), Mueller.. Regus Leidig et al. (2019; J Neurosci) and cones Grabner ...DeVries (Nat Comm 2023). A comparison of cell types shows that the extent of release is (1) proportional to the total size of the ribbon footprint, and (2) less release is witnessed when ribbons are deleted (also see photo ablation studies by Snellman.... And Mehta..Zenisek, Nat Neurosci and Neuron).

      Ribbon morphology may change in an activity-dependent manner. The rod ribbon AZ has been reported to lengthen in the dark (Dembla et al 2020), and deletion of the ribbon shortens the length of the AZ (defined by Cav1,4 or RIM2); in addition, the Ribeye-ko AZs fail to change in size with light and dark conditioning. Furthermore, EM studies on rod and cone AZs in light and dark argue that the number of SVs at the base of the ribbon increases in the dark, when PRs are depolarized (see Figure 10, Babai et al 2016 JNeurosci). Lastly, using goldfish Mb1 on-bipolars, Hull et al (2006, J Neurophysio) correlated an increase in release efficiency with an increase in ribbon numbers, which accompanied daylight. >> When release activity is high, ribbon AZ length increases (Dembla, rods), the number of docked SVs increases (Babai, rods cones), and the number of ribbons increases (Hull, diurnal Mb1s).

      The results under review, Kuo et al., were attained with SBF-SEM, which has the benefit of addressing large-volume questions as required here, yet it achieves lower spatial resolution than what is attained with TEM tomography and FIB-EM. Ideally, the EM description would include SV size, and the density of ribbon-tethered SVs that are docked at the plasma membrane, because this is where the SVs fuse (additional non-ribbon release sites may also exist? Mehta ... Singer 2014 J Neurosci). Studies by Graydon et al 2011 and 2014 (both in J Neurosci), and Jean ... Moser et al 2018 (eLife) are good examples of quantitative estimates of SVs docking sites at ribbons. SBF-SEM does not allow for an assessment of SVs within 5 nm of the PM, but if the authors can identify the number of SVs that appear within the limit of resolution (10 to 15 nm) from the PM, then this data would be useful. Also, what dimension(s) of the large ribbons make them larger? Typically, ribbons are fixed in height (at least in the outer retina, 200 to 250 nm), but their length varies and the number ribbons per terminal varies. Is the larger ribbon size observed in type 6 bpcs do to longer ribbons, or taller ribbons? A longer ribbon likely has more docked SVs. An additional possibility is that more SVs are about the ribbon-PM footprint, either more densely packed and/or expanding laterally (see definitions in Jean....Moser, elife 2018).

      The ribbon literature given above makes the argument that ribbons increase exocytotic output, and morphological studies suggest that release activity enhances 1) ribbon length (Dembla) and 2) the density of SVs near the PM (Babai). These findings could lead one to propose that type 6 bpcs (inputs to On-sustained) are more active than type 5i (feed into On-transient). Here Kuo et al. show that the bpcs have similar Vm (measured from the soma) in response to light stimulation. Does Vm predict release? Not entirely as the authors acknowledge, because: Cav channel properties, SV availability, and negative feedback are all downstream of bpc Vm. The only experiment performed to test downstream factors focused on negative feedback from amacrines. The data presented in Figures 5C-F led me to conclude the opposite of what the authors concluded. My impression is that the T-ON rgc exhibits strong disinhibition when GABA-blockers are applied (the initial phase is greatly increased in amplitude and broadened with the drug), which contrasts with the S-On rgc responses that show a change in the amplitude of the initial phase but not its width (taus would be nice). Here and in many places the authors refer to changes in release kinetics, without implementing a useful description of kinetics. For instance, take the cumulative current (charge) in Figure 5C and fit the control and drug traces to arrive at taus, and their respective amplitudes, and use these values to describe kinetic phases. One final point, the summary in Figure 5D has a p: 0.06, very close to the cutoff for significance, which begs for more than an n = 5. Given that previous studies have shown that bpc output is shaped by immediate msec GABA feedback, in ways that influence kinetic phases of release (..Mb1 bipolars, see Vigh et al 2005 Neuron), more attention to this matter is needed before the authors rule out feedback inhibition in favor of ribbon size. If by chance, type 5i bpcs are under uniquely strong feedback inhibition, then ribbon size may result from less activity, not less output resulting from smaller ribbons.

      As mentioned above, the behavior of Cav channels is important here. This is difficult to address with voltage clamps from the soma, especially in the Vm range relevant to this study. Given that it has previously been modeled that the rod bpc to AII pathway adapts to prolonged depolarization of rbcs through downregulating Cav channel-mediated Ca2+ influx (Grimes ....Rieke 2014 Neuron), it seems important for Kou et al to test if there is a difference in Cav regulation between type 6 and 5i bpcs. Ca2+ imaging with a GCaMP strategy (Baden....Lagnado Current Biology, 2011) or filling the presynapse with Ca dyes (see inner hair cells: Ozcete and Moser, EMBO J 2020) would allow for the correlation of [Ca]intra with GluSnf signals (both local readouts).

      Stimulation protocol and presentation of Glutamate Sniffer data in Figure 6. In all of your figures where you state steady st as a % of pk amplitude, please indicate in the figure where you estimate steady state. Alternatively, if you take the cumulative dF/F signal, then you can fit the different kinetic phases. From the appearance of the data, the Sustained Glu signals look like square waves (Figure 6B ROI1-4), without a transient at onset, which is not predicted in your ribbon model that assumes different kinetic phases (1. depletion of docked SVs, and 2. refilling and repriming). The Transient responses (Figure 6B ROI5-8) are transient and more compatible with a depressing ribbon scheme. If you take the cumulative, for all of the On-S and compare it to all of the On-T responses, my guess is the cumulative dF/F will be 10 to 20 larger for the S-On. Would you conclude that bpc inputs to On-S (type 6) release 20-fold more SVs per 4 seconds on a per ribbon basis, and does the surface area of the type 6 bpcs account for this difference? From Figures 8B and D, the volume of the ribbon is ~2 fold greater for type 6 vs 5i, but the Surface Area (both faces of ribbon) is more relevant to your model that claims ribbon size is the pivotal factor. If making cumulative traces, and comparisons on an absolute scale is unfounded, then we need to know how to compare different observations. The classic ribbon models always have a conversion factor such as the capacitance of an SV or q size that is used to derive SV numbers from total dCm or Qcontent. See Kim ....et al von Gersdorff, 2023, Cell Reports. Why not use the Gaussian noise stimulus in Fig 6 as in Figure 1 and 2?

      Figure 7. What is the recovery time for mammalian cones derived from ribbon-based models? There are estimates from membrane capacitance studies. Ground squirrel cones take 0.7 to 1 sec to recover the ultrafast, primed pool of SVs when probed with a paired-pulse protocol (Grabner ...DeVries 2016, Neuron). Their off-bpcs take anywhere from under 0.2 sec to a second to recover, which is a combination of many synaptic factors (Grabner ...DeVries Nat Comm 2023). Rod On bpcs take over a second (Singer Diamond 2006, reviewed Wan and Heidelberger 2011). In Figure 7B, the recovery time is ~150 ms for the responses measured at rgcs. This brief recovery time is incompatible with existing ribbon models of release. Whole-cell membrane capacitance measurements would be helpful here.

      Experimental Suggestion: Add GABA blockers and see if type 5i bpc responds with more release (GluSniff) and prolonged [Ca2+] intra (GCaMP). Compare this to type 6 bpc behavior with GABA/gly blockers. This will rule in or out whether feedback inhibition is involved.

    1. Reviewer #2 (Public Review):

      Summary:

      This study utilized EEG-alpha activity and saccade bias to quantify the spatial allocation of attention during a working memory task. The findings indicate a second stage of internal attentional deployment following the appearance of a memory test, revealing distinct patterns between expected and unexpected test trials. The spatial bias observed during the expected test suggests a memory verification process, whereas the prolonged spatial bias during the unexpected test suggests a re-orienting response to the memory test. This work offers novel insights into the dynamics of attentional deployment, particularly in terms of orienting and re-orienting following both the cue and memory test.

      Strengths:

      The inclusion of both EEG-alpha activity and saccade bias yields consistent results in quantifying the attentional orienting and re-orienting processes. The data clearly delineate the dynamics of spatial attentional shifts in working memory. The findings of a second stage of attentional re-orienting may enhance our understanding of how memorized information is retrieved.

      Weaknesses:

      Although analyses of neural signatures and saccade bias provided clear evidence regarding the dynamics of spatial attention, the link between these signatures and behavioral performance remains unclear. Given the novelty of this study in proposing a second stage of 'verification' of memory contents, it would be more informative to present evidence demonstrating how this verification process enhances memory performance.

    1. Reviewer #2 (Public Review):

      The authors investigate the role of near-infrared photosynthesis in primary production across three beachrock communities. This work is particularly pertinent as more cyanobacteria with far-red light acclimation capacities are discovered, underscoring the need to assess their contributions to primary production. However, the manuscript is currently very difficult to follow due to unclear correlations between the text and figures and the samples analyzed in the different experiments.. Additional explanations would also enhance clarity. For example, it would be beneficial for the authors to better define the three communities, as distinctions are not apparent. Another example is the pigment analysis, where the extinction coefficients for pigments vary in different solvents. Quantification by chromatography should use calibration curves for all pigments, not just Chl a, as is currently done. Pigments can be easily purified from cyanobacteria for this purpose.

    1. Reviewer #2 (Public Review):

      Summary:

      Morucci et al. tested the influence of linguistic prosody long-term priors in forming predictions about simple acoustic rhythmic tone sequences composed of alternating tone duration, by violating context-dependent short-term priors formed during sequence listening. Spanish and Basque participants were selected due to the different rhythmic prosody of the two languages (functor-initial vs. Functor final, respectively), despite a common cultural background. The authors found that neuromagnetic responses to casual tone omissions reflected the linguistic prosody pattern of the participant's dominant language: in Spanish speakers, omission responses were larger to short tones, whereas in Basque speakers, omission responses were larger to long tones. Source localization of these responses revealed this interaction pattern in the left auditory cortex, which the authors interpret as reflecting a perceptual bias due to acoustic cues (inherent linguistic rhythms, rather than linguistic content). Importantly, this pattern was not found when the rhythmic sequence entailed pitch, rather than duration, cues. To my knowledge, this is the first study providing neural signatures of a known behavioral effect linking ambiguous rhythmic tone sequence perceptual organization to linguistic experience.

      The conclusions of the study are well supported by the data. The hypotheses, albeit allowing alternative perspectives, are well justified according to the existing literature. Albeit with inconclusive results, additional analyses to test entrained oscillatory activity to the perceived rhythms have been performed, which adds explanatory power to the study.

      Strengths:

      (1) The choice of participants. The bilingual population of the Basque country is perfect for performing studies which need to control for cultural and socio-economic background while having profound linguistic differences. In this sense, having dominant Basque speakers as a sample equates that in Molnar et al. (2016), and thus overcomes the lack of direct behavioral evidence for a difference in rhythmic grouping across linguistic groups. Molnar et al. (2016)'s evidence on the behavioral effect is compelling, and the evidence on neural signatures provided by the present study aligns with it.

      (2) The experimental paradigm. It is a well designed acoustic sequence, which considers aspects such as gap length insertion, to be able to analyze omission responses free from subsequent stimulus-driven responses, and which includes a control sequence which uses pitch instead of duration as a cue to rhythmic grouping, which provides a stronger case for the differences found between groups to be due to prosodic duration cues.

      (3) Data analyses. Sound, state-of-the-art methodology in the event-related field analyses at the sensor and source levels.

      Weaknesses:

      (1) The main conclusion of the study reflects a known behavioral effect on rhythmic sequence perceptual organization driven by linguistic background (Molnar et al. 2016, particularly) and, thus, the novelty of the findings is restricted to neural activity evidence.

      (2) Although the paradigm is well designed, there are alternative views in formulating the hypotheses. For instance, one could argue that, according to predictive coding views, omission responses should be larger when the gap occurs at the end of the pattern, as that would be where stronger expectations are placed. However, the authors provide good justification based on previous literature for the expectation of larger omission responses at the downbeat of a rhythmic pattern.

    1. Reviewer #2 (Public Review):

      Summary:

      The phytopathogenic bacterium Pseudomonas syringae is comprised of many pathovars with different host plant species and has been used as a model organism to study bacterial pathogenesis in plants. Transcriptional regulation is key to plant infection and adaptation to host environments by this bacterium. However, researches have focused on limited number of transcription factors (TFs) that regulate virulence-related pathways. Thus, a comprehensive, systems-level understanding of regulatory interactions between transcription factors in P. syringae has not been achieved.

      This study by Sun et al performed ChIP-seq analysis of 170 out of 301 TFs in P. syringae pv. syringae 1448A and used this unique dataset to infer transcriptional regulatory networks in this bacterium. The network analyses revealed hierarchical interactions between TFs, various network motifs, and co-regulation of target genes by TF pairs, which collectively mediate information flow. As discussed, the structure and properties of the P. syringae transcriptional regulatory networks are somewhat different from those identified in humans, yeast, and E. coli, highlighting the significance of this study. Further, the authors made use of the P. syringae transcriptional regulatory networks to find TFs of unknown functions to be involved in virulence-related pathways. For some of these TFs, their target specificity and biological functions, such as motility and biofilm formation, were experimentally validated. Of particular interest is the finding that despite conservation of TFs between P. syringae pv. syringae 1448A, P. syringae pv. tomato DC3000, P. syringae pv. syringae B728a, and P. syringae pv. actinidiae C48, some of the conserved TFs show different repertoires of target genes in these four P. syringae strains.

      Strengths:

      This study presents a systems-level analysis of transcriptional regulatory networks in relation to P. syringae virulence and metabolism, highlights differences in transcriptional regulatory landscapes of conserved TFs between different P. syringae strains, and develops a user-friendly database for mining the ChIP-seq data generated in this study. These findings and resources will be valuable to researchers in the fields of systems biology, bacteriology, and plant-microbe interactions.

      Weaknesses:

      No major weaknesses were found, but some of the results may need to be interpreted with caution. ChIP-seq was performed with bacterial strains overexpressing TFs. This may cause artificial binding of TFs to promoters which may not occur when TFs are expressed at physiological levels. Another caution is applied to the interpretation of the biological functions of TFs during plant infection, as biological roles of the tested TFs are mostly based on in vitro experiments.

      This work advances our understanding of transcriptional regulation of virulence and metabolic pathways in plant pathogenic bacteria. Solid evidence for the claims is provided by computational analysis of newly generated data on the genome-wide binding of 170 transcription factors to their target genes, together with experimental validation of the biological functions of some of these transcription factors. The findings and resources from this study will be valuable to researchers in the fields of systems biology, bacteriology, and plant-microbe interactions.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors wanted to determine whether cis-acting factors of Sxl - two different Sxl promoters in somatic cells - regulate Sxl in a similar way in germ cells. They also wanted to determine whether trans-acting factors known to regulate Sxl in the soma also regulate Sxl in the germline.

      Regarding the cis-acting factors, they examine the Sxl "establishment promoter" (SxlPE) that is activated in female somatic cells by the presence of two X chromosomes. Slightly later in development, dosage compensation equalizes X chromosome expression in males and females and so X chromosomes can no longer be counted. The second Sxl promoter is the "maintenance promoter," (SxlPM), which is activated in both sexes. The mRNA produced from the maintenance promoter has to be alternatively splicing from early Sxl protein generated earlier in development by the PE. This leads to an autoregulatory loop that maintains Sxl expression in female somatic cells. The authors used fluorescent in situ hybridization (FISH) with oligopaints to determine the temporal activation of the PE or PM promoters. They find that - unlike the soma - the PE does not precede the PM and instead is activated contemporaneously or later than the PM - this is confusing with the later results (see below). Next, they generated transcriptional reporter constructs containing large segments of the Sxl locus, the 1.5 kb used in somatic studies, a 5.2 kb reporter, and a 10.2 kb. Interestingly the 1.5 kb reporter that was reported to recapitulate Sxl expression in soma and germline was not observed by the authors. The 5.2 kb reporter was observed in female somatic cells but not in germ cells. Only when they include an additional 5 kb downstream of the 5.2 kb reporter (here the 10.2 kb reporter) they did see expression in germ cells but this occurred at the L1 stages. Their data indicate that Sxl activity in the germ requires different cis-regulation than the soma and that the PE is activated later in germ cells than in somatic cells. The authors next use gene editing to insert epitope tags in two distinct strains in the hopes of creating an early Sxl and a later Sxl protein derived from the PE and PM, respectively. The HA-tagged protein from the PE was seen in somatic cells but never in the germline, possibly due to very low expression. The FLAG-tagged late Sxl protein is observed in L2 germ cells. Because the early HA-Sxl protein is not perceptible in germ cells, it is not possible to conclude its role in the germline. However, because late FLAG-Sxl was only observed in L2 germ cells and the PE was detected in L1, this leaves open the possibility that PE produces early HA-Sxl (which currently cannot be detected), which then alternatively splices the transcript from the PM. In other words, the soma and germline could have a similar temporal relationship between the two Sxl promoters. While I agree with the authors about this conclusion, the earlier work with the oligopaints leads to the conclusion that SE is active after PM. This is confusing.

      Next, the authors wanted to turn their attention to the trans-acting factors that regulate Sxl in the soma, including Sisterless A (SisA), SisB, Runt, and the JAK/STAT ligand Unpaired. Using germline RNAi, the authors found that only knockdown of SisA causes ovarian tumors, similar to the loss of Sxl, suggesting that SisA regulates Sxl (ie the PE) in both the soma and the germline. They generated a SisA null allele using CRISPR/Cas9 and these animals had ovarian tumors and germ cell-less ovaries. FISH revealed that sisA is activated in primordial germ cells in stages 3-6 before the activation of Sxl. They used CRISPR-Cas9 to generate an endogenously-tagged SisA and found that tagged SisA was expressed in stage 3-6 PCGs, which is consistent with activating PE in the germline. They showed that sisA is upstream of Sxl as germline depletion of sisA led to a significant decrease in expression from the 10.2 kb PE reporter and in SXL protein. The authors could rescue the ovarian tumors and loss of Sxl protein upon germline depletion of sisA by supplying Sxl from another protein (the otu promoter). These data indicate that sisA is necessary for Sxl activation in the germline. However, ectopic sisA in germ cells in the testis did not lead to ectopic Sxl, suggesting that sisA is not sufficient to activate Sxl in the germline.

      Strengths:

      (1) The genetic and genomic approaches in this study are top-notch and they have generated reagents that will be very useful for the field.

      (2) Excellent use of powerful approaches (oligo paint, reporter constructs, CRISPR-Cas9 alleles).

      (3) The combination of state of art approaches and quantification of phenotypes allows the authors to make important conclusions.

      Weaknesses:

      (1) Confusion in line 127 (this indicates that SxlPE is not activated before SxlPM in the germline) about PE not being activated before the PM in the germline when later figures show that PE is activated in L1 and late Sxl protein is seen in L2. It would be helpful to the readers if the authors edited the text to avoid this confusion. Perhaps more explanation of the results at specific points would be helpful.

    1. Reviewer #2 (Public Review):

      Summary: The investigators apply scRNA seq and bioinformatics to identify biomarkers associated with the DNFB-induced contact dermatitis in mice. The bioinformatics component of the study appears reasonable and may provide new insights regarding TH1 driven immune reactions in ACD in mice. However, the IF data and images of tissue sections are not clear and should be improved to validate the model.

      Strengths:<br /> The bioinformatics analysis.

      Weaknesses:<br /> The IF data presented in 4H, 6H, 7E and 7F are not convincing and need to be correlated with routine staining on histology and different IF markers for PDGFR. Some of the IF staining data demonstrates a pattern inconsistent with its target.

    1. Reviewer #2 (Public Review):

      Summary

      Based on i) the documented role of FMNL1 proteins in IS formation; ii) their ability to regulate F-actin dynamics; iii) the implication of PKCdelta in MVB polarization to the IS and FMNL1beta phosphorylation; and iv) the homology of the C-terminal DAD domain of FMNL1beta with FMNL2, where a phosphorylatable serine residue regulating its auto-inhibitory function had been previously identified, the authors have addressed the role of S1086 in the FMNL1beta DAD domain in F-actin dynamics, MVB polarization and exosome secretion, and investigated the potential implication of PKCdelta, which they had previously shown to regulate these processes, in FMNL1beta S1086 phosphorylation. They demonstrate that FMNL1beta is indeed phosphorylated on S1086 in a PKCdelta-dependent manner and that S1086-phosphorylated FMNL1beta acts downstream of PKCdelta to regulate centrosome and MVB polarization to the IS and exosome release. They provide evidence that FMNL1beta accumulates at the IS where it promotes F-actin clearance from the IS center, thus allowing for MVB secretion.

      Strengths

      The work is based on a solid rationale, which includes previous findings by the authors establishing a link between PKCdelta, FMNL1beta phosphorylation, synaptic F-actin clearance and MVB polarization to the IS. The authors have thoroughly addressed the working hypotheses using robust tools. Among these, of particular value is an expression vector that allows for simultaneous RNAi-based knockdown of the endogenous protein of interest (here all FMNL1 isoforms) and expression of wild-type or mutated versions of the protein as YFP-tagged proteins to facilitate imaging studies. The imaging analyses, which are the core of the manuscript, have been complemented by immunoblot and immunoprecipitation studies, as well as by the measurement of exosome release (using a transfected MVB/exosome reporter to discriminate exosomes secreted by T cells).

      Weaknesses

      The authors have satisfactorily addressed the weaknesses pointed out in my previous review.

    1. Reviewer #2 (Public Review):

      Animals constantly adjust behavior and physiology based on internal states. Hungry animals, desperate for food, exhibit physiological changes immediately upon sensing, smelling, or chewing food, known as the cephalic phase response (CPR), involving processes like increased saliva and gastrointestinal secretions. While starvation lowers body temperature, the mechanisms underlying how the sensation of food without nutrients induces behavioral responses remain unclear. Hunger stress induces changes in both behavior and physiological responses, which in flies (or at least in Drosophila melanogaster) leads to a preference for lower temperatures, analogous to the hunger-driven lower body temperature observed in mammals. In this manuscript, the authors have used Drosophila melanogaster to investigate the issue of whether taste cues can robustly trigger behavioral recovery of temperature preference in starving animals. The authors find that food detection triggers a warm preference in flies. Starved flies recover their temperature preference after food intake, with a distinction between partial and full recovery based on the duration of refeeding. Sucralose, an artificial sweetener, induces a warm preference, suggesting the importance of food-sensing cues. The paper compares the effects of sucralose and glucose refeeding, indicating that both taste cues and nutrients contribute to temperature preference recovery. The authors show that that sweet gustatory receptors (Grs) and sweet GRNs (Gustatory Receptor Neurons) play a crucial role in taste-evoked warm preference. Optogenetic experiments with CsChrimson support the idea that the excitation of sweet GRNs leads to a warm preference. The authors then examine the internal state's influence on taste-evoked warm preference, focusing on neuropeptide F (NPF) and small neuropeptide F (sNPF), analogous to mammalian neuropeptide Y. Mutations in NPF and sNPF result in a failure to exhibit taste-evoked warm preference, emphasizing their role in this process. However, these neuropeptides appear not to be critical for nutrient-induced warm preference, as indicated by increased temperature preference during glucose and fly food refeeding in mutant flies. The authors also explore the role of hunger-related factors in regulating taste-evoked warm preference. Hunger signals, including diuretic hormone (DH44) and adipokinetic hormone (AKH) neurons, are found to be essential for taste-evoked warm preference but not for nutrient-induced warm preference. Additionally, insulin-like peptide 6 (Ilp6) and Unpaired3 (Upd3), related to nutritional stress, are identified as crucial for taste-evoked warm preference. The investigation then extends into circadian rhythms, revealing that taste-evoked warm preference does not align with the feeding rhythm. While flies exhibit a rhythmic feeding pattern, taste-evoked warm preference occurs consistently, suggesting a lack of parallel coordination. Clock genes, crucial for circadian rhythms, are found to be necessary for taste-evoked warm preference but not for nutrient-induced warm preference.

      Strengths:

      A well-written and interesting study, investigating an intriguing issue. The claims, none of which to the best of my knowledge controversial, are backed by a substantial number of experiments.

      Weakness:

      The experimental setup used and the procedures for assessing the temperature preferences of flies is rather sparingly described. Additional details and data presentation would enhance the clarity and replicability of the study. I kindly request the authors to consider the following points: i) A schematic drawing or diagram illustrating the experimental setup for the temperature preference assay would greatly aid readers in understanding the spatial arrangement of the apparatus, temperature points, and the positioning of flies during the assay. The drawing should also be accompanied by specific details about the setup (dimensions, material, etc). ii) It would be beneficial to include a visual representation of the distribution of flies within the temperature gradient on the apparatus. A graphical representation, such as a heatmaps or histograms, showing the percentage of flies within each one-degree temperature bin, would offer insights into the preferences and behaviors of the flies during the assay. In addition to the detailed description of the assay and data analysis, the inclusion of actual data plots, especially for key findings or representative trials, would provide readers with a more direct visualization of the experimental outcomes. These additions will not only enhance the clarity of the presented information but also provide the reader with a more comprehensive understanding of the experimental setup and results. I appreciate the authors' attention to these points and look forward to the potential inclusion of these elements in the revised manuscript.

      Update: The revised manuscript now includes heatmaps showing the distribution of the flies across the temperature bins. As well as a schematic drawing of the behavioral setup.

    1. Reviewer #2 (Public Review):

      Summary:

      This study looks at sex differences in alcohol drinking behaviour in a well-validated model of binge drinking. They provide a comprehensive analysis of drinking behaviour within and between sessions for males and females, as well as looking at the calcium dynamics in neurons projecting from the anterior insula cortex to the dorsolateral striatum.

      Strengths:

      Examining specific sex differences in drinking behaviour is important. This research question is currently a major focus for preclinical researchers looking at substance use. Although we have made a lot of progress over the last few years, there is still a lot that is not understood about sex-differences in alcohol consumption and the clinical implications of this.

      Identifying the lateralisation of activity is novel, and has fundamental importance for researchers investigating functional anatomy underlying alcohol-driven behaviour (and other reward-driven behaviours).

      Weaknesses:

      Very small and unequal sample sizes, especially females (9 males, 5 females). This is probably ok for the calcium imaging, especially with the G-power figures provided, however, I would be cautious with the outcomes of the drinking behaviour, which can be quite variable.

      For female drinking behaviour, rather than this being labelled "more efficient", could this just be that female mice (being substantially smaller than male mice) just don't need to consume as much liquid to reach the same g/kg. In which case, the interpretation might not be so much that females are more efficient, as that mice are very good at titrating their intake to achieve the desired dose of alcohol.

    1. Reviewer #2 (Public Review):

      Summary:

      Identifying spatial subunits within the receptive field of retinal ganglion cells can help study spatial nonlinearities and upstream computations performed by the bipolar cells. The authors significantly accelerate the implementation of the previously proposed Spike Triggered semi-non-negative Matrix Factorization (STNMF) method to identify the subunits. The authors also propose a few method improvements - better initialization; new stability-based criteria for selecting the regularization strength, and hyperparameter selection across cell types.

      The authors then apply this new method to RGC populations in both the salamander retina and the macaque (marmoset) retina. The authors document the subunit sizes, numbers, and overlap across cell types. The neuroscience finding describes the anti-coordination of ON and OFF parasol receptive fields, but not for the corresponding subunits.

      Overall, the authors claim that a faster and more accurate method makes scale-up to large neuronal populations feasible.

      Strengths:

      - The paper is well-written, easy to read and the figures are clear. The limitations are also made clear.

      - The scientific findings are novel and seem to be well supported.

      - The claimed speed-up of the method is potentially important for practical applications to large populations. Each innovation of the method is well-supported.

      - This is a serious effort to improve the method and document the subunits in primate retina.

      Weaknesses:

      - The description of the method is confusing. Currently, the new method is described in the context of changes from existing methods. As someone who is not familiar with previous methods, it is very confusing to follow the details.

      - I think it will help a lot with clarity to have a concise flowchart/pseudocode to summarize the algorithm and separate it from a description of the main changes from previous methods.

      - Separate pseudocodes can be provided for the main method, initialization, regularization parameter selection using consensus, and identifying the regularization parameter across cell types.

      - While the new method clearly shows a drastic improvement compared to the previous method on a laptop, would it be possible to get the same improvement on the previous method if it was implemented with GPU (as is standard for most AI/ML algorithms)?

      - For the calculation of subunits across multiple cells, can you run multiple parallel jobs on the same computer? This may make some innovations unnecessary (like setting the same regularization strength across multiple cells).

      - There are two main innovations in this paper: the fast and approximate method, and analysis of subunit mosaics for primate RGCs. It would be helpful to include an analysis of the primate RGC subunits using the older, slower, but more exact method and show that the major scientific results can be reproduced. This would validate the new method in an end-to-end manner. While this may take a while to run, it may be helpful in the supplement.

      - It would be important to understand the data-efficiency of the method. The approximate method may deviate more from the exact method when the amount of data is limited.

      - Would it be possible to have a few steps of the exact method at the end to ensure that the solution truly optimizes the objective function?

      - Does the number of estimated subunits change with the number of observed spikes? If so, the estimates of subunit number/size must be interpreted with caution.

    1. Reviewer #2 (Public Review):

      Yang et al. investigated the role of miR-802 in the development of adipose tissue (AT) inflammation during obesity. The authors found miR-802 levels are up-regulated in the AT of mouse models of obesity and insulin resistance as well as in the AT of humans. They further demonstrated that miR-802 regulates the intracellular levels of TRAF3 and downstream activation of the NF-kB pathway. Ultimately, controlling AT inflammation by manipulating miR-802 affected whole-body glucose homeostasis, highlighting the role of AT inflammatory status in whole-body metabolism. The study provides solid evidence on the role of adipocyte miR-802 in controlling inflammation and macrophage recruitment. However, how lipid mobilization from adipocytes and how engulfment of lipid droplets by macrophages control inflammatory phenotype in these cells could be better explored. The findings of this study will have a great impact in the field, contributing to the growing body of evidence on how microRNAs control the inflammatory microenvironment of AT and whole-body metabolism in obesity.

    1. Reviewer #2 (Public Review):

      The manuscript by Tompary & Davachi presents results from two experiments, one behavior only and one fMRI plus behavior. They examine the important question of how to separate object memories (C1 and C2) that are never experienced together in time and become linked by shared predictive cues in a sequence (A followed by B followed by one of the C items). The authors developed an implicit priming task that provides a novel behavioral metric for such integration. They find significant C1-C2 priming for sequences that were learned 24h prior to the test, but not for recently learned sequences, suggesting that associative links between the two originally separate memories emerge over an extended period of consolidation. The fMRI study relates this behavioral integration effect to two neural metrics: pattern similarity changes in the medial prefrontal cortex (mPFC) as a measure of neural integration, and changes in hippocampal-LOC connectivity as a measure of post-learning consolidation. While fMRI patterns in mPFC overall show differentiation rather than integration (i.e., C1-C2 representational distances become larger), the authors find a robust correlation such that increasing pattern similarity in mPFC relates to stronger integration in the priming test, and this relationship is again specific to remote memories. Moreover, connectivity between the posterior hippocampus and LOC during post-learning rest is positively related to the behavioral integration effect as well as the mPFC neural similarity index, again specifically for remote memories. Overall, this is a coherent set of findings with interesting theoretical implications for consolidation theories, which will be of broad interest to the memory, learning, and predictive coding communities.

      Strengths:

      (1) The implicit associative priming task designed for this study provides a promising new tool for assessing the formation of mnemonic links that influence behavior without explicit retrieval demands. The authors find an interesting dissociation between this implicit measure of memory integration and more commonly used explicit inference measures: a priming effect on the implicit task only evolved after a 24h consolidation period, while the ability to explicitly link the two critical object memories is present immediately after learning. While speculative at this point, these two measures thus appear to tap into neocortical and hippocampal learning processes, respectively, and this potential dissociation will be of interest to future studies investigating time-dependent integration processes in memory.

      (2) The experimental task is well designed for isolating pre- vs post-learning changes in neural similarity and connectivity, including important controls of baseline neural similarity and connectivity.

      (3) The main claim of a consolidation-dependent effect is supported by a coherent set of findings that relate behavioral integration to neural changes. The specificity of the effects on remote memories makes the results particularly interesting and compelling.

      (4) The authors are transparent about unexpected results, for example, the finding that overall similarity in mPFC is consistent with a differentiation rather than an integration model.

      Weaknesses:

      (1) The sequence learning and recognition priming tasks are cleverly designed to isolate the effects of interest while controlling for potential order effects. However, due to the complex nature of the task, it is difficult for the reader to infer all the transition probabilities between item types and how they may influence the behavioral priming results. For example, baseline items (BL) are interspersed between repeated sequences during learning, and thus presumably can only occur before an A item or after a C item. This seems to create non-random predictive relationships such that C is often followed by BL, and BL by A items. If this relationship is reversed during the recognition priming task, where the sequence is always BL-C1-C2, this violation of expectations might slow down reaction times and deflate the baseline measure. It would be helpful if the manuscript explicitly reported transition probabilities for each relevant item type in the priming task relative to the sequence learning task and discussed how a match vs mismatch may influence the observed priming effects.

      (2) The choice of what regions of interest to include in the different sets of analyses could be better motivated. For example, even though briefly discussed in the intro, it remains unclear why the posterior but not the anterior hippocampus is of interest for the connectivity analyses, and why the main target is LOC, not mPFC, given past results including from this group (Tompary & Davachi, 2017). Moreover, for readers not familiar with this literature, it would help if references were provided to suggest that a predictable > unpredictable contrast is well suited for functionally defining mPFC, as done in the present study.

      (3) Relatedly, multiple comparison corrections should be applied in the fMRI integration and connectivity analyses whenever the same contrast is performed on multiple regions in an exploratory manner.

    1. Reviewer #2 (Public Review):

      Girardello et al investigated the composition of the molecular machinery of caveolae governing their mechano-regulation in migrating cells. Using live cell imaging and RPE1 cells, the authors provide a spatio-temporal analysis of cavin-3 distribution during cell migration and reveal that caveolae are preferentially localized at the rear of the cell in a stable manner. They further characterize these structures using electron tomography and reveal an organization into clusters connected to the cell surface. By performing a proteomic approach, they address the interactome of caveolin-1 proteins upon mechanical stimulation by exposing RPE1 cells to hypo-osmotic shock (which aims to increase cell membrane tension) or not as a control condition. The authors identify over 300 proteins, notably proteins related to actin cytoskeleton and cell adhesion. These results were further validated in cellulo by interrogating protein-protein interactions using proximity ligation assays and hypo-osmotic shock. These experiments confirmed previous data showing that high membrane tension induces caveolae disassembly in a reversible manner. Eventually, based on literature and on the results collected by the proteomic analysis, authors investigated more deeply the molecular signaling pathway controlling caveolae assembly upon mechanical stimuli. First, they confirm the targeting of ROCK1 with Caveolin-1 and the implication of the kinase activity for caveolae formation (at the rear of the cell). Then, they show that RhoGA ARHGAP29, a factor newly identified by the proteomic analysis, is also implicated in caveolae mechano-regulation likely through YAP protein and found that overexpression of RHoGA ARHGAP29 affects cell motility. Overall, this paper interrogated the role of membrane tension in caveolae located at the rear of the cell and identified a new pathway controlling cell motility.

      Strengths:

      Using a proximity-based proteomic assay, the authors reveal the protein network interacting with caveolae upon mechanical stimuli. This approach is elegant and allows to identify a substantial new set of factors involved in the mechano-regulation of caveolin-1, some of which have been verified directly in the cell by PLA. This study provides a compelling set of data on the interactions between caveolae and its cortical network which was so far ill-characterized.

      Weaknesses:

      The methodology demonstrating an impact of membrane tension is not precise enough to directly assess a direct role on caveolae at a subcellular scale, that is between the front and the rear of the cell. First, a better characterization of the "front-rear" cellular model is encouraged. Secondly, authors frequently present osmotic shock as "high membrane tension" stimuli. While osmotic shock is widely used in the field, this study is focused only on caveolae localized at the rear of cell and it remains unclear how the level of a global mechanical stimuli triggered by an osmotic shock could mimic a local stimuli. In the present case, it remains unknown the extent to which this mechanical stress is physiologically relevant to mimic mechanical forces applied at the rear of a migrating cell.<br /> Some images are not satisfying to fully support the conclusions of the article. At this stage, the lack of an unbiased quantitative analysis of the spatio-temporal analysis of caveolae upon well-defined mechanical stimuli is also needed. Cells on images, in particular Figure 1, are difficult to see. Signal-to noise ratio in different cell area could generate a biased. Since there is inconsistency between caveolae density and localization between Figures, more solid illustrations are needed along quantitative analysis.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors have taken their previous finding that arpin is important for epithelial junctions and extended this to endothelial cells. They find that the positive effects of arpin on endothelial junctions are not dependent on Arp2/3 activity but instead on suppression of actinomyosin contractility.

      Strengths:

      The study uses standard approaches to test each of the components in the model. The quality of the experimental work is good and the amount of experimental evidence is sufficient to support this straightforward story.

      Weaknesses:

      The major weakness is that the story is a simple extension of the previous work on arpin and junctions in epithelial cells. The additional information is that the effects are not via Arp2/3 directly, but instead through an increase in actinomyosin contractility. However, the connection between arpin and increased ROCK activity is not revealed.

    1. Reviewer #2 (Public Review):

      In the present study, Vora et al. elucidated the transcription factors downstream of the BMP pathway components Smad and Schnurri in C. elegans and their effects on body size. Using a combination of a broad range of techniques, they compiled a comprehensive list of genome-wide downstream targets of the Smads SMA-3 and SMA-9. They found that both proteins have an overlapping spectrum of transcriptional target sites they control, but also unique ones. Thereby, they also identified genes involved in one-carbon metabolism or the endoplasmic reticulum (ER) secretory pathway. In an elaborate effort, the authors set out to characterize the effects of numerous of these targets on the regulation of body size in vivo as the BMP pathway is involved in this process. Using the reporter ROL-6::wrmScarlet, they further revealed that not only collagen production, as previously shown, but also collagen secretion into the cuticle is controlled by SMA-3 and SMA-9. The data presented by Vora et al. provide in-depth insight into the means by which the BMP pathway regulates body size, thus offering a whole new set of downstream mechanisms that are potentially interesting to a broad field of researchers.

      The paper is mostly well-researched, and the conclusions are comprehensive and supported by the data presented. However, certain aspects need clarification and potentially extended data.

      (1) The BMP pathway is active during development and growth. Thus, it is logical that the data shown in the study by Vora et al. is based on L2 worms. However, it raises the question of if and how the pattern of transcriptional targets of SMA-3 and SMA-9 changes with age or in the male tail, where the BMP pathway also has been shown to play a role. Is there any data to shed light on this matter or are there any speculations or hypotheses?

      (2) As it was shown that SMA-3 and SMA-9 potentially act in a complex to regulate the transcription of several genes, it would be interesting to know whether the two interact with each other or if the cooperation is more indirect.

      (3) It would help the understanding of the data even more if the authors could specifically state if there were collagens among the genes regulated by SMA-3 and SMA-9 and which.

      (4) The data on the role of SMA-3 and SMA-9 in the regulation of the secretion of collagens from the hypodermis is highly intriguing. The authors use ROL-6 as a reporter for the secretion of collagens. Is ROL-6 a target of SMA-9 or SMA-3? Even if this is not the case, the data would gain even more strength if a comparable quantification of the cuticular levels of ROL-6 were shown in Figure 6, and potentially a ratio of cuticular versus hypodermal levels. By that, the levels of secretion versus production can be better appreciated.

      (5) It is known that the BMP pathway controls several processes besides body size. The discussion would benefit from a broader overview of how the identified genes could contribute to body size. The focus of the study is on collagen production and secretion, but it would be interesting to have some insights into whether and how other identified proteins could play a role or whether they are likely to not be involved here (such as the ones normally associated with lipid metabolism, etc.).

    1. Reviewer #2 (Public Review):

      Aybar-Torres and colleagues utilize common human STING alleles to dissect the mechanism of SAVI inflammatory disease. The authors demonstrate that these common alleles alleviate SAVI pathology in mice, and perhaps more importantly use the differing functionality of these alleles to provide insight into requirements of SAVI disease induction. Their findings suggest that it is residue A230 and/or Q293 that are required for SAVI induction, while the ability to induce an interferon-dependent inflammatory response is not. This is nicely exemplified by the AQ/SAVI mice that have an intact inflammatory response to STING activation, yet minimal disease progression. As both mutants seem to be resistant STING-dependent cell death, this manuscript also alludes to the importance of STING-dependent cell death, rather than STING-dependent inflammation, in the progression of SAVI pathology. I believe this manuscript makes some important connections between STING pathology mouse models and human genetics that would contribute to the field.

    1. Reviewer #2 (Public Review):

      (1) Regarding the results in Figure 2 and Figure 5: for the heatmaps in Fig.2F and Fig.2E, the overall activity pattern of D1 and D2 MSNs looks very similar, both D1 and D2 MSNs contains neurons showing decreasing or increasing activity during interval timing. And the optogenetic and pharmacologic inhibition of either D1 or D2 MSNs resulted in similar behavior outcomes. To me, the D1 and D2 MSN activities were more complementary than opposing. If the authors want to emphasize the opposing side of D1 and D2 MSNs, then the manipulation experiments need to be re-designed, since the average activity of D2 MSNs increased, while D1 MSNs decreased during interval timing, instead of using inhibitory manipulations in both pathways, the authors should use inhibitory manipulation in D2-MSNs, while using optogenetic or pharmacology to activate D1-MSNs. In this way, the authors can demonstrate the opposing role of D1 and D2 MSNs and the functions of increased activity in D2-MSNs and decreased activity in D1-MSNs.

      (2) Regarding the results in Figure 3 C and D, Figure 6 H and Figure 7 D, what is the sample size? From the single data points in the figures, it seems that the authors were using the number of cells to do statistical tests and plot the figures. For example, Figure 3 C, if the authors use n= 32 D2 MSNs and n= 41D1 MSNs to do the statistical test, it could make a small difference to be statistically significant. The authors should use the number of mice to do the statistical tests.

      (3) Regarding the results in Figure 5, what is the reason for the increase in the response times? The authors should plot the position track during intervals (0-6 s) with or without optogenetic or pharmacologic inhibition. The authors can check Figures 3, 5, and 6 in the paper https://doi.org/10.1016/j.cell.2016.06.032 for reference to analyze the data.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors developed a novel tool, SCellBOW, to perform cell clustering and infer survival risks on individual cancer cell clusters from the single-cell RNA seq dataset. The key ideas/techniques used in the tool include transfer learning, bag of words (BOW), and phenotype algebra which is similar to word algebra from natural language processing (NLP). Comparisons with existing methods demonstrated that SCellBOW provides superior clustering results and exhibits robust performance across a wide range of datasets. Importantly, a distinguishing feature of SCellBOW compared to other tools is its ability to assign risk scores to specific cancer cell clusters. Using SCellBOW, the authors identified a new group of prostate cancer cells characterized by a highly aggressive and dedifferentiated phenotype.

      Strengths:

      The application of natural language processing (NLP) to single-cell RNA sequencing (scRNA-seq) datasets is both smart and insightful. Encoding gene expression levels as word frequencies is a creative way to apply text analysis techniques to biological data. When combined with transfer learning, this approach enhances our ability to describe the heterogeneity of different cells, offering a novel method for understanding the biological behavior of individual cells and surpassing the capabilities of existing cell clustering methods. Moreover, the ability of the package to predict risk, particularly within cancer datasets, significantly expands the potential applications.

      Weaknesses:

      Given the promising nature of this tool, it would be beneficial for the authors to test the risk-stratification functionality on other types of tumors with high heterogeneity, such as liver and pancreatic cancers, which currently lack clinically relevant and well-recognized stratification methods. Additionally, it would be worthwhile to investigate how the tool could be applied to spatial transcriptomics by analyzing cell embeddings from different layers within these tissues.

    1. Reviewer #2 (Public Review):

      Summary:

      Zhixin and collaborators have investigated if the molecular pathways present in glia play a role in the proliferation, maintenance and differentiation of Neural Stem Cells. In this case, Drosophila Neuroblasts are used as models. Authors find that neuronal iron metabolism modulated by glial ferritin is an essential element for Neuroblast proliferation and differentiation. They show that loss of glial ferritin is sufficient to impact the number of neuroblasts. Remarkably, authors have identified that ferritin produced in the glia is secreted to be used as an iron source by the neurons. Therefore iron defects in glia have serious consequences in neuroblasts and likely vice versa. Interestingly, preventing iron absorption in the intestine is sufficient to reduce NB number. Furthermore, they have identified Zip13 as another regulator of the process. Evidence presented strongly indicates that the loss of neuroblasts is due to premature differentiation rather than cell death.

      Strengths:

      - Comprehensive analysis of the impact of glial iron metabolism in neuroblast behaviour by genetic and drug-based approaches as well as using a second model (mouse) for some validations.

      - Using cutting edge methods such as RNAseq as well as very elegant and clean approaches such as RNAi-resistant lines or temperature-sensitive tools

      - Goes beyond the state of the art highlighting iron as a key element in neuroblast formation as well as as a target in tumor treatments.

      Comments on latest version:

      The authors have successfully and convincingly addressed all comments from this reviewer. The modifications, changes and additions have increased the robustness of the results and clearly increased the readability of the manuscript.

      This reviewer also appreciates all the efforts and extra work conducted by the authors to finish in a reasonable time all the experiments suggested by all reviewers.

    1. Reviewer #2 (Public Review):

      The authors investigate the gene expression variation in a rice diversity panel under normal and saline growth conditions to gain insight into the underlying molecular adaptive response to salinity. They present a convincing case to demonstrate that environmental stress can induce selective pressure on gene expression, which is in agreement to their earlier study (Groen et al, 2020). The data seems to be a good fit for their study and overall the analytic approach is robust.

      (1) The work started by investigating the effect of genotype and their interaction at each transcript level using 3'-end-biased mRNA sequencing, and detecting a wide-spread GXE effect. Later, using the total filled grain number as a proxy of fitness, they estimated the strength of selection on each transcript and reported stronger selective pressure in a saline environment. However, this current framework relies on precise estimation of fitness and, therefore can be sensitive to the choice of fitness proxy.

      (2) Furthermore, the authors decomposed the genetic architecture of expression variation into cis- and trans-eQTL in each environment separately and reported more unique environment-specific trans-eQTLs than cis-. The relative contribution of cis- and trans-eQTL depends on both the abundance and effect size. I wonder why the latter was not reported while comparing these two different genetic architectures. If the authors were to compare the variation explained by these two categories of eQTL instead of their frequency, would the inference that trans-eQTLs are primarily associated with expression variation still hold?

      (3) Next, the authors investigated the relationship between cis- and trans-eQTLs at the transcript level and revealed an excess of reinforcement over the compensation pattern. Here, I struggle to understand the motivation for testing the relationship by comparing the effect of cis-QTL with the mean effect of all trans-eQTLs of a given transcript. My concern is that taking the mean can diminish the effect of small trans-eQTLs potentially biasing the relationship towards the large-effect eQTLs.

    1. Reviewer #2 (Public Review):

      Summary:

      The study by Ver Heul et al., investigates the consequences of RAG expression for type 2 innate lymphoid cell (ILC2) function. RAG expression is essential for the generation of the receptors expressed by B and T cells and their subsequent development. Innate lymphocytes, which arise from the same initial progenitor populations, are in part defined by their ability to develop in the absence of RAG expression. However, it has been described in multiple studies that a significant proportion of innate lymphocytes show a history of Rag expression. In compelling studies several years ago, members of this research team revealed that early Rag expression during the development of Natural Killer cells (Karo et al., Cell 2014), the first described innate lymphocyte, had functional consequences.

      Here, the authors revisit this topic, a worthwhile endeavour given the broad history of Rag expression within all ILCs and the common use of RAG-deficient mice to specifically assess ILC function. Focusing on ILC2s and utilising state-of-the-art approaches, the authors sought to understand whether early expression of Rag during ILC2 development had consequences for activity, fitness, or function. Having identified cell-intrinsic effects in vivo, the authors investigated the causes of this, identifying epigenetic changes associated with the accessibility genes associated with core ILC2 functions.

      The manuscript is well written and does an excellent job of supporting the reader through reasonably complex transcriptional and epigenetic analyses, with considerate use of explanatory diagrams. Overall I think that the conclusions are fair, the topic is thought-provoking, and the research is likely of broad immunological interest. I think that the extent of functional data and mechanistic insight is appropriate.

      Strengths:

      - The logical and stepwise use of mouse models to first demonstrate the impact on ILC2 function in vivo and a cell-intrinsic role. Initial analyses show enhanced cytokine production by ILC2 from RAG-deficient mice. Then through two different chimeric mice (including BM chimeras), the authors convincingly show this is cell intrinsic and not simply as a result of lymphopenia. This is important given other studies implicating enhanced ILC function in RAG-/- mice reflect altered competition for resources (e.g. cytokines).

      - Use of Rag expression fate mapping to support analyses of how cells were impacted - this enables a robust platform supporting subsequent analyses of the consequences of Rag expression for ILC2.

      - Use of snRNA-seq supports gene expression and chromatin accessibility studies - these reveal clear differences in the data sets consistent with altered ILC2 function.

      - Convincing evidence of epigenetic changes associated with loci strongly linked to ILC2 function. This forms a detailed analysis that potentially helps explain some of the altered ILC2 functions observed in ex vivo stimulation assays.

      - Provision of a wealth of expression data and bioinformatics analyses that can serve as valuable resources to the field.

      Weaknesses:

      - Lack of insight into precisely how early RAG expression mediates its effects, although I think this is beyond the scale of this current manuscript. Really this is the fundamental next question from the data provided here.

      - The epigenetic analyses provide evidence of differences in the state of chromatin, but there is no data on what may be interacting or binding at these sites, impeding understanding of what this means mechanistically.

      - Focus on ILC2 from skin-draining lymph nodes rather than the principal site of ILC2 activity itself (the skin). This may well reflect the ease at which cells can be isolated from different tissues.

      - Comparison with ILC2 from other sites would have helped to substantiate findings and compensate for the reliance on data on ILC2 from skin-draining lymph nodes, which are not usually assessed amongst ILC2 populations.

      - The studies of how ILC2 are impacted are a little limited, focused exclusively on IL-13 and IL-5 cytokine expression.

    1. Reviewer #2 (Public Review):

      Summary:

      Sarcomeres, the contractile units of skeletal and cardiac muscle, contract in a concerted fashion to power myofibril and thus muscle fiber contraction.

      Muscle fiber contraction depends on the stiffness of the elastic substrate of the cell, yet it is not known how this dependence emerges from the collective dynamics of sarcomeres. Here, the authors analyze the contraction time series of individual sarcomeres using live imaging of fluorescently labeled cardiomyocytes cultured on elastic substrates of different stiffness. They find that reduced collective contractility of muscle fibers on unphysiologically stiff substrates is partially explained by a lack of synchronization in the contraction of individual sarcomeres.

      This lack of synchronization is at least partially stochastic, consistent with the notion of a tug-of-war between sarcomeres on stiff sarcomeres. A particular irregularity of sarcomere contraction cycles is 'popping', the extension of sarcomeres beyond their rest length. The statistics of 'popping' suggest that this is a purely random process.

      Strengths:

      This study thus marks an important shift of perspective from whole-cell analysis towards an understanding of the collective dynamics of coupled, stochastic sarcomeres.

      Weaknesses:

      Further insight into mechanisms could be provided by additional analyses and/or comparisons to mathematical models.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript presents a novel and significant investigation into the role of SIRT4 For CCN2 expression in response to TGF-β by modulating U2AF2-mediated alternative splicing and its impact on the development of kidney fibrosis.

      Strengths:

      The authors' main conclusion is that SIRT4 plays a role in kidney fibrosis by regulating CCN2 expression via pre-mRNA splicing. Additionally, the study reveals that SIRT4 translocates from the mitochondria to the cytoplasm through the BAX/BAK pore under TGF-β stimulation. In the cytoplasm, TGF-β activated the ERK pathway and induced the phosphorylation of SIRT4 at Ser36, further promoting its interaction with importin α1 and subsequent nuclear translocation. In the nucleus, SIRT4 was found to deacetylate U2AF2 at K413, facilitating the splicing of CCN2 pre-mRNA to promote CCN2 protein expression. Overall, the findings are fully convincing. The current study, to some extent, shows potential importance in this field. 

      Weaknesses:

      (1) Exosomes containing anti-SIRT4 antibodies were found to effectively mitigate UUO-induced kidney fibrosis in mice. While the protein loading capacity and loading methods were not mentioned.

      (2) The method section is incomplete, and many methods like cell culture, cell transfection, gene expression profiling analysis, and splicing analysis, were not introduced in detail.

      (3) The authors should compare their results with previous studies and mention clearly how their work is important in comparison to what has already been reported in the Discussion section.

    1. Reviewer #2 (Public Review):

      Summary:

      The study by Xingsen Zhao et al on "A human forebrain organoid model reveals the essential function of GTF2IRD1-TTR-ERK axis for the neurodevelopmental deficits of Williams Syndrome" presents a forebrain organoid model for WS and has identified defects in neurogenesis. The authors have performed scRNAseq from these patients' derived forebrain organoids showing upregulation expression in genes related to cell proliferation while genes involved in neuronal differentiation were downregulated. The major findings presented in this study are an increase in the size of SOX2+ ventricular zone in WS forebrain organoids with an altered developmental trajectory and aberrant excitatory neurogenesis. The study also presents evidence that transthyretin (TTR) has a reduced expression in WS organoids, and its expression is regulated by the transcription factor -GTF2IRD1. The authors then go on identity mechanistic details of TTR function on MAPK/ERK pathway which has been known to be involved in brain development. Overall, this is a well-constructed study revealing the function of one of the key genes that is deleted in WS and provides novel insights into mechanisms underlying the abnormal neurogenesis in WS brain.

      Strengths:

      WS patients have neurocognitive disorders which most likely stem from defects in early neurodevelopment. This study has investigated a WS forebrain organoid model with scRNAseq and identified differences in cell proliferation and differentiation. This study has presented some new evidence regarding the function and regulation of TTR and its regulator GTF2IRD1 during brain development.

      Weaknesses:

      Though the evidence presented for the mechanism of action of TTR on the MAPK pathway is unclear and lacks depth. It would require identifying downstream targets of TTR and how it interacts with the MAPK pathway.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript explores the neuronal signals that underlie resistance vs resource-based models of cognitive effort. The authors use a delayed discounting task and computational models to explore these ideas. The authors find that the ACC strongly tracks value and time, which is consistent with prior work. Novel contributions include quantification of a resource-based control signal among ACC ensembles, and linking ACC theta oscillations to a resistance-based strategy.

      Strengths:

      The experiments and analyses are well done and have the potential to generate an elegant explanatory framework for ACC neuronal activity. The inclusion of local-field potential / spike-field analyses is particularly important because these can be measured in humans.

      Weaknesses:

      I had questions that might help me understand the task and details of neuronal analyses.

      (1) The abstract, discussion, and introduction set up an opposition between resource and resistance-based forms of cognitive effort. It's clear that the authors find evidence for each (ACC ensembles = resource, theta=resistance?) but I'm not sure where the data fall on this dichotomy.<br /> a. An overall very simple schematic early in the paper (prior to the MCML model? or even the behavior) may help illustrate the main point.<br /> b. In the intro, results, and discussion, it may help to relate each point to this dichotomy.<br /> c. What would resource-based signals look like? What would resistance based signals look like? Is the main point that resistance-based strategies dominate when delays are short, but resource-based strategies dominate when delays are long?<br /> d. I wonder if these strategies can be illustrated? Could these two measures (dLP vs ival tracking) be plotted on separate axes or extremes, and behavior, neuronal data, LFP, and spectral relationships be shown on these axes? I think Figure 2 is working towards this. Could these be shown for each delay length? This way, as the evidence from behavior, model, single neurons, ensembles, and theta is presented, it can be related to this framework, and the reader can organize the findings.

      (2) The task is not clear to me.<br /> a. I wonder if a task schematic and a flow chart of training would help readers.<br /> b. This task appears to be relatively new. Has it been used before in rats (Oberlin and Grahame is a mouse study)? Some history / context might help orient readers.<br /> c. How many total sessions were completed with ascending delays? Was there criteria for surgeries? How many total recording sessions per animal (of the 54?)<br /> d. How many trials completed per session (40 trials OR 45 minutes)? Where are there errors? These details are important for interpreting Figure 1.

      (3) Figure 1 is unclear to me.<br /> a. Delayed vs immediate lever presses are being plotted - but I am not sure what is red, and what is blue. I might suggest plotting each animal.<br /> b. How many animals and sessions go into each data point?<br /> c. Table 1 (which might be better referenced in the paper) refers to rats by session. Is it true that some rats (2 and 8) were not analyzed for the bulk of the paper? Some rats appear to switch strategies, and some stay in one strategy. How many neurons come from each rat?<br /> d. Task basics - RT, choice, accuracy, video stills - might help readers understand what is going into these plots<br /> e. Does the animal move differently (i.e., RTs) in G1 vs. G2?

      (4) I wasn't sure how clustered G1 vs. G2 vs G3 are. To make this argument, the raw data (or some axis of it) might help.<br /> a. This is particularly important because G3 appears to be a mix of G1 and G2, although upon inspection, I'm not sure how different they really are<br /> b. Was there some objective clustering criteria that defined the clusters?<br /> c. Why discuss G3 at all? Can these sessions be removed from analysis?

      (5) The same applies to neuronal analyses in Fig 3 and 4<br /> a. What does a single neuron peri-event raster look like? I would include several of these.<br /> b. What does PC1, 2 and 3 look like for G1, G2, and G3?<br /> c. Certain PCs are selected, but I'm not sure how they were selected - was there a criteria used? How was the correlation between PCA and ival selected? What about PCs that don't correlate with ival?<br /> d. If the authors are using PCA, then scree plots and PETHs might be useful, as well as comparisons to PCs from time-shuffled / randomized data.

      (6) I had questions about the spectral analysis<br /> a. Theta has many definitions - why did the authors use 6-12 Hz? Does it come from the hippocampal literature, and is this the best definition of theta?. What about other bands (delta - 1-4 Hz), theta (4-7 Hz); and beta - 13- 30 Hz? These bands are of particular importance because they have been associated with errors, dopamine, and are abnormal in schizophrenia and Parkinson's disease.<br /> b. Power spectra and time-frequency analyses may justify the authors focus. I would show these (y-axis - frequency, x-axis - time, z-axis, power).

      (7) PC3 as an autocorrelation doesn't seem the to be right way to infer theta entrainment or spike-field relationships, as PCA can be vulnerable to phantom oscillations, and coherence can be transient. It is also difficult to compare to traditional measures of phase-locking. Why not simply use spike-field coherence? This is particularly important with reference to the human literature, which the authors invoke.

    1. Reviewer #2 (Public Review):

      BTB domains are protein-protein interaction domains found in diverse eukaryotic proteins, including transcription factors. It was previously known that many of the Drosophila transcription factor BTB domains are of the TTK-type - these are defined as having a highly-conserved motif, FxLRWN, at their N-terminus, and they thereby differ from the mammalian BTB domains. Whereas the well-characterised mammalian BTB domains are dimeric, several Drosophila TTK-BTB domains notably form multimers and function as chromosome architectural proteins. The aims of this work were (i) to determine the structural basis of multimerisation of the Drosophila TTK-BTB domains, (ii) to determine how different Drosophila TTK-BTB domains interact with each other, and (iii) to investigate the evolution of this subtype of BTB domain.

      The work significantly advances our understanding of the biology of BTB domains. The conclusions of the paper are mostly well-supported, although some aspects need clarification:

      Hexameric organisation of the TTK-type BTB domains:<br /> Using cryo-EM, the authors showed that the CG6765 TTK-type BTB domain forms a hexameric assembly in which three "classic" BTB dimers interact via a beta-sheet interface involving the B3 strand. This is particularly interesting, as this region of the BTB domain has recently been implicated in protein-protein interactions in a mammalian BTB-transcription factor, MIZ1. SEC-MALS analysis indicated that the LOLA TTK-type BTB domain is also hexameric, and SAXS data was consistent with a hexameric assembly of the CG6765- and LOLA BTB domains.

      The data regarding the hexameric organisation is convincing. However, interpreting the role of specific regions of the BTB domain is difficult because the description of the molecular contacts lacks depth.

      Heteromeric interactions between TTK-type BTB domains:<br /> The authors use yeast two-hybrid assays to study heteromeric interactions between various Drosophila TTK-type BTB domains. Such assays are notorious for producing false positives, and this needs to be mentioned. Although the authors suggest that the heteromeric interactions are mediated via the newly-identify B3 interaction interface, there is no evidence to support this, since mutation of B3 yielded insoluble proteins.

      Evolution of the TTK-type BTB domains:<br /> The authors carried out a bioinformatics analysis of BTB proteins and showed that most of the Drosophila BTB transcription factors (24 out of 28) are of the TTK-type. They investigated how the TTK-type BTB domains emerged during evolution, and showed that these are only found in Arthropoda, and underwent lineage-specific expansion in the modern phylogenetic groups of insects. These findings are well-supported by the evidence.

    1. Reviewer #2 (Public Review):

      The manuscript by Xie and colleagues presents transcriptomic experiments that measure gene expression in eight different tissues taken from adult female and male mice from four species. These data are used to make inferences regarding the evolution of sex-biased gene expression across these taxa. The experimental methods and data analysis are appropriate; however, most of the conclusions drawn in the manuscript have either been previously reported in the literature or are not fully supported by the data.

      There are two ways the manuscript could be modified to better strengthen the conclusions.

      First, some of the observed differences in gene expression have very little to no effect on other phenotypes, and are not relevant to medicine or fitness. Selectively neutral gene expression differences have been inferred in previous studies, and consistent with that work, sex-biased and between-species expression differences in this study may also be enriched for selectively neutral expression differences. This idea is supported by the analysis of expression variance, which indicates that genes that show sex-biased expression also tend to show more inter-individual variation. This perspective is also supported by the MK analysis of molecular evolution, which suggests that positive selection is more prevalent among genes that are sex-biased in both mus and dom, and genes that switch sex-biased expression are under less selection at the level of both protein-coding sequence and gene expression.

      As an aside, I was confused by (line 176): "implying that the enhanced positive selection pressure is triggered by their status of being sex-biased in either taxon." - don't the MK values suggest an excess of positive selection on genes that are sex-biased in both taxa?

      Without an estimate of the proportion of differentially expressed genes that might be relevant for broader physiological or organismal phenotypes, it is difficult to assess the accuracy and relevance of the manuscript's conclusions. One (crude) approach would be to analyze subsets of genes stratified by the magnitude of expression differences; while there is a weak relationship between expression differences and fitness effects, on average large gene expression differences are more likely to affect additional phenotypes than small expression differences. Another perspective would be to compare the within-species variance to the between-species variance to identify genes with an excess of the latter relative to the former (similar logic to an MK test of amino acid substitutions).

      Second, the analysis could be more informative if it distinguished between genes that are expressed across multiple tissues in both sexes that may show greater expression in one sex than the other, versus genes with specialized function expressed solely in (usually) reproductive tissues of one sex (e.g. ovary-specific genes). One approach to quantify this distinction would be metrics like those used defined by [Yanai I, et al. 2005. Genome-wide midrange transcription profiles reveal expression-level relationships in human tissue specification. Bioinformatics 21:650-659.] These approaches can be used to separate out groups of genes by the extent to which they are expressed in both sexes versus genes that are primarily expressed in sex-specific tissue such as testes or ovaries. This more fine-grained analysis would also potentially inform the section describing the evolution/conservation of sex-biased expression: I expect there must be genes with conserved expression specifically in ovaries or testes (these are ancient animal structures!) but these may have been excluded by the requirement that genes be sex-biased and expressed in at least two organs.

      There are at least three examples of statements in the discussion that at the moment misinterpret the experimental results.

      The discussion frames the results in the context of sexual selection and sexually antagonistic selection, but these concepts are not synonymous. Sexual selection can shape phenotypes that are specific to one sex, causing no antagonism; and fitness differences between males and females resulting from sexually antagonistic variation in somatic phenotypes may not be acted on by sexual selection. Furthermore, the conditions promoting and consequence of both kinds of selection can be different, so they should be treated separately for the purposes of this discussion.

      The discussion claims that "Our data show that sex-biased gene expression evolves extremely fast" but a comparison or expectation for the rate of evolution is not provided. Many other studies have used comparative transcriptomics to estimate rates of gene expression evolution between species, including mice; are the results here substantially and significantly different from those previous studies? Furthermore, the experimental design does not distinguish between those gene expression phenotypes that are fixed between species as compared to those that are polymorphic within one or more species which prevents straightforward interpretation of differences in gene expression as interspecific differences.

      The conclusion that "Our results show that most of the genetic underpinnings of sex differences show no long-term evolutionary stability, which is in strong contrast to the perceived evolutionary stability of two sexes" - seems beyond the scope of this study. This manuscript does not address the genetic underpinnings of sex differences (this would involve eQTL or the like), rather it looks at sex differences in gene expression phenotypes. Simply addressing the question of phenotypic evolutionary stability would be more informative if genes expressed specifically in reproductive tissues were separated from somatic sex-biased genes to determine if they show similar patterns of expression evolution.

    1. Reviewer #2 (Public Review):

      This study utilized the LCMV Docile infection model, which induces chronic and persistent infection in mice, leading to T cell exhaustion and dysfunction. Through exogenous IL-2 fusion protein treatment during the late stage of infection, the researchers found that IL-2 treatment significantly enlarges the antigen-specific effector CD8 T cells, expanding the CXCR5-TCF1- exhausted population (Tex) while maintaining the size of the CXCR5+TCF1+ precursors of exhausted T cell population (Tpex). This preservation of the Tpex population's self-renewing capacity allows for sustained T cell proliferation and antiviral responses.

      The authors discovered a dual effect of IL-2 treatment: it decreases CXCR5 expression on Tpex cells, restricting their entry into the B cell follicle. This may explain why IL-2 treatment has little impact on overall viral control. However, this finding also suggests a potential application of IL-2 treatment for autoimmune diseases, as it can suppress specific immune responses within the B cell follicle. Using imaging-based approaches, the team provided direct evidence that IL-2 treatment shifts the viral load to concentrate within the B cell follicle, correlating with the observed decrease in CXCR5 expression.

      Further, the researchers showed that ectopic expression of constitutively active STAT5, downstream of IL-2 induced cytokine signaling, in P14 TCR transgenic T cells (specific for an LCMV epitope), drove the T cell population toward the CXCR5- Tex phenotype over the CXCR5+ Tpex cells in vivo. Additionally, abrogating Blimp1, upregulated by active IL-2-phosphorylated STAT5 signaling, restored the CXCR5+ Tpex population.

      Building on these results, the researchers used an engineered IL-2 fusion protein, ANV410, targeting the beta-chain of the IL-2 receptor CD122, which successfully replicated their earlier findings. Importantly, the Tpex-sustaining effect of IL-2 was only observed when treatment was administered during the late stage of infection, as early treatment suppressed Tpex cell generation. Immune profiling of SLE patients undergoing low-dose IL-2 treatment showed a similar reduction in the CXCR5+ Tpex cell population.

      This study provides compelling data on the physiological consequences of IL-2 treatment during chronic viral infection. By leveraging the chronic and persistent LCMV Docile infection model, the researchers identified the temporal effects of IL-2 fusion protein treatment, offering strategic insights for therapies targeting cancer and autoimmune diseases.

    1. Reviewer #2 (Public Review):

      In the revised manuscript, the authors tried to address some of my comments from the previous round of review. Notably, they have performed some additional ITC experiments where protein precipitation is not an issue to probe interactions between PARKIN and different domains. In addition, they have toned down some of the language in the text to better reflect their data and results. However, I still feel that the manuscript lacks some key answers regarding the relative interactions between p-PARKIN and different domains, as discussed in my previous review. A deeper dive into the underlying biophysical and biochemical features that drive these interactions is important to fully understand the importance of their work. However, this manuscript does provide some interesting potential insights into the mechanisms of PARKIN activation that could be useful for the field moving forward.

    1. Reviewer #3 (Public Review):

      Summary

      The high heterogeneity nature of α-synuclein (α-syn) fibrils posed significant challenges in structural reconstruction of the ex vivo conformation. A deeper understanding of the factors influencing the formation of various α-syn polymorphs remains elusive. The manuscript by Frey et al. provides a comprehensive exploration of how pH variations (ranging from 5.8 to 7.4) affect the selection of α-syn polymorphs (specifically, Type1, 2 and 3) in vitro by using cryo-electron microscopy (cryo-EM) and helical reconstruction techniques. Crucially, the authors identify two novel polymorphs at pH 7.0 in PBS. These polymorphs bear resemblance to the structure of patient-derived juvenile-onset synucleinopathy (JOS) polymorph and diseased tissue amplified α-syn fibrils. The revised manuscript more strongly supports the notion that seeding is a non-polymorph-specific in the context of secondary nucleation-dominated aggregation, underscoring the irreplaceable role of pH in polymorph formation.

      Strengths

      This study systematically investigates the effects of environmental conditions and seeding on the structure of α-syn fibrils. It emphasizes the significant influence of environmental factors, especially pH, in determining the selection of α-syn polymorphs. The high-resolution structures obtained through cryo-EM enable a clear characterization of the composition and proportion of each polymorph in the sample. Collectively, this work provides a strong support for the pronounced sensitivity of α-syn fibril structures to the environmental conditions and systematically categorizes previously reported α-syn fibril structures. Furthermore, the identification of JOS-like polymorph also demonstrates the possibility of in vitro reconstruction of brain-derived α-syn fibril structures.

      Weaknesses

      All my previous concerns have been resolved to my satisfaction.

    1. Reviewer #2 (Public Review):

      Summary:

      There is significant interest in characterizing the mechanisms by which genetic mutations linked to autoimmunity perturb immune processes. Pahl et al. collect information of dynamic accessible regions, genes, and 3D contacts in primary CD4+ T cell samples that have been stimulated ex vivo. The study includes a variety of analyses characterizing these dynamic changes. With TF footprinting they propose factors linked to active regulatory elements. They compare the performance of their variant mapping pipeline that uses their data versus existing datasets. Most compelling there was a deep dive into additional study of regulatory elements nearby the IL2 gene. Finally, they perform a pharmacological screen targeting several genes they suggest are involved in T cell proliferation.

      Strengths:

      - The work done characterizing elements at the IL2 locus is impressive.

      Weaknesses:

      - There are extensive studies performed on resting and activated immune cell states (CD4+ T cells and other cell types) and some at multiple time points or concentrations of stimuli that collect ATAC-seq and/or RNA-seq. Several analyses performed in published studies were similarly performed in this study. I expected the authors to at least briefly mention published studies and whether their conclusions generally agree or disagree. Are the same dynamic regulatory regions or genes identified upon T cell activation? Are the same TF footprints enriched in these dynamic regulatory elements? In the revision, I appreciate that the authors now include additional data from several studies that I had initially suggested for the purposes of nominating disease genes in their precision-recall analysis.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors aimed to elucidate the role of AARS2, an alanyl-tRNA synthase, in mouse hearts, specifically its impact on cardiac function, fibrosis, apoptosis, and metabolic pathways under conditions of myocardial infarction (MI). By investigating the effects of both deletion and overexpression of AARS2 in cardiomyocytes, the study aims to determine how AARS2 influences cardiac health and survival during ischemic stress.

      The authors successfully achieved their aims by demonstrating the critical role of AARS2 in maintaining cardiomyocyte function under ischemic conditions. The evidence presented, including genetic manipulation results, functional assays, and mechanistic studies, robustly supports the conclusion that AARS2 facilitates cardiomyocyte survival through PKM2-mediated metabolic reprogramming. The study convincingly links AARS2 overexpression to improved cardiac outcomes post-MI, validating the proposed protective AARS2-PKM2 signaling pathway.

      This work may have a significant impact on the field of cardiac biology and ischemia research. By identifying AARS2 as a key player in cardiomyocyte survival and metabolic regulation, the study opens new avenues for therapeutic interventions targeting this pathway. The methods used, particularly the cardiomyocyte-specific genetic models and ribosome profiling, are valuable tools that can be employed by other researchers to investigate similar questions in cardiac physiology and pathology.

      Understanding the metabolic adaptations in cardiomyocytes during ischemia is crucial for developing effective treatments for MI. This study highlights the importance of metabolic flexibility and the role of specific enzymes like AARS2 in facilitating such adaptations. The identification of the AARS2-PKM2 axis adds a new layer to our understanding of cardiac metabolism, suggesting that enhancing glycolysis can be a viable strategy to protect the heart from ischemic damage.

      Strengths:

      (1) Comprehensive Genetic Models: The use of cardiomyocyte-specific AARS2 knockout and overexpression mouse models allowed for precise assessment of AARS2's role in cardiac cells.

      (2) Functional Assays: Detailed phenotypic analyses, including measurements of cardiac function, fibrosis, and apoptosis, provided evidence for the physiological impact of AARS2 manipulation.

      (3) Mechanistic Insights: This study used ribosome profiling (Ribo-Seq) to uncover changes in protein translation, specifically highlighting the role of PKM2 in metabolic reprogramming.

      (4) Therapeutic Relevance: The use of the PKM2 activator TEPP-46 to reverse the effects of AARS2 deficiency presents a potential therapeutic avenue, underscoring the practical implications of the findings.

      Weaknesses:

      (1) Species Limitation: The study is limited to mouse and rat models, and while these are highly informative, further validation in human cells or tissues would strengthen the translational relevance.

      (2) Temporal Dynamics: The study does not extensively address the temporal dynamics of AARS2 expression and PKM2 activity during the progression of MI and recovery, which could offer deeper insights into the timing and regulation of these processes.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper from the Barford lab describes medium/high-resolution cryo-EM structures of three versions of the S. cerevisiae anaphase-promoting complex/cyclosome (APC/C):

      (1) the recombinant apo complex purified from insect cells,

      (2) the apo complex phosphorylated in vitro by cyclin-dependent kinase, and

      (3) an active APC/C-Cdh1-substrate ternary complex.

      The focus of the paper is on comparing similarities and differences between S. cerevisiae and human APC/C structures, mechanisms of activation by coactivator, and regulation by phosphorylation. The authors find that the overall structures of S. cerevisiae and human APC/C are remarkably similar, including the binding sites and orientation for the substrate-recruiting coactivator, Cdh1. In addition, the mechanism of Cdh1 inhibition by phosphorylation appears conserved across kingdoms. However, key differences were also observed that reveal divergence in APC/C mechanisms that are important for researchers in this field to know. Specifically, the mechanism of APC/C-Cdc20 activation by mitotic phosphorylation appears to be different, due to the absence of the key Apc1 autoinhibition loop in the S. cerevisiae complex. In addition, the conformational activation of human APC/C by coactivator binding was not observed in the S. cerevisiae complex, implying that stimulation of E2 binding must occur via a different mechanism in this species.

      Strengths:

      Consistent with the numerous prior cryo-EM structures of human APC/C from the Barford lab, the technical quality of the structure models is a major strength of this work. In addition, the detailed comparison of similarities and differences between the two species will be a very valuable resource for the scientific community. The manuscript is written very well and allows readers lacking expertise in cryo-EM to understand the important aspects of the conservation of APC/C structure and mechanism across kingdoms.

      Weaknesses:

      The lack of experimentation in this work to test some of the putative differences in APC/C mechanism (e.g. stimulation of E2 binding by coactivator and stimulation of activity by mitotic phosphorylation) could be considered a weakness. Nonetheless, the authors do a nice job explaining how the structure interpretations imply these differences likely exist, and this work sets the stage nicely for future studies to understand these differences at a mechanistic level. There is enough value in having the S. cerevisiae structure models and the comparison to the human structures, without any additional experimentation.

      The validation of APC/C phosphorylation in the unphosphorylated and hyperphosphorylated states is not very robust. Given the lack of significant effects of phosphorylation on APC/C structure observed here (compared to the human complex), this becomes important. A list of phosphorylation sites identified by mass spec before and after in vitro phosphorylation is provided but lacks quantitative information. This list indicates that a significant number of phosphorylation sites are detected in the purified APC/C prior to reaction with purified kinases. Many more sites are detected after in vitro kinase reaction, but it isn't clear how extensively any of the sites are modified. There is reason for caution then, in accepting the conclusions that structures of unphosphorylated and hyperphosphorylated APC/C from S. cerevisiae are nearly identical.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In this manuscript the authors examine the question of whether discrete action sequences and coarticulated continuous sequential actions can be produced from the same controller, without having to derive separate control policies for each sequential movement. Using modeling and behavioral experiments, the authors demonstrate that this is indeed possible if the constraints of the policy are appropriately specified. These results are of interest to those interested in motor sequences, but it is unclear whether these findings can be interpreted to apply to the control of sequences more broadly (see weaknesses below).

      Strengths:<br /> The authors provide an interesting and novel extension of the stochastic optimal control model to demonstrate how different temporal constraints can lead to either individual or coarticulated movements. The authors use this model to make predictions about patterns of behavior (e.g., in response to perturbations), which they then demonstrate in human participants both by measuring movement kinematics as well as EMG. Together this work supports the authors' primary claims regarding how changes in task instructions (i.e., task constraints) can result in coarticulated or separated movement sequences and the extent to which the subsequent movement goal affects the planning and control of the previous movement.

      Weaknesses:<br /> Although this work is quite interesting, it remains unknown whether there is a fundamental distinction between a coarticulated sequence and a single movement passing through a via point (or equivalently, avoiding an obstacle). The notion of a coarticulated sequence brings with it the notion of sequential (sub)movements and temporal structure, whereas the latter can really be treated as more of a constraint on the production of a single continuous movement. The authors suggest that these are not truly different kinds of movements at the level of a control policy, but this remains to be tested experimentally.

      It also remains unclear for the theory of optimal feedback control as a whole where and how the cost function and constraints are specified to guide the optimization process. That is, presumably there is the ability for higher-level or explicit description of these constraints, but how they then become incorporated into a control policy remains unclear. With regard to the kind of multi-target constraints proposed here, in typical sequence tasks, while some movements become coarticulated, people also tend to form chunks with distinct chunk boundaries. This presumably means that there is at least some specification of the sequential ordering of these chunks that must exist beyond the control policy and that multiple control policies may still be warranted to execute an entire sequence (otherwise the authors' model might suggest that people can coarticulate forever without needing to exhibit any chunk boundaries). Hence, while the authors fairly convincingly show that a single control policy can lead to separated or coarticulated movements given an appropriate set of constraints, their work does not speak to where or how those constraints are specified, nor to how longer sequences are controlled.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper addresses an important computational problem in learning and memory. Why do related memory representations sometimes become more similar to each other (integration) and sometimes more distinct (differentiation)? Classic supervised learning models predict that shared associations should cause memories to integrate, but these models have recently been challenged by empirical data showing that shared associations can sometimes cause differentiation. The authors have previously proposed that unsupervised learning may account for these unintuitive data. Here, they follow up on this idea by actually implementing an unsupervised neural network model that updates the connections between memories based on the amount of coactivity between them. The authors use their modeling framework to simulate three recent empirical studies, showing that their model captures aspects of these findings that are hard to account for with supervised learning.

      Overall, this is a strong and clearly described work that is likely to have a positive impact on computational and empirical work in learning and memory. While the authors have written about some of the ideas discussed in this paper previously, a fully implemented and openly available model is a clear advance that will benefit the field. It is not easy to translate a high-level description of a learning rule into a model that actually runs and behaves as expected. The fact that the authors have made all their code available makes it likely that other researchers will extend the model in numerous interesting ways, many of which the authors have discussed and highlighted in their paper.

      Strengths:

      The authors succeed in demonstrating that unsupervised learning with a simple u-shaped rule can produce results that are qualitatively in line with the empirical reports. In each of the three models, the authors manipulate stimulus similarity (following Chanales et al.), shared vs distinct associations (following Favila et al.), or learning strength (a stand-in for blocked versus interleaved learning schedule; following Schlichting et al.). In all cases, with hand-tuning of additional parameters, the authors are able to produce model representations that fit the empirical results, but that can't easily be accounted for by supervised learning. Demonstrating these effects isn't trivial and a formal modeling framework for doing so is a valuable contribution. Overall, the work is very thorough. The authors investigate many different aspects of the learning dynamics (learning rate, oscillation strength, hidden layer overlap etc) in these models and produce several key insights. Of particular value are their demonstrations that when differentiation occurs, it occurs very quickly and asymmetrically and results in anti-correlated representations, as well as the distinction between symmetric and asymmetric integration in their model. The authors thoroughly acknowledge the relative difficulty of producing differentiation in their models relative to integration, and are now more clear about why they don't necessarily view this as mismatch with the empirical data. The authors are also more clear about the complicated activation dynamics in their model and why critical ranges for some parameters can't be given -- the number of interacting parameters mean that there are many combinations that could produce the critical activation dynamics and thus the same result. Despite this complexity, the paper is very clearly written; the authors do a good job of both formally describing their model as well as giving readers a high level sense of how many of their critical model components work.

      Weaknesses:

      Though the u-shaped learning rule is essential to this framework, the paper doesn't do any formal investigation of this learning rule or comparison with other learning rules. The authors do have a strong theoretical interest in this rule as well as experimental precedent for testing this rule, which they now thoroughly discuss in the paper. Still, a stronger argument in support of the non monotonic plasticity hypothesis could have been made by comparing this learning rule to alternatives. Additionally, the authors' choice of strongly prewiring associations makes it difficult to think about how their model maps onto experimental contexts where associations are only weakly learned. However, the authors thoroughly acknowledge why this was necessary and discuss this limitation in the paper.

    1. Reviewer #2 (Public Review):

      The study by Link et al. advances our understanding of the actomyosin system in T. brucei, focusing on the role of TbMyo1, a class I myosin, within the parasite's endosomal system. Using a combination of biochemical fractionation, in vitro motility assays, and advanced imaging techniques such as correlative light and electron microscopy (CLEM), this paper demonstrates that TbMyo1 is dynamically distributed across early and late endosomes, the cytosol, is associated with the cytoskeleton, and a fraction has an unexpected association with glycosomes. Notably, the study shows that TbMyo1 can translocate actin filaments at velocities suggesting an active role in intracellular trafficking, potentially higher than those observed for similar myosins in other cell types. This work not only elucidates the spatial dynamics of TbMyo1 within T. brucei but also suggests its broader involvement in maintaining the complex architecture of the endosomal network, underscoring the critical role of the actomyosin system in a parasite that relies on high rates of endocytosis for immune evasion.

      A key strength of the study is its exceptional rigor and successful integration of a wide array of sophisticated techniques, such as in vitro motility assays, and advanced imaging methods, e.g. CLEM. This combination of approaches underscores the study's comprehensive approach to examining the ultrastructural organization of the trypanosome endomembrane system. The application of functional data using inhibitors, such as latrunculin A for actin depolymerization, further strengthens the study by providing insights into the dynamics and regulatory mechanisms of the endomembrane system. This demonstrates how the actomyosin system contributes to cellular morphology and trafficking processes. Furthermore, the discovery of TbMyo1 localization to glycosomes introduces a novel aspect to the potential roles of myosin I proteins within the cell, particularly in the context of organelles analogous to peroxisomes. This observation not only broadens our understanding of myosin I functionality but also opens up new avenues for research into the cell biology of trypanosomatids, marking a significant contribution to the field.

      A significant initial weakness was the reliance on spatial association data to infer functional relationships without direct demonstration of biochemical activities in vivo. The authors have since addressed this by including new evidence from TbMyo1 RNAi cell lines and EM data that show the effects of TbMyo1 depletion on cellular ultrastructure. The authors' responses and additional data reinforce their initial conclusions and address previous concerns. Several new, elegant hypotheses are proposed in the discussion that warrant further investigation to fully understand TbMyo1's interactions and regulatory mechanisms in vivo.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors set out to uncover which brain regions might support the continuous updating of semantic associations thereby showing a system of semantic plasticity. Using fMRI data from participants viewing thousands of natural scene images over 30 recording sessions, they hoped to establish how objects co-occuring with each other within images influences the semantic representations in the human brain that relate to those object concepts.

      Strengths:

      There is a lot to like about the paper. A major strength of the methods and results is the convincing demonstration of many of the results. This includes showing item representations in the ventral visual pathway and medial temporal lobes (MTL), as we would expect. They also show semantic effects - defined using the word co-occurrence vectors from word2vec, along the posterior and anterior ventral visual pathway and MTL - replicating various past studies. The authors use a creative approach to show that the item representations measured within each session are modulated by the co-occurrence structure in previous trials, becoming more closely related. And that item representations seem to subtly change over the course of the 30 sessions, in that they become less related to each other with increasing distance. However, the semantic effects within each session itself are claimed to remain unchanged.

      Weaknesses:

      This leads to what I see as a weakness in the study. The conclusions relate to semantic plasticity and the changes in semantic (associative) representations. The drift analyses do appear to show representational changes across the sessions, but this is based on the item representations. The inference is that this is due to an updating of knowledge about the associations each item has had with other items. Yet, in the same regions, the authors suggest that semantic associative effects, as tested using word2vec for each session, remain stable. Doesn't this seem to contradict the claims about semantic plasticity?

      Some of this is difficult to unpick as the semantic stability analysis using word2vec in each session is only very briefly mentioned, and the data is not shown (I would include it). So, at present, I feel they show evidence of representational changes but do not show evidence of what the nature of the change is. If the neural representations consistently reflect the long-term semantic associations (which is what word2vec captures), then how does this combine with the drift effects of item representations?

      Does it mean that the changes in item representations do not reflect semantic associative knowledge? And reflect some other non-specified type of information (perhaps as the participants are doing an image memory test).

      Another potential weakness is the robustness of the drift analysis itself. For the drift analysis, item representations in each session are compared to all other sessions and then averaged according to the number of intervening sessions. This means the data for item representation with a session difference of 1 will be based on 29 data points, a session difference of 2 on 28 data points ... and a session difference of 29 based on 1 data point. So there is a huge imbalance in the amount of data that goes into the analysis for the different numbers of intervening sessions. This leads me to wonder if it could impact the validity of the results. An alternative might be to use 1 datapoint for each session (or a suitable value, I imagine 5 would still give enough data to analyse drifts) and calculate drift, and then repeat this with different partitions of the data to see how stable it is, and if drift is reliably occurring. Alternatively, the analyses they use might have been used and validated previously.

      To be clear, I do think this is a very nice study and will have a positive impact on researchers interested in object processing, semantic knowledge, statistical learning, and schemas. But think there are some gaps between what the data shows evidence for, and the ultimate inferences made.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript, "Activation of Polycystin-1 Signaling by Binding of Stalk-derived Peptide Agonists", by Miao and coworkers. The autosomal dominant polycystic kidney disease (ADPKD) is a major form of polycystic kidney disease (PKD). To provide better treatment and avoid side effects associated with currently available options, the authors investigated an interesting GPCR, polycystin-1 (PC1), as a potential therapeutic target. In vitro and in silico studies were combined to identify peptide agonists for PC1 and to elucidate their roles in PC1 signaling. Overall, regarding the significance of the findings, this work described valuable peptide agonists for PC1 and the combined in vitro and in silico approach can be useful to study a complex system like PC1. However, the strength of the evidence is incomplete, as more experiments are needed as controls to validate the computational observations. The work appears premature.

      Strengths:

      (1) This work first described the experimental discovery of short peptides designed to mimic the stalk region of PC1, followed by computational investigation using docking and MD simulations. PC1 is a complex membrane protein and an emerging target for ADPKD, but it can be challenging to study. The knowledge and the peptide discovery can be valuable and useful to understand the mechanism and potential modulation of PC1.<br /> (2) The authors published the mechanistic study of PC1 and identified key interacting residues such as N3074-S3585 and R3848-E4078, using very similar techniques (PNAS 2022, 119(19), e2113786119). This work furthers this research by identifying peptides that are stalk mimics for PC1 activation.<br /> (3) Eight peptides were designed and tested experimentally first; three were computationally studied with docking and GaMD simulations to understand their mechanism (s).

      Weaknesses:

      (1) The selectivity of the peptides between PC1 and PC2 remains unknown in this revision.

      Overall, my comments were mostly addressed properly.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Djebar et al investigated the role and the underlying mechanism of the ciliary transition zone protein Rpgrip1l in zebrafish spinal alignment. They showed that rpgrip1l mutant zebrafish develop a nearly full penetrance of body curvature at juvenile stages. The mutant fish have cilia defects associated with ventricular dilations and loss of the Reissner fibers. Scoliosis onset and progression are also strongly associated with astrogliosis and neuroinflammation, and anti-inflammatory drug treatment prevents scoliosis in mutant zebrafish, suggesting a novel pathogenic mechanism for human idiopathic scoliosis. This study is quite comprehensive with high quality data, and the manuscript is well written, providing important information on how the ciliary transition zone protein functions in maintaining the zebrafish body axis straightness.

      Strengths:

      Very clear and comprehensive analysis of the mutant zebrafish.

    1. Reviewer #2 (Public Review):

      In this manuscript, the authors attempted to study mechanisms of transcription inhibition in cells treated with IR. They observed that unlike transcription inhibition induced by UV damage that depends on histone chaperone HIRA, IR induced transcription inhibition is independent on HIRA. Through a CRISPR/Cas9 screen, they identified protein neddylation is important for transcription inhibition. By sequencing nascent RNA, they observed that down-regulated transcripts upon IR treatment are largely highly transcribed genes including histone genes and rDNA.

      This study utilized comprehensive approaches to fill in knowledge gap of IR-induced transcription inhibition.

      Comments on current version:

      The revised manuscript largely addressed my concerns.

    1. Reviewer #2 (Public Review):

      Summary:

      In the manuscript by Oestreicher et al, the authors use patch-clamp electrophysiology, immunofluorescent imaging of the cochlea, auditory function tests, and single-unit recordings of auditory afferent neurons to probe the unique properties of calcium signaling in cochlear hair cells that allow rapid and sustained neurotransmitter release. The calcium binding proteins (CaBPs) are thought to modify inactivation of the Cav1.3 calcium channels in IHCs that initiate vesicle fusion, reducing the calcium-dependent inactivation (CDI) of the channels to allow sustained calcium influx to support neurotransmitter release. The authors use knockout mice of Cabp1 and Cabp2 in a double knockout (Cabp1/2 DKO) to show that these molecules are required for enabling sustained calcium currents by reducing CDI, enabling proper IHC neurotransmitter release. They further support their evidence by re-introducing Cabp2 using injection of AAV containing the Cabp2 sequence into the cochlea, which restores some of the auditory function and reduces CDI in patch-clamp recordings.

      Strengths:

      Overall the data is convincing that Cabp1/2 is required for reducing CDI in cochlear hair cells, allowing their sustained neurotransmitter release and sound encoding. Figures are well-prepared, recordings are careful and stats are appropriate, and the manuscript is well written. The discussion appropriately considers aspects of the data that are not yet explained and await further experimentation.

      Weaknesses:

      There are some sections of the manuscript that pool data from different experiments with slightly different conditions (wt data from a previous paper, different calcium concentrations, different holding voltages, tones vs clicks, etc). This makes the work harder to follow and more complicated to explain. However, the major conclusion, that that cabp1 and 2 work together to reduce calcium dependent inactivation of L-type calcium channels in cochlear inner hair cells, still holds and is well supported. Another minor weakness is that the authors used injections of AAV containing sequences for Cabp2, but do not present data from sham surgeries. In most cases, the improvement of hearing function with AAV injection is believable and should be attributed to the cabp2 function. However, in at least one instance (Figure 4B), the results of the AAV injection experiments may be overinterpreted - the authors show that upon AAV injection, the hair cells have a much longer calcium current recovery following a large, long depolarization to inactivate the calcium channels. Without comparison to a sham surgery, it is not known if this result could be a subtle result of the surgery or indeed due to the Cabp2 expression. The authors have added text acknowledging this, as appropriate.

    1. Reviewer #3 (Public Review):

      In this study, Wang and coworkers established a model of Drosophila-S. marcescens interactions and thoroughly examined host-microbe bidirectional interactions. They found that:

      (1) Drosophila larvae directly impact microbial aggregation and density;<br /> (2) Drosophila larvae affect microbial metabolism and cell wall morphology, as evidenced by reduced prodigiosin production and EPS production, respectively;<br /> (3) Drosophila larvae attenuate microbial virulence;<br /> (4) Drosophila larvae modulate the global transcription of microbes for adaptation to the host;<br /> (5) Microbial single-cell RNA sequencing (scRNA-seq) analysis revealed heterogeneity in microbial pathogenicity and growth;<br /> (6) AMPs are key factors controlling microbial virulence phenotypes.

      Taken together, they concluded that host immune factors such as AMPs are directly involved in the pathogen-to-commensal transition by altering microbial transcription.

      In general, in this revised version, I feel that the authors addressed all the points raised in the previous review process. Specifically, they demonstrated that sub-lethal doses of antibiotics such as kanamycin or ampicillin is sufficient to induce the virulence switch in S. marcescens. Furthermore, by testing IMD pathway mutant animals, they concluded that AMP plays a major role in the commensal-to-pathogen transition. In summary, I appreciate the authors' efforts, and I am satisfied with the revision.

    1. Reviewer #2 (Public Review):

      This study by Bell et al. focuses on understanding the roles of two alternatively spliced exons in the single Drosophila Cav2 gene cac. The authors generate a series of cac alleles in which one or the other mutually exclusive exons are deleted to determine the functional consequences at the neuromuscular junction. They find alternative splicing at one exon encoding part of the voltage sensor impacts the activation voltage as well as localization to the active zone. In contrast, splicing at the second exon pair does not impact Cav2 channel localization, but it appears to determine the abundance of the channel at active zones. Together, the authors propose that alternative splicing at the Cac locus enables diversity in Cav2 function generated through isoform diversity generated at the single Cav2 alpha subunit gene encoded in Drosophila.

      Overall this is an excellent, rigorously validated study that defines unanticipated functions for alternative splicing in Cav2 channels. The authors have generated an important toolkit of mutually exclusive Cac splice isoforms that will be of broad utility for the field, and show convincing evidence for distinct consequences of alternative splicing of this single Cav2 channel at synapses. Importantly, the authors use electrophysiology and quantitative live sptPALM imaging to determine the impacts of Cac alternative splicing on synaptic function. There are some outstanding questions regarding the mechanisms underlying the changes in Cac localization and function, and some additional suggestions are listed below for the authors to consider in strengthening this study. Nonetheless, this is a compelling investigation of alternative splicing in Cav2 channels that should be of interest to many researchers.

    1. Reviewer #2 (Public Review):

      Guan and colleagues address the question of how a single neuroblast produces a defined number of progeny, and what influences its decommissioning. The focus of the experiments are two well-studied RNA-binding proteins: Imp and Syp. The Authors find that these factors play an important role in determining the number of neurons in their preferred model system of VNC motor neurons coming from a single lineage (LinA/15) by separate functions taking place at specific stages of development of this lineage: influencing the life-span of the LinA neuroblast to control its timely decommissioning and functioning in the Late-born post-mitotic neurons to influence cell death after the appropriate number of progeny is generated. The post-mitotic role of Imp/Syp in regulating programmed-cell death (PCD) is also correlated with a specific code of key transcription factors that are suspected to influence neuronal identity, linking the fate of neuronal survival with its specification. This paper addresses a wide scope of phenotypes related to the same factors, thus providing an intriguing demonstration of how the nervous system is constructed by context-specific changes in key developmental regulators. The bulk of conclusions drawn by the authors are supported by careful experimental evidence, and the findings are a useful addition to an important topic in developmental neuroscience.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors present an interesting technique for analysis of diffusion magnetic resonance images (dMRI) using a sub-diffusion model of the diffusion process. They show that the results of their technique when fitted to dMRI with two diffusion times provide robust diffusion coefficient and kurtosis measures.

      Strengths:

      The measures provided by the sub-diffusion technique are robust and can be reliably estimated from short dMRI data acquisitions. This is potentially useful in application to clinical studies.

      Weaknesses:

      The authors do not fully demonstrate that their D* and K* measures are not affected by diffusion time. Potential limitations of the technique are not considered.

      This reviewer suggests that the paper would benefit from considerations of the limitations of the applied techniques. This would include consideration of:<br /> (i) The use of the sub-diffusion model in the simulation studies - there are circular arguments that should be considered.<br /> (ii) The time dependence of D* and K*. This is because the human data provided in Tables 3 and 4 (for Δ=19ms and Δ=49ms) seem to show that<br /> D* and K* are time dependent.

      With respect to the second point this reviewer acknowledges the authors' argument that when the fitting is performed over the higher dimensional space that includes multiple diffusion times then this leads to a more robust estimation of sub-diffusion measures. However, the authors only include two diffusion times in their in-vivo human analysis (Δ=19ms and Δ=49ms) so it is not possible for them to show here that different pairs of diffusion times lead to invariant D* and K* values. This is a limitation of the study as the authors show there is time dependence of D* and K* in tables 3 and 4 (when the model is fitted to single diffusion times). Potentially the larger apparent time dependence of K* in white matter compared to grey matter (tables 3 and 4) could lead to the tissue specific differences in root mean squared error shown in Figure 7.

      This reviewer requests that the authors discuss their results more clearly with respect to these potential limitations and include some discussion of their single (and multiple) diffusion time results (for D_SUB and K*) in comparison with the time dependent DKI literature.

    1. Reviewer #2 (Public Review):

      Summary:<br /> Replacing linezolid (L) with the preclinical development candidate spectinamide 1599, administered by inhalation, in the BPaL standard of care regimen achieves similar efficacy, reduces hematological changes and por-inflammatory responses.

      Strengths:<br /> The authors not only measure efficacy but also quantify histological changes, hematological responses and immune responses, to provide a comprehensive picture of treatment response and the benefits of the L to S substitution.

      The authors generate all data in two mouse models of TB infection, each reproducing different aspects of human histopathology.

      Extensive supplementary figures ensure transparency.

      Weaknesses:<br /> Articulation of objectives and hypotheses can be improved, as suggested below.

    1. Reviewer #2 (Public Review):

      Strengths:

      The experiments were well-designed and executed with meticulous control. The analyses of both behavioural and electrophysiological data align with the standards in the field.

      Weaknesses:

      Many of the findings appear to be subtle differences and incremental compared to previous literature, including the authors' own work. While incremental findings are not necessarily a problem, the manuscript lacks clear statements about the extent to which the dataset, analysis, and findings overlap with the authors' prior research. For example, one of the main findings, which suggests that V4 neurons exhibit larger visual responses in hit trials (as shown in Fig. 3), appears to have been previously reported in their 2017 paper.

      Furthermore, the manuscript does not explore potentially interesting aspects of the dataset. For instance, the authors could have investigated instances where monkeys made 'false' reports, such as executing saccades towards visual stimuli when no orientation change occurred, which allows for a broader analysis that considers the perceptual component of neural activity over pure sensory responses. Overall, lacking broad interest with the current form.

    1. Reviewer #2 (Public Review):

      Studying Apteronotus leptorhynchus (the weakly electric brown ghost knifefish), the authors provide evidence that 'chirps' (brief modulations in the frequency and amplitude of the ongoing wave-like electric signal) function in active sensing (specifically homeoactive sensing) rather than communication. Chirping is a behavior that has been well studied, including numerous studies on the sensory coding of chirps and the neural mechanisms for chirp generation. Chirps are largely thought to function in communication behavior, so this alternative function is a very exciting possibility that should have a great impact on the field.

      The authors provide convincing evidence that chirps may function in homeoactive sensing. In particular, the evidence showing increased chirping in more cluttered environments and a relationship between chirping and movement are especially strong and suggestive. Their evidence arguing against a role for chirps in communication is not as strong. However, based on an extensive review of the literature, the authors conclude, I think fairly, that the evidence arguing in favor of a communication function is limited and inconclusive. Thus, the real strength of this study is not that it conclusively refutes the communication hypothesis, but that it calls this hypothesis into question while also providing compelling evidence in favor of an alternative function.

      In summary, although the evidence against a role for chirps in communication is not as strong as the evidence for a role in active sensing, this study presents very interesting data that is sure to stimulate discussion and follow-up studies. The authors acknowledge that chirps could function as both a communication and homeactive sensing signal, and the language arguing against a communication function is appropriately measured. A given electrical behavior could serve both communication and homeoactive sensing. I suspect this is quite common in electric fish (not just in gymnotiforms such as the species studied here, but also in the distantly related mormyrids), and perhaps in other actively sensing species such as echolocating animals.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript reports a comparison of microbial traits and host response traits in a laboratory model of infected granuloma using Mtb strains from different lineages. The authors report increased bacillary growth and granuloma formation, inversely associated with T cell activation that is characterized by CXCL9, granzyme B, and TNF expression. They therefore infer that these T cell responses are likely to be host-protective and that the greater virulence of modern Mtb lineages may be driven by their ability to avoid triggering these responses.

      Strengths:

      The comparison of multiple Mtb lineages in a granuloma model that enables evaluation of the potential role of multiple host cells in Mtb control offers a valuable experimental approach to studying the biological mechanisms that underpin differential virulence of Mtb lineages that have been previously reported in clinical and epidemiological studies.

      Weaknesses:

      The study is rather limited to descriptive observations and lacks experiments to test causal relationships between host and pathogen traits. Some of the presentation of the data is difficult to interpret, and some conclusions are not adequately supported by the data.

    1. Reviewer #2 (Public Review):

      Choi et al. describe a new approach for enabling input-specific CRISPR-based genome editing in cultured cells. While CRISPR-Cas9 is a broadly applied system across all of biology, one limitation is the difficulty in inducing genome editing based on cellular events. A prior study, from the same group, developed ENGRAM - which relies on activity-dependent transcription of a prime editing guide RNA, which records a specific cellular event as a given edit in a target DNA "tape". However, this approach is limited to the detection of induced transcription and does not enable the detection of broader molecular events including protein-protein interactions or exposure to small molecules. As an alternative, this study envisioned engineering the reconstitution of a split prime editing guide RNA (pegRNA) in a protein-protein interaction (PPI)-dependent manner. This would enable location- and content-specific genome editing in a controlled setting.

      The authors explored three different design possibilities for engineering a PPI-dependent split pegRNA. First, they tried splitting pegRNA into a functional sgRNA and corresponding prime editing transRNA, incorporating reverse-complementary dimerization sequences on each guide half. This approach, however, resulted in low editing efficiency across 7 different designs with various complementary annealing template lengths (<2% efficiency). They also tried inserting a self-splicing ribozyme within the pegRNA, which produces a functional pegRNA post-transcriptionally. The incorporation of a split-ribozyme, dependent on a PPI, could have been used to reconstitute the split pegRNA in an event-controlled manner. However again, only modest levels of editing were observed with the self-splicing ribozyme design (<2%). Finally, they tried splitting the pegRNA at the repeat:anti-repeat junction that was used to join the original dual-guide system comprised of a crRNA and tracrRNA, into a single-guide RNA. They incorporated the prime editing features into the tracrRNA half, to create petracrRNA. Dimerization was initially induced by different complementary RNA annealing sequences. Using this design, they were able to induce an editing efficiency of ~28% (compared to 37% efficiency using a positive control epegRNA guide).

      Having identified a suitable split pegRNA system, they next sought to induce the reconstitution of the two halves in a PPI-dependent manner. They replaced the complementary RNA annealing sequences with two different RNA aptamers (MS2 and BoxB). MS2 detects the MCP protein, while BoxB detects the LambdaN protein. Close proximity between MCP and LambdaN would thus bring together the two split pegRNA halves, creating a functional pegRNA that would enable prime editing at a specific target site. They demonstrated that they could induce MCP-BoxB proximity by fusing them to different dimerizing protein partners: 1) constitutive epitope-nanobody/antibody pairs such as scFv/GCN4 or NbALFA/ALFA-Tag; 2) split-GFP; or 3) chemically-induced protein pairs such as FKBP/FRB or ABI/PYL. For all of these approaches, they could achieve between ~20-60% normalized editing efficiency (relative to positive control editing levels with epegRNA). Additional mutation of the linkers between the RNA and aptamers could increase editing efficiency but also increase non-specific background editing even in the absence of an induced PPI.

      Additional applications of this overall strategy included incorporating the design with different DNA base editors, with the most promising examples shown with the base editors CBE4max and ABE8. It should be noted that these specific examples used a non-physiological LambdaN-MCP direct fusion protein as the "bait" that induced reconstitution of the two halves of the guideRNA, rather than relying on a true induced PPI. They also demonstrated that the recently reported RADARS strategy could be incorporated into their system. In this example, they used an ADAR-guide-RNA to drive the expression of a LambdaN-PCP fusion protein in the presence of a specific target RNA molecule, IL6. This induced LambdaN-PCP protein could then reconstitute the split peg-RNAs to drive prime editing. To enable this last application, they replaced the MS2 aptamer in their pegRNA with the PP7 aptamer that binds the PCP protein (this was to avoid crosstalk with RADARS, which also uses MS2/MCP interaction). Using this strategy, they observed a normalized editing efficiency of around 12% (but observed non-specific editing of around 8% in the absence of the target RNA).

      Strengths:

      The strengths of this paper include an interesting concept for engineering guide RNAs to enable activity-dependent genome editing in living cells in the future, based on discreet protein-protein interactions (either constitutively, spatially, or chemically induced). Important groundwork is laid down to engineer and improve these guide RNAs in the future (especially the work describing altering the linkers in Supplementary Figure 3 - which provides a path forward).

      Weaknesses:

      In its current state, the editing efficiency appears too low to be applied in physiological settings. Much of the latter work in the paper relies on a LambdaN-MCP direction fusion protein, rather than two interacting protein pairs. Further characterizations in the future, especially varying the transfection amounts/durations/etc of the various components of the system, would be beneficial to improve the system. It will also be important to demonstrate editing at additional sites; to characterize how long the PPI must be active to enable efficient prime editing; and how reversible the reconstitution of the split pegRNA is.

    1. Reviewer #2 (Public Review):

      The authors address the question of differences in the development of the central complex (Cx), a brain structure mainly controlling spatial orientation and locomotion in insects, which can be traced back to the neuroblast lineages that produce the Cx structure. The lineages are called type-II neuroblast (NB) lineages and are assumed to be conserved in insects. While Tribolium castaneum produces a functional larval Cx that only consists of one part of the adult Cx structure, the fan-shaped body, in Drosophila melanogaster a non-functional neuropile primordium is formed by neurons produced by the embryonic type-II NBs which then enter a dormant state and continue development in late larval and pupal stages.

      The authors present a meticulous study demonstrating that type-II neuroblast (NB) lineages are indeed present in the developing brain of Tribolium castaneum. In contrast to type-I NB lineages, type-II NBs produce additional intermediate progenitors. The authors generate a fluorescent enhancer trap line called fez/earmuff which prominently labels the mushroom bodies but also the intermediate progenitors (INPs) of the type-II NB lineages. This is convincingly demonstrated by high-resolution images that show cellular staining next to large pointed labelled cells, a marker for type-II NBs in Drosophila melanogaster. Using these and other markers (e.g. deadpan, asense), the authors show that the cell type composition and embryonic development of the type-II NB lineages are similar to their counterparts in Drosophila melanogaster. Furthermore, the expression of the Drosophila type-II NB lineage markers six3 and six4 in subsets of the Tribolium type-II NB lineages (anterior 1-4 and 1-6 type-II NB lineages) and the expression of the Cx marker skh in the distal part of most of the lineages provide further evidence that the identified NB lineages are equivalent to the Drosophila lineages that establish the central complex. However, in contrast to Drosophila, there are 9 instead of 8 embryonic type-II NB lineages per brain hemisphere and the lineages contain more progenitor cells compared to the Drosophila lineages. The authors argue that the higher number of dividing progenitor cells supports the earlier development of a functional Cx in Tribolium.

      While the manuscript clearly shows that type-II NB lineages similar to Drosophila exist in Tribolium, it does not considerably advance our understanding of the heterochronic development of the Cx in these insects. First of all, the contribution of these lineages to a functional larval Cx is not clear. For example, how do the described type-II NB lineages relate to the DM1-4 lineages that produce the columnar neurons of the Cx? What is the evidence that the embryonically produced type-II NB lineage neurons contribute to a functional larval Cx? The formation of functional circuits could rely on larval neurons (like in Drosophila) which would make a comparison of embryonic lineages less informative with respect to understanding the underlying variations of the developmental processes. Furthermore, the higher number of progenitors (and consequently neurons) in Tribolium could simply reflect the demand for a higher number of cells required to build the fan-shaped body compared to Drosophila. In addition, the larger lineages in Tribolium, including the higher number of INPs could be due to a greater number of NBs within the individual clusters, rather than a higher rate of proliferation of individual neuroblasts, as suggested. What is the evidence that there is only one NB per cluster? The presented schemes (Fig. 7/12) and description of the marker gene expression and classification of progenitor cells are inconsistent but indicate that NBs and immature INPs cannot be consistently distinguished.

      The main difference between Tribolium and Drosophila Cx development with regard to the larval functionality might be that Drosophila type-II NB lineage-derived neurons undergo quiescence at the end of embryogenesis so that the development of the Cx is halted, while a developmental arrest does not occur in Tribolium. However, this needs to be confirmed (as the authors rightly observe).

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript describes a comprehensive analysis of signalling downstream of the chemokine receptor CCR7. A comprehensive dataset supports the authors' hypothesis that G protein and beta-arrestin signalling can occur simultaneously at CCR7 with implications for continued signalling following receptor endocytosis.

      Strengths:

      The experiments are well controlled and executed, employing a wide range of assays using - in the main - CCR7 transfectants. Data are well presented, with the authors' claims supported by the data. The paper also has an excellent narrative which makes it relatively easy to follow. I think this would certainly be of interest to the readership of the journal.

      Weaknesses:

      Since the authors show a differential enrichment of RhoGTPases by CCR7 stimulation with CCL19 versus CCL21, I think that they also need to show that the Gi/o coupling of HEK-292-CCR7-APEX2 cells to both CCL19 and CCL21 is not perturbed by the modification. Currently, the authors only show data for CCL19 signalling, which leaves the potential for a false negative finding in terms of CCL21 signalling being selectively impaired. This should be relatively easy to do and should strengthen the authors' conclusions.

      The authors conclude the discussion by suggesting that their findings highlight endosomal signalling as a general mechanism for chemokine receptors in cell migration. I think this is an overreach. The authors chose several studies of CXC chemokine receptors to support their argument that C-terminal truncation or mutation of the C-terminal phosphorylation sites impairs endocytosis and chemotaxis (refs 40-42). However, in some instances e.g. at the related chemokine receptor CCR4, C-terminal removal of these sites impairs endocytosis but promotes chemotaxis (Nakagawa et al, 2014); Anderson et al, 2020). I therefore think that either the final statement needs to be tempered down or the counterargument discussed a little.

      References:

      Anderson, C. A. et al. A degradatory fate for CCR4 suggests a primary role in Th2 inflammation. J Leukocyte Biol 107, 455-466 (2020).

      Nakagawa, M. et al. Gain-of-function CCR4 mutations in adult T cell leukaemia/lymphoma. Journal of Experimental Medicine 211, 2497-2505 (2014).

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Cozzolino et al. demonstrate that inhibition of the Mediator kinase CDK8 and its paralog CDK19 suppresses hyperactive interferon (IFN) signaling in Down syndrome (DS), which results from trisomy of chromosome 21 (T21). Numerous pathologies associated with DS are considered direct consequences of chronic IFN pathway activation, and thus hyperactive IFN signaling lies at the heart of pathophysiology. The collective interrogation of transcriptomics, metabolomics, and cytokine screens in sibling-matched cell lines (T21 vs D21) allows the authors to conclude that Mediator kinase inhibition could mitigate chronic, hyperactive IFN signaling in T21. To probe the functional outcomes of Mediator kinase inhibition, the authors performed cytokine screens, transcriptomic, and untargeted metabolomics. This collective approach revealed that Mediator kinases establish IFN-dependent cytokine responses at least in part through transcriptional regulation of cytokine genes and receptors. Mediator kinase inhibition suppresses cell responses during hyperactive IFN signaling through inhibition of pro-inflammatory transcription factor activity (anti-inflammatory effect) and alteration of core metabolic pathways, including upregulation of anti-inflammatory lipid mediators, which served as ligands for specific nuclear receptors and downstream phenotypic outcomes (e.g., oxygen consumption). These data provided a mechanistic link between Mediator kinase activity and nuclear receptor function. Finally, the authors also disclosed that Mediator kinase inhibition alters splicing outcomes.

      Overall, this study reveals a mechanism by which Mediator kinases regulate gene expression and establish that its inhibition antagonizes chronic IFN signaling through collective transcriptional, metabolic, and cytokine responses. The data have implications for DS and other chronic inflammatory conditions, as Mediator kinase inhibition could potentially mitigate pathological immune system hyperactivation.

      Strengths:

      (1) One major strength of this study is the mechanistic evidence linking Mediator kinases to hyperactive IFN signaling through transcriptional changes impacting cell signaling and metabolism.

      (2) Another major strength of this study is the use of sibling-matched cell lines (T21 vs D21) from various donors (not just one sibling pair), and further cross-referencing with data from large cohorts, suggesting that part of the data and conclusions are generalizable.

      (3) Another major strength of this study is the combined experimental approach including transcriptomics, untargeted metabolomics, and cytokine screens to define the mechanisms underlying suppression of hyperactive interferon signaling in DS upon Mediator kinase inhibition.

      (4) Another major strength of this study is the significance of the work to DS and its potential impact on other chronic inflammatory conditions.

      Weakness:

      (1) Genetic evidence linking the mentioned nuclear receptors to activation of an anti-inflammatory program upon Mediator kinase inhibition could improve the definition of the mechanism and overall impact of the work.

      (2) Page 5 states that "Mediator kinases broadly regulate cholesterol and fatty acid biosynthesis and this was further confirmed by the metabolomics data", but a clear mechanistic explanation was lacking. Likewise, the data suggest but do not prove, that altered lipid metabolites influence the function of nuclear receptors to regulate an anti-inflammatory program in response to Mediator kinase inhibition (p. 6), despite the fact the gene expression changes elicited by Mediator kinase inhibition tracked with downstream metabolic changes.

      (3) The figures are outstanding but dense.

      (4) Figure 6 (PRO-Seq). The authors refer to pro-inflammatory TFs (e.g. NF-kB/RelA). It is not clear whether the authors have specifically examined TF binding at enhancers or more broadly at every region occupied by the interrogated TFs?

    1. Reviewer #2 (Public Review):

      Summary:

      This paper investigates deep-sea bacteriophage systems which appear to employ a chronic replication mechanism that is induced or enhanced by polysaccharide addition. Some preliminary evidence for the potential role of auxiliary metabolic genes in aiding phage and/or host proliferation is also provided. The hypothesis being tested is fully supported with solid and convincing evidence and the findings are potentially generalizable with implications for our understanding of polysaccharide-mediated virus-host interactions and carbon cycling in marine ecosystems more broadly.

      Strengths:

      This paper synthesizes sequencing and phylogenic analyses of two Lentisphaerae bacteria and three phage genomes; electron microscopy imaging of bacterial/phage particles; differential gene expression analyses; differential growth curve analyses, and differential phage proliferation assays to extract insights into whether laminarin and starch can induce both host growth and phage proliferation. The data presented convincingly demonstrate that both host culture density and phage proliferation increase as a result having host, phage, and polysaccharide carbon source together in culture.

      Weaknesses:

      The AMG-centered elements of the article would be strengthened by more "mechanistic" experiments focusing on identifying "HOW" the polysaccharide processing, transport, and metabolism genes are being used by the phages to either directly increase viral infection/replication or else to indirectly do so by supporting the growth of the host (via mutualism). The concept of "selfishness" in bacterial systems and its potential role in viral life cycles could be more developed. Selfish bacteria are active throughout the water column of the ocean. ISME COMMUN. 3, 11 (2023) (see for instance https://doi.org/10.1038/s43705-023-00219-7) and such "selfish" bacteria sequester metabolizable polysaccharides in their periplasm to advantage (https://www.nature.com/articles/ismej201726). It is plausible that phages may be either hijacking such polysaccharide sequestration mechanisms to improve infectivity and ENTRY or else helping their hosts to grow and proliferate so they can reap the benefits of simply having more hosts to infect. The current work does not clearly distinguish between these two distinct mechanistic possibilities. The paper would be strengthened by a more detailed/clear discussion of this possibility.

    1. Reviewer #2 (Public Review):

      This work clarifies neural mechanisms that can lead to a phenomenology consistent with motor preparation in its broader sense. In this context, motor preparation refers to activity that occurs before the corresponding movement. Another property often associated with preparatory activity is a correlation with global movement characteristics such as reach speed (Churchland et al., Neuron 2006), reach angle (Sun et al., Nature 2022), or grasp type (Meirhaeghe et al., Cell Reports 2023). Such activity has notably been observed in premotor and primary motor cortices, and it has been hypothesized to serve as an input to a motor execution circuit. The timing and mechanisms by which such 'preparatory' inputs are made available to motor execution circuits remain however unclear in general, especially in light of the presence of a 'trigger-like' signal that appears to relate to the transition from preparatory dynamics to execution activity (Kaufman et al. eNeuron 2016, Iganaki et al., Cell 2022, Zimnik and Churchland, Nature Neuroscience 2021).

      The preparatory inputs have been hypothesized to fulfill one or several (non-mutually-exclusive) possible objectives. Two notable hypotheses are that these inputs could be shaped to maximize output accuracy under regularization of the input magnitude; or that they may help the flexible re-use of the neural machinery involved in the control of movements in different contexts.

      Here, the authors investigate in detail how the former hypothesis may be compatible with the presence of early inputs in recurrent network models driving arm movements, and compare models to data.

      Strengths:

      The authors are able to deploy an in-depth evaluation of inputs that are optimized for producing an accurate output at a pre-defined time while using a regularization term on the input magnitude, in the case of movements that are thought to be controlled in a quasi-open loop fashion such as reaches.

      First, the authors have identified that optimal control theory is a great framework to study this question as it provides methods to find and analyze exact solutions to this cost function in the case of models with linear dynamics. The authors not only use this framework to get an exact assessment of how much pre-movement input arises in large recurrent networks, but also give insight into the mechanisms by which it happens by dissecting in detail low-dimensional networks. The authors find that two key network properties - observability of the readout's nullspace and limited controllability - give rise to optimal inputs that are large before the start of the movement (while the corresponding network activity lies in the nullspace of the readout). Further, the authors numerically investigate the timing of optimized inputs in models with nonlinear dynamics, and find that pre-movement inputs can also arise in these more general networks. The authors also explore how some variations on their model's constraints - such as penalizing the input roughness or changing task contingencies about the go cue timing - affect their results. Finally, the authors point out some coarse-grained similarities between the pre-movement activity driven by the optimized inputs in some of the models they studied, and the phenomenology of preparation observed in the brain during single reaches and reach sequences. Overall, the authors deploy an impressive arsenal of tools and a very in-depth analysis of their models.

      Oustanding questions that could lead to interesting follow-up work:

      Like all great pieces of research, this article makes it clear where current limitations lie and therefore opens up opportunities for future work.

      (1) Though the optimal control theory framework is ideal for determining inputs that minimize output error while regularizing the input norm or other simple input features, it cannot easily account for some other varied types of objectives - especially those that may lead to a complex optimization landscape. For instance, the reusability of parts of the circuit, sparse use of additional neurons when learning many movements, and ease of planning (especially under uncertainty about when to start the movement), may be alternative or additional reasons that could help explain the preparatory activity observed in the brain. It is interesting to note that inputs that optimize the objective chosen by the authors arguably lead to a trade-off in terms of other desirable objectives. Specifically, the inputs the authors derive are time-dependent, so a recurrent network would be needed to produce them and it may not be easy to interpolate between them to drive new movement variants. In addition, these inputs depend on the desired time of output and therefore make it difficult to plan, e.g. in circumstances when timing should be decided depending on sensory signals. Finally, these inputs are specific to the full movement chain that will unfold, so they do not permit reuse of the inputs e.g. in movement sequences of different orders. Of note, the authors have pointed out in the discussion how their framework may be extended in future work to account for some additional objectives, such as inputs' temporal smoothness or some strategies for dealing with go cue timing uncertainty.

      (2) Relatedly, if the motor circuits were to balance different types of objectives, the activity and inputs occurring before each movement may be broken down into different categories that may each specialize into their own objective. For instance, previous work (Kaufman et al. eNeuron 2016, Iganaki et al., Cell 2022, Zimnik and Churchland, Nature Neuroscience 2021) has suggested that inputs occurring before the movement could be broken down into preparatory inputs 'stricto sensu' - relating to the planned characteristics of the movement - and a trigger signal, relating to the transition from planning to execution - irrespective of whether the movement is internally timed or triggered by an external event. The current work does not address which type(s) of early input may be labeled as 'preparatory' or may be thought of as a part of 'planning' computations, or whether these inputs may come from several different source circuits. Future research could investigate these questions using a different approach, for instance, by including structural constraints from brain architecture into a neural network model.

      (3) While the authors rightly point out some similarities between the inputs that they derive and observed preparatory activity in the brain, notably during motor sequences, there are also some differences. For instance, while both the derived inputs and the data show two peaks during sequences, the data reproduced from Zimnik and Churchland show preparatory inputs that have a very asymmetric shape that really plummets before the start of the next movement, whereas the derived inputs have larger amplitude during the movement period - especially for the second movement of the sequence. In addition, the data show trigger-like signals before each of the two reaches. Finally, while the data show a very high correlation between the pattern of preparatory activity of the second reach in the double reach and compound reach conditions, the derived inputs appear to be more different between the two conditions. Note that the data would be consistent with separate planning of the two reaches even in the compound reach condition, as well as the re-use of the preparatory input between the compound and double reach conditions. Therefore, different motor sequence datasets - notably, those that would show even more coarticulation between submovements - may be more promising for finding a tight match between the data and the author's inputs. In the future, further analyses in these datasets could help determine whether the coarticulation could be due to simple filtering by the circuits and muscles downstream of M1, planning of movements with adjusted curvature to mitigate the work performed by the muscles while permitting some amount of re-use across different sequences, or - as suggested by the authors - inputs fully tailored to one specific movement sequence that maximize accuracy and minimize the M1 input magnitude.

      (4) Though iLQR is a powerful optimization method to find inputs optimizing the author's cost function, it also has some limitations. First, given that it relies on a linearization of the dynamics at each timestep, it has a limited ability to leverage potential advantages of nonlinearities in the dynamics. Second, the iLQR algorithm is not a biologically plausible learning rule and does not account for biological constraints affecting the circuits that produce and process these inputs. Therefore, it might be difficult for the brain to learn to produce the inputs that it finds. Consequently, when observing differences between model and data, this can confound the question of whether it comes from a difference of assumed objective or a difference of optimization procedure or circuit implementation. It remains unclear whether using alternative algorithms with different limitations - for instance, using variants of BPTT to train a separate RNN to produce the inputs in question - could impact some of the results.

      (5) Under the objective considered by the authors, the amount of input occurring before the movement might be impacted by the presence of online sensory signals for closed-loop control. Even if the inputs include some sensory activity and/or the RNN activity could represent all general variables (e.g. sensory) whose states can be decoded from M1, the model does not currently include mechanisms that process imperfect (delayed, noisy) sensory feedback to adapt the output in a trial-specific manner. The information related to such sensory feedback cannot be anticipated, and therefore the related input would have to reach the motor cortex after preparation. Thus, it is an open question whether the objective and network characteristics suggested by the authors could also explain the presence of large preparatory activity before e.g. grasping movements that are thought to be more sensory-feedback-driven (Meirhaeghe et al., Cell Reports 2023).

      (6) More broadly, with the type of objectives that the authors assume the inputs fulfill, some M1 properties that lead to strong preparation - notably, limited readout controllability - may not be favorable for control in general, so it would be interesting if other objectives and assumptions could robustly lead to strong preparation under more general M1 properties.'

    1. Reviewer #2 (Public Review):

      Pyoverdines, siderophores produced by many Pseudomonads, are one of the most diverse groups of specialized metabolites and frequently used as model systems. Thousands of Pseudomonas genomes are available, but large scale analyses of pyoverdines are hampered by the biosynthetic gene clusters (BGCs) being spread across multiple genomic loci and existing tools' inability to accurately predict amino acid substrates of the biosynthetic adenylation (A) domains. The authors present a bioinformatics pipeline that identifies pyoverdine BGCs and predicts the A domain substrates with high accuracy. They tackled a second challenging problem by developing an algorithm to differentiate between outer membrane receptor selectivity for pyoverdines versus other siderophores and substrates. The authors applied their dataset to thousands of Pseudomonas strains, producing the first comprehensive overview of pyoverdines and their receptors and predicting many new structural variants.

      The A domain substrate prediction is impressive, including the correction of entries in the MIBiG database. Their high accuracy came from a relatively small training dataset of A domains from 13 pyoverdine BGCs. The authors acknowledge that this small dataset does not include all substrates, and correctly point out that new sequence/structure pairs can be added to the training set to refine the prediction algorithm. The workflow unfortunately cannot differentiate between different variants of Asp and OHOrn. To validate their predictions, they elucidated structures of several new pyoverdines, and their predictions performed well. The authors tested their workflow on Burkholderiales A domains and had good results, suggesting it can be used on other taxa. Skimming through the source code and data, the algorithm itself appears to be sound and a clear improvement over existing tools for pyoverdine BGC annotation.

      Predicting outer membrane receptor specificity is likewise a challenging problem and the authors have made a promising achievement by finding specific gene regions that differentiate the pyoverdine receptor FpvA from FpvB and other receptor families. Their predictions were not tested experimentally, but the finding that only predicted FpvA receptors were proximate to the biosynthesis genes lends credence to the predictive power of the workflow. The authors find predicted pyoverdine receptors across an impressive 468 genera, an exciting finding for expanding the role of pyoverdines as public goods beyond Pseudomonas. However, whether or not these receptors can actually recognize pyoverdines (and if so, which structures!) remains to be investigated.

      In all, the authors have assembled a rich dataset that will enable large scale comparative genomic analyses. This dataset could be used by a variety of researchers, including those studying natural product evolution, public good eco/evo dynamics, and NRPS engineering.

    1. Reviewer #2 (Public Review):

      Summary:

      One of the greatest challenges for the spliceosome is to be able to repress the many cryptic splice sites that can occur in both the intronic and exotic sequences of genes. Although many studies have focused on cryptic signals in introns (because of their common involvement in disease) the question still remained open as to the factors that repress cryptic exons in exons. Because exons are normally much shorter than introns, in many cases the problem does not exist. However, in human genes a significant proportion of exons can be considerably longer than the average 150 nt length and this raises the question of how cryptic splicing can be prevented in long exons. To address this question, the authors have focused on the possible role played by an ancient mammalian RBD protein called RBMX. Using a combination of high-throughput and classic splicing methodologies, they have shown that there is a class of RBMX-dependent ultra-long exons connected where the RBMX, RBMXL2 and RBMY paralogs have closely related functional activity in repressing cryptic splice site selection.

      Strengths:

      In general, the present work sheds light on what has been a rather understudied process in splicing research. The use of iCLIP and RNA-seq data has not only allowed to identify the long exons where cryptic splicing is prevented by the RBMX proteins but has also allowed to identify a network of genes mostly involved in genome stability and transcriptional control where these proteins seem to play a prominent role. This can therefore also shed additional information on the way splicing has shaped evolutionary processes in the mammalian lineage and will therefore be of interest to many researchers in this field.

      Weaknesses:

      There are no major weaknesses, although some specific aspects of the findings could be addressed more in-depth in the recommendations to authors.

    1. Reviewer #2 (Public Review):<br /> Summary:<br /> This study used a novel diffusion-weighted pseudo-continuous arterial spin labelling (pCASL) technique to simultaneously explore age- and sex-related differences in brain tissue perfusion (i.e., cerebral blood flow (CBF) & arterial transit time (ATT) - a measure of CBF delivery to brain tissue) and blood-brain barrier (BBB) function, measured as the water exchange (kw) across the BBB. While age- and sex-related effects on CBF are well known, this study provides new insights to support the growing evidence of these important factors in cerebrovascular health, particularly in BBB function. Across the brain, decline in CBF and BBB function (kw) and elevation in ATT was reported in older adults, after the age of 60 and more so in males compared to females. This was also evident in key cognitive regions including the insular, prefrontal, and medial temporal regions, stressing the consideration of age and sex in these brain physiological assessments.

      Strengths:<br /> Simultaneous assessment of CBF with BBB along with transit time and at the voxel-level helped elucidate the brain's vulnerability to age and sex-effects. It is apparent that the investigators carefully designed this study to assess regional associations of age and sex with attention to exploring potential non-linear effects.

      Weaknesses:<br /> It appears that no brain region showed concurrent CBF and BBB dysfunction (kw), based on the results reported in the main manuscript and supplemental information. Was an association analysis between CBF and kw performed? There is a potential effect of the level of formal education on CBF (PMID: 12633147; 15534055), which could have been considered and accounted for as well, especially for a cohort with stated diversity (age, race, sex).

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Peng et al., reported that 36THz high-frequency terahertz stimulation (HFTS) can suppress the activity of pyramidal neurons through enhancing the conductance of voltage-gated potassium channel. The authors also demonstrated the effectiveness of using 36THz HFTS for treating neuropathic pain.

      Strengths:

      The manuscript is well written and the conclusions are supported by robust results. This study highlighted the potential of using 36THz HFTS for neuromodulation.

      Weaknesses:

      More characterization of HFTS is needed, so the readers can have a better assessment of the potential usage of HFTS in their own applications.

    1. Reviewer #2 (Public Review):

      Summary:

      Cancer treatments are not just about the tumor - there is an ever-increasing need for treating pain, fatigue, and anhedonia resulting from the disease as patients are undergoing successful but prolonged bouts with cancer. Using an implantable oral tumor model in the mouse, Barr et al describe neural infiltration of tumors, and posit that these nerve fibers are transmitting pain and other sensory signals to the brain that reduce pleasure and motivation. These findings are in part supported by anatomical and transcriptional changes in the tumor that suggest sensory innervation, neural tracing, and neural activity measurements. Further, the authors conduct behavior assays in tumor-bearing animals and inhibit/ablate pain sensory neurons to suggest involvement of local sensory innervation of tumors in mediating cancer-induced malaise.

      Strengths:

      • This is an important area of research that may have implications for improving the quality of life of cancer patients.

      • The studies use a combination of approaches (tracing and anatomy, transcriptional, neural activity recordings, behavior assays, loss-of-function) to support their claims.

      • Tracing experiments suggest that tumor-innervating afferents are connected to brain nuclei involved in oral pain sensing. Consistent with this, the authors observed increased neural activity in those brain areas of tumor-bearing animals. It should be noted that some of these brain nuclei have also been implicated in cancer-induced behavioral alterations in non-head and neck tumor models.

      • Experiments are well-controlled and approaches are validated.

      • The paper is well-written and the layout was easy to follow.

      Weaknesses/Future Directions:

      • The main claim is that tumor-infiltrating nerves underlie cancer-induced behavioral alterations. While the studies are supportive of this conclusion, manipulations in the current study are non-specific, ablating all TRPV1 sensory neurons. A direct test would be to selectively inhibit/ablate nerve fibers innervating the tumor or mouth region.

    1. Reviewer #2 (Public Review):

      Summary

      The authors aimed to investigate the functionality of the GnRH (gonadotropin-releasing hormone) pulse generator in different mouse models to understand its role in reproductive physiology and its implications for conditions like polycystic ovary syndrome (PCOS). They compared the GnRH pulse generator activity in control mice, peripubertal androgen (PPA) treated mice, and prenatal androgen (PNA) exposed mice. The study sought to elucidate how androgen exposure affects the GnRH pulse generator and subsequent LH (luteinizing hormone) secretion, contributing to the pathophysiology of PCOS.

      Strengths

      (1) Comprehensive Model Selection: The use of both PPA and PNA mouse models allows for a comparative analysis that can distinguish the effects of different timings of androgen exposure.

      (2) Detailed Methodology: The methods employed, such as photometry recordings and serial blood sampling, are robust and allow for precise measurement of GnRH pulse generator activity and LH secretion.

      (3) Clear Results Presentation: The experimental results are well-documented with appropriate statistical analyses, ensuring the findings are reliable and reproducible.

      (4) Relevance to PCOS: The study addresses a significant gap in understanding the neuroendocrine mechanisms underlying PCOS, making the findings relevant to both basic science and potentially clinical research.

      Weaknesses

      (1) Model Limitations: While the PNA mouse model is suggested as the most appropriate for studying PCOS, the authors acknowledge that it does not completely replicate the human condition, particularly the elevated LH response seen in women with PCOS.

      (2) Complex Data Interpretation: The reduced progesterone feedback and its effects on the GnRH pulse generator in PNA mice add complexity to data interpretation, making it challenging to draw straightforward conclusions.

      (3) Machine Learning (ML) Selection and Validation: While k-means clustering is a useful tool for pattern recognition, the manuscript lacks detailed justification for choosing this specific algorithm over other potential methods. The robustness of clustering results has not been validated.

      (4) Biological Interpretability: Although the machine learning approach identified cyclical patterns, the biological interpretation of these clusters in the context of PCOS is not thoroughly discussed. A deeper exploration of how these clusters correlate with physiological and pathological states could enhance the study's impact.

      (5) Sample Size: The study uses a relatively small number of animals (n=4-7 per group), which may limit the generalisability of the findings. Larger sample sizes could provide more robust and statistically significant results.

      (6) Scope of Application: The findings, while interesting, are primarily applicable to mouse models. The translation to human physiology requires cautious interpretation and further validation.

    1. Reviewer #2 (Public Review):

      Nichols et al studied the role of axon guidance molecules and their receptors and how these work as long-range and/or local cues, using in-vivo time-lapse imaging in C. elegans. They found that the Netrin axon guidance system works in different modes when acting as a long-range (chemotaxis) cue vs local cue (haptotaxis). As an initial context, they take advantage of the postembryonic-born neuron, PDE, to understand how its axon grows and then is guided into its target. They found that this process occurs in various discrete steps, during which the growth cone migrates and pauses at specific structures, such as the vSLNC. The role of the UNC-6/Netrin and UNC-40/DCC axon guidance ligand-receptor pair was then looked at in terms of its requirement for<br /> (1) initial axon outgrowth direction<br /> (2) stabilization at the intermediate target<br /> (3) directional branching from the sublateral region or<br /> (4) ventral growth from the intermediate target to the VNC.

      They found that each step is disrupted in the unc-6/Netrin and unc-40/DCC mutants and observed how the localization of these proteins changed during the process of axon guidance in wild-type and mutant contexts. These observations were further supported by analysis of a mutant important for the regulation of Netrin signaling, the E3 ubiquitin ligase madd-2/Trim9/Trim67. Remarkably, the authors identified that this mutant affected axonal adhesion and stabilization, but not directional growth. Using membrane-tethered UNC-6 to specific localities, they then found this to be a consequence of the availability of UNC-6 at specific localities within the axon growth path. Altogether, this data and in-vivo analysis provide compelling evidence of the mechanistic foundation of Netrin-mediated axon guidance and how it works step by step.

      The conclusions are well-supported, with both imaging and quantification of each step of axon guidance and localization of UNC-6 and UNC-40. Using a different type of neuron to validate their findings further supports their conclusions and strengthens their model. It's not yet known whether this model holds true for other ligand-receptor pairs, but the current work sets the stage for future analysis of other axon guidance molecules using time-lapse in-vivo imaging. There are still two outstanding questions that are important to address to support the authors' model and conclusions.

      (1) The results of UNC-6-TM expression at different locations are clear and support the conclusions but need to consider that there's no diffusible UNC-6 available. What would happen if UNC-6 is tethered to the membrane in an otherwise completely 'normal' UNC-6 gradient. Does the axon guidance ensue normally or does it get stuck in the respective site of the membrane tethered-UNC-6 and doesn't continue to outgrow properly? This is an important control (expression of the UNC-6-TM at the vSLNC or VNC in the wild type background) that would help clarify this question and gain a better insight into the separability of both axon guidance steps and the ability to manipulate these.

      (2) Axon guidance systems do not work in a vacuum and are generally competing against each other. For example, the SLT-1/Slit and SAX-3/ROBO axon guidance ligand-receptor pair is also required for PDE, and other post-embryonic neurons, axon guidance. It would be interesting to test mutants for these genes with the membrane tethered-UNC-6 to determine if the different steps of axon guidance are disrupted and if so, to what degree these are disrupted.

    1. Reviewer #2 (Public Review):

      The study by Setogawa et al. aims to understand the role that different striatal subregions belonging to parallel brain circuits have in associative learning and discrimination learning (S-O-R and S-R tasks). Strengths of the study are the use of multiple methodologies to measure and manipulate brain activity in rats, from microPET imaging to excitotoxic lesions and multielectrode recordings across anterior dorsolateral (aDLS), posterior ventral lateral (pVLS)and dorsomedial (DMS) striatum.

      The main conclusions are that the aDLS promotes stimulus-response association and suppresses response-outcome associations. The pVLS is engaged in the formation and maintenance of the stimulus-response association. There is a lot of work done and some interesting findings however, the manuscript can be improved by clarifying the presentation and reasoning. The inclusion of important controls will enhance the rigor of the data interpretation and conclusions.

    1. “Analysts need to be able to dissect exactly how the AI reached a particular conclusion or recommendation,” says Chief Business Officer Eric Costantini. “Neo4j enables us to enforce robust information security by applying access controls at the subgraph level.”

      “Analysts need to be able to dissect exactly how the AI reached a particular conclusion or recommendation,” “Neo4j enables us to enforce robust information security by applying access controls at the subgraph level.” Chief Business Officer Eric Costantini.

    1. Reviewer #2 (Public Review):

      In the current study, Li et al. developed a novel approach that aligns chronological age to a cross-species brain age prediction model to investigate the evolutionary effect. This method revealed some interesting findings, like the brain-age gap of the macaque model in predicting human age will increase as chronological age increases, suggesting an evolutionary alignment between the macaque brain and the human brain in the early stage of development. This study exhibits ample novelty and research significance. However, I still have some concerns regarding the reliability of the current findings.

      (1) Although the authors named their new method a "cross-species" model, the current study only focused on the prediction between humans and macaques. It would be better to discuss whether their method can also generalize to cross-species examination of other species (e.g., C. elegans), which may provide more comprehensive evolutionary insights. Also, other future directions with their new method are worth discussing.

      (2) Algorithm of prediction model. In the method section, the authors only described how they chose features, but did no description about the algorithm (e.g., supporting vector regression) they used. Please add relevant descriptions to the methods.

      (3) Sex difference. The sex difference results are strange to me. For example, in the second row of Figure Supplement 3A, different models show different correlation patterns, but why their Pearson's r is all equal to 0.3939? If they are only typo errors, please correct them. The authors claimed that they found no sex difference. However, the results in Figure Supplement 3 show that, the female seems to have poorer performance in predicting macaque age from the human model. Moreover, accumulated studies have reported sex differences in developing brains (Hines, 2011; Kurth et al., 2021). I think it is also worth discussing why sex differences can't be found in the evolutionary effect.

      Reference:<br /> Hines, M. (2011). Gender development and the human brain. Annual review of neuroscience, 34, 69-88.<br /> Kurth, F., Gaser, C., & Luders, E. (2021). Development of sex differences in the human brain. Cognitive Neuroscience, 12(3-4), 155-162.

    1. Reviewer #2 (Public Review):

      In "Multi-modal Neural Correlates of Childhood Psychopathology" Krebets et al. integrate multi-modal neuroimaging data using machine learning to delineate dissociable links to diverse dimensions of psychopathology in the ABCD sample. This paper had numerous strengths including a superb use of a large resource dataset, appropriate analyses, beautiful visualizations, clear writing, and highly interpretable results from a data-driven analysis. Overall, I think it would certainly be of interest to a general readership.

      That being said, I do have several comments for the authors to consider.

      - Out-of-sample testing: while the permutation testing procedure for the PLS is entirely appropriate, without out-of-sample testing the reported effect sizes are likely inflated.

      - Site/family structure: it was unclear how site/family structure were handled as covariates.

      - Anatomical features: I was a bit surprised to see volume, surface area, and thickness all evaluated - and that there were several comments on the correspondence between the SA and volume in the results section. Given that cortical volume is simply a product of SA and CT (and mainly driven by SA), this result may be pre-required.

      - Ethnicity: the rationale for regressing ethnicity from the data was unclear and may conflict with current best practices.

      - Data quality: the authors did an admirable job in controlling for data quality in the analyses of functional connectivity data. However, it is unclear if a comparable measure of data quality was used for the T1/dMRI analyses. This likely will result in inflated effect sizes in some cases; it has the potential to reduce sensitivity to real effects.

    1. Reviewer #2 (Public Review):

      This is, to my knowledge, the most scalable method for phylogenetic placement that uses likelihoods. The tool has an interesting and innovative means of using gaps, which I haven't seen before. In the validation the authors demonstrate superior performance to existing tools for taxonomic annotation (though there are questions about the setup of the validation as described below).

      The program is written in C with no library dependencies. This is great. However, I wasn't able to try out the software because the linking failed on Debian 11, and the binary artifact made by the GitHub Actions pipeline was too recent for my GLIBC/kernel. It'd be nice to provide a binary for people stuck on older kernels (our cluster is still on Ubuntu 18.04). Also, would it be hard to publish your .zipped binaries as packages?

      Thank you for publishing your source files for the validation on zenodo. Please provide a script that would enable the user to rerun the analysis using those files, either on zenodo or on GitHub somewhere.

      The validations need further attention as follows.

      First, the authors have not chosen data sets that are not well-aligned with real-world use cases for this software, and as a result, its applicability is difficult to determine. First, the leave-one-species-out experiment made use of COI gene sequences representing 253 species from the order Charadriiformes, which includes bird species such as gulls and terns. What is the reasoning for selecting this data set given the objective of demonstrating the utility of Tronko for large scale community profiling experiments which by their nature tend to include microorganisms as subjects? If the authors are interested in evaluating COI (or another gene target) as a marker for characterizing the composition of eukaryotic populations, is the heterogeneity and species distribution of bird species within order Charadriiformes comparable to what one would expect in populations of organisms that might actually be the target of a metagenomic analysis?

      Second, It appears that experiments evaluating performance for 16S were limited to reclassification of sequencing data from mock communities described in two publications, Schirmer (2015, 49 bacteria and 10 archaea, all environmental), and Gohl (2016; 20 bacteria - this is the widely used commercial mock community from BEI, all well-known human pathogens or commensals). The authors performed a comparison with kraken2, metaphlan2, and MEGAN using both the default database for each as well as the same database used for Tronko (kudos for including the latter). This pair of experiments provide a reasonable high-level indication of Tronko's performance relative to other tools, but the total number of organisms is very limited, and particularly limited with respect to the human microbiome. It is also important to point out that these mock communities are composed primarily of type strains and provide limited species-level heterogeneity. The performance of these classification tools on type strains may not be representative of what one would find in natural samples. Thus, the leave-one-individual-out and leave-one-species-out experiments would have been more useful and informative had they been applied to extended 16S data sets representing more ecologically realistic populations.

      Finally, the authors should describe the composition of the databases used for classification as well as the strategy (and toolchain) used to select reference sequences. What databases were the reference sequences drawn from and by what criteria? Were the reference databases designed to reflect the composition of the mock communities (and if so, are they limited to species in those communities, or are additional related species included), or have the authors constructed general purpose reference databases? How many representatives of each species were included (on average), and were there efforts to represent a diversity of strains for each species? The methods should include a section detailing the construction of the data sets: as illustrated in this very study, the choice of reference database influences the quality of classification results, and the authors should explain the process and design considerations for database construction.

    1. Reviewer #2 (Public Review):

      In this manuscript by Perez-Lopez et al., the authors investigate the role of the chemokine CCL28 during bacterial infections in mucosal tissues. This is a well-written study with exciting results. They show a role for CCL28 in promoting neutrophil accumulation to the guts of Salmonella-infected mice and to the lung of mice infected with Acinetobacter. Interestingly, the functional consequences of CCL28 deficiency differ between infections with the two different pathogens, with CCL28-deficiency increasing susceptibility to Salmonella, but increasing resistance to Acinetobacter. The underlying mechanistic reasons for this suggest roles for CCL28 in enhanced neutrophil antimicrobial activity, production of reactive oxygen species, and formation of extracellular traps. However, additional experiments are required to shore up these mechanisms, including addressing the role of other CCL28-dependent cell types and further characterization of neutrophils from CCL28-deficient mice.

    1. Reviewer #2 (Public Review):

      This work describes a novel bipotent differentiation capacity of human muscle progenitors marked by CD56 and CD29. In addition to previously well-known myogenic differentiation potential, the authors discovered these progenitors could also be induced into tenocyte-like cells. They describe the sorted CD56+/CD29+ cells not only differentiate into tenocytes in vitro; they were also able to engraft into injured tendons and repair damaged tendons when transplanted into nude mice. Human MuSC transplantation improved the locomotor function and physiological strength of the tendon-injured mice. The authors further observed that this bipotent differentiation potential was specific to human MuSC, the same cell population isolated from mice remains unipotent to myogenic differentiation and not capable of tenocytic differentiation.

      The discovery of the tenocyte differentiation potential of human CD56+/CD29+ MuSCs provides a potential cell therapeutic option for tendon injury. This work may have a significant clinical impact on improving treatment outcomes for patients suffering from tendon injury.

      Strength of the paper:

      Multimodal experimental approach using both in vitro and in vivo experiments provided strong proof for the differentiation capacity of the human MuSCs into tenocytes, and the potential clinical implication of these cells in the treatment of tendon injury in patients by in vivo transplantation assay. Using RNA sequencing to characterise the differentiated myocytic and tenocytic populations proved global expression profile data which have shown non-biased efficiency information to the in vitro differentiated cells.

      The comparison of differentiation potentials of human and mouse MuSCs is interesting and clinically meaningful. This work illustrates that animal studies may not always be clinically relevant in studying human diseases and treatment modalities.

      Weaknesses:

      scRNAseq assay using total mononuclear cell population did not provide meaningful insight that enriched knowledge on CD56+/CD29+ cell population. CD56+/CD29+ cells information may have been lost due to the minority identity of these cells in the total skeletal muscle mononuclear population, especially given the total cell number used for scRNAseq was very low and no information on participant number and repeat sample number used for this assay. Using this data to claim a stem cell lineage relationship for MuSCs and tenocytes may not convincing, as seeing both cell types in the total muscle mononuclear population does not establish a lineage connection between them.

      The TGF-b pathway assay uses a small molecular inhibitor of TGF-b to probe Smad2/3. The assay conclusion regarding Smad2/3 pathway responsible for tenocyte differentiation may be overinterpretation without Smad2/3 specific inhibitors being applied in the experiments.

    1. Reviewer #2 (Public Review):

      This manuscript offers significant insights into the impact of maternal obesity on oocyte methylation and its transgenerational effects. The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, to explore how high-fat diet (HFD)-induced obesity alters genomic methylation in oocytes and how these changes are inherited by subsequent generations. The findings suggest that maternal obesity induces hyper-methylation in oocytes, which is partly transmitted to F1 and F2 oocytes and livers, potentially contributing to metabolic disorders in offspring. Notably, the study identifies melatonin as a key regulator of this hyper-methylation process, mediated through the cAMP/PKA/CREB pathway.

      Strengths:

      The study employs comprehensive methodologies, including transgenerational breeding experiments, whole genome bisulfite sequencing, and metabolomics analysis, and provides convincing data.

      Weaknesses:

      The description in the results section is somewhat verbose. This section (lines 126~227) utilized transgenerational breeding experiments and methylation analysis to demonstrate that maternal obesity-induced alterations in oocyte methylation (including hyper-DMRs and hypo-DMRs) can be partially transmitted to F1 and F2 oocytes and livers. The authors should consider condensing and revising this section for clarity and brevity.

      There is a contradiction with Reference 3, but the discrepancy is not discussed. In this study, the authors observed an increase in global methylation in oocytes from HFD mice, whereas Reference 3 indicates Stella insufficiency in oocytes from HFD mice. This Stella insufficiency should lead to decreased methylation (Reference 33). There should be a discussion of how this discrepancy can be reconciled with the authors' findings.

    1. Reviewer #2 (Public Review):

      Summary:

      This work by Grogan and colleagues aimed to translate animal studies showing that acetylcholine plays a role in motivation by modulating the effects of dopamine on motivation. They tested this hypothesis with a placebo-controlled pharmacological study administering a muscarinic antagonist (trihexyphenidyl; THP) to a sample of 20 adult men performing an incentivized saccade task while undergoing electroengephalography (EEG). They found that reward increased vigor and reduced reaction times (RTs) and, importantly, these reward effects were attenuated by trihexyphenidyl. High incentives increased preparatory EEG activity (contingent negative variation), and though THP also increased preparatory activity, it also reduced this reward effect on RTs.

      Strengths:

      The researchers address a timely and potentially clinically relevant question with a within-subject pharmacological intervention and a strong task design. The results highlight the importance of the interplay between dopamine and other neurotransmitter systems in reward sensitivity and even though no Parkinson's patients were included in this study, the results could have consequences for patients with motivational deficits and apathy if validated in the future.

      Weaknesses:

      The main weakness of the study is the small sample size (N=20) that unfortunately is limited to men only. The generalizability and replicability of the conclusions remain to be assessed in future research with a larger and more diverse sample size and potentially a clinically relevant population. The EEG results do not shape a concrete mechanism of action of the drug on reward sensitivity.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors aimed to identify if and how magnesium affects the ability of two particular bacteria species to resist the action of antibiotics. In my view, the authors succeeded in their goals and presented a compelling study that will have important implications for the antibiotic resistance research community. Since metals like magnesium are present in all lab media compositions and are present in the host, the data presented in this study certainly will inspire additional research by the community. These could include research into whether other types of metals also induce multi-drug resistance, whether this phenomenon can be observed in other bacterial species, especially pathogenic species that cause clinical disease, and whether the underlying molecular determinants (i.e. enzymes) of metal-induced phenotypic resistance could be new antimicrobial drug targets themselves.

      Strengths:

      This study's strengths include that the authors used a variety of methodologies, all of which point to a clear effect of exogenous Mg2+ on drug resistance in the targeted species. I also commend the authors for carrying out a comprehensive study, spanning evaluation of whole cell phenotypes, metabolic pathways, genetic manipulation, to enzyme activity level evaluation. The fact that the authors uncovered a molecular mechanism underlying Mg2+-induced phenotypic resistance is particularly important as the key proteins should be studied further.

      Weaknesses:

      I believe there are weaknesses in the manuscript, however. The authors take for granted that the reader is familiar with all the assays utilized, and do not properly explain some experiments, and thus I highly suggest that the authors add a brief statement in each situation describing the rationale for each selected methodology (more details are in the private review to the authors). The Results section is also quite long and bogs down at times, and I suggest that the authors reduce its length by 10 to 20%. In contrast, the Introduction is sparse and lacks key aspects, for example, there should be mention of the study's main purpose and approaches, plus an introduction to the authors' choice of species and their known drug resistance properties, as well as the drug of choice (balofloxacin). Another notable weakness is that the authors evaluated Mg2+-induced phenotypic resistance only against two closely related species, and thus the generalizability of this mechanism of drug resistance is not known. The paper would be strengthened if the authors could demonstrate this type of phenotypic resistance in at least one more Gram-negative species and at least one Gram-positive species (antimicrobial susceptibility evaluations would suffice), each of which should be pathogenic to humans. Demonstrating magnesium-induced phenotypic drug resistance in the WHO Priority Bacterial Pathogens would be particularly important.

      In general, the conclusions drawn by the authors are justified by the data, except for the interpretation of some experiments. Importantly, this paper has discovered new antimicrobial resistance mechanisms and has also pointed to potential new targets for antimicrobials.

    1. Reviewer #2 (Public Review):

      I found the original paper to be of high quality and value. The revisions the authors have made (particularly with respect to the more cautious phraseology concerning the ability to track labelled proteins) are valuable additions. The other responses are well-argued and satisfactory to this reviewer.

    1. Reviewer #2 (Public Review):

      This is an interesting computational study addressing how salt affects the assembly of biomolecular condensates. The simulation data are valuable as they provide a degree of atomistic details regarding how small salt ions modulate interactions among intrinsically disordered proteins with charged residues, namely via Debye-like screening that weakens the effective electrostatic interactions among the polymers, or through bridging interactions that allow interactions between like charges from different polymer chains to become effectively attractive (as illustrated, e.g., by the radial distribution functions in Supplementary Information). However, this manuscript has several shortcomings: (i) Connotations of the manuscript notwithstanding, many of the authors' concepts about salt effects on biomolecular condensates have been put forth by theoretical models, at least back in 2020 and even earlier. Those earlier works afford extensive information such as considerations of salt concentrations inside and outside the condensate (tie-lines). But the authors do not appear to be aware of this body of prior works and therefore missed the opportunity to build on these previous advances and put the present work with its complementary advantages in structural details in the proper context. (ii) There are significant experimental findings regarding salt effects on condensate formation [which have been modeled more recently] that predate the A1-LCD system (ref.19) addressed by the present manuscript. This information should be included, e.g., in Table 1, for sound scholarship and completeness. (iii) The strengths and limitations of the authors' approach vis-à-vis other theoretical approaches should be discussed with some degree of thoroughness (e.g., how the smallness of the authors' simulation system may affect the nature of the "phase transition" and the information that can be gathered regarding salt concentration inside vs. outside the "condensate" etc.). Accordingly, this manuscript should be revised to address the following. In particular, the discussion in the manuscript should be significantly expanded by including references mentioned below as well as other references pertinent to the issues raised.

      (1) The ability to use atomistic models to address the questions at hand is a strength of the present work. However, presumably because of the computational cost of such models, the "phase-separated" "condensates" in this manuscript are extremely small (only 8 chains). An inspection of Fig.1 indicates that while the high-salt configuration (snapshot, bottom right) is more compact and droplet-like than the low-salt configuration (top right), it is not clear that the 50 mM NaCl configuration can reasonably correspond to a dilute or homogeneous phase (without phase separation) or just a condensate with a lower protein concentration because the chains are still highly associated. One may argue that they become two droplets touching each other (the chains are not fully dispersed throughout the simulation box, unlike in typical coarse-grained simulations of biomolecular phase separation). While it may not be unfair to argue from this observation that the condensed phase is less stable at low salt, this raises critical questions about the adequacy of the approach as a stand-alone source of theoretical information. Accordingly, an informative discussion of the limitation of the authors' approach and comparisons with results from complementary approaches such as analytical theories and coarse-grained molecular dynamics will be instructive-even imperative, especially since such results exist in the literature (please see below).

      (2) The aforementioned limitation is reflected by the authors' choice of using Dmax as a sort of phase-separation order parameter. However, no evidence was shown to indicate that Dmax exhibits a two-state-like distribution expected of phase separation. It is also not clear whether a Dmax value corresponding to the linear dimension of the simulation box was ever encountered in the authors' simulated trajectories such that the chains can be reliably considered to be essentially fully dispersed as would be expected for the dilute phase. Moreover, as the authors have noted in the second paragraph of the Results, the variation of Dmax with simulation time does not show a monotonic rank order with salt concentration. The authors' explanation is equivalent to stipulating that the simulation system has not fully equilibrated, inevitably casting doubt on at least some of the conclusions drawn from the simulation data.

      (3) With these limitations, is it realistic to estimate possible differences in salt concentration between the dilute and condensed phases in the present work? These features, including tie-lines, were shown to be amenable to analytical theory and coarse-grained molecular dynamics simulation (please see below).

      (4) In the comparison in Fig.2B between experimental and simulated radius of gyration as a function of [NaCl], there is an outlier among the simulated radii of gyration at [NaCl] ~ 250 mM. An explanation should be offered.

      (5) The phenomenon of no phase separation at zero and low salt and phase separation at higher salt has been observed for the IDP Caprin1 and several of its mutants [Wong et al., J Am Chem Soc 142, 2471-2489 (2020) [https://pubs.acs.org/doi/full/10.1021/jacs.9b12208], see especially Fig.9 of this reference]. This work should be included in the discussion and added to Table 1.

      (6) The authors stated in the Introduction that "A unifying understanding of how salt affects the phase separation of IDPs is still lacking". While it is definitely true that much remains to be learned about salt effects on IDP phase separation, the advances that have already been made regarding salt effects on IDP phase separation is more abundant than that conveyed by this narrative. For instance, an analytical theory termed rG-RPA was put forth in 2020 to provide a uniform (unified) treatment of salt, pH, and sequence-charge-pattern effects on polyampholytes and polyelectrolytes (corresponding to the authors' low net charge and high net charge cases). This theory offers a means to predict salt-IDP tie-lines and a comprehensive account of salt effect on polyelectrolytes resulting in a lack of phase separation at extremely low salt and subsequent salt-enhanced phase separation (similar to the case the authors studied here) and in some cases re-entrant phase separation or dissolution [Lin et al., J Chem Phys 152. 045102 (2020) [https://doi.org/10.1063/1.5139661]]. This work is highly relevant and it already provided a conceptual framework for the authors' atomistic results and subsequent discussion. As such, it should definitely be a part of the authors' discussion.

      (7) Bridging interactions by small ions resulting in effective attractive interactions among polyelectrolytes leading to their phase separation have been demonstrated computationally by Orkoulas et al., Phys Rev Lett 90, 048303 (2003) [https://journals.aps.org/prl/abstract/10.1103/PhysRevLett.90.048303]. This result should also be included in the discussion.

      (8) More recently, the salt-dependent phase separations of Caprin1, its RtoK variants and phosphorylated variant (see item #5 above) were modeled (and rationalized) quite comprehensively using rG-RPA, field-theoretic simulation, and coarse-grained molecular dynamics [Lin et al., arXiv:2401.04873 [https://arxiv.org/abs/2401.04873]], providing additional data supporting a conceptual perspective put forth in Lin et al. J Chem Phys 2020 (e.g., salt-IDP tie-lines, bridging interactions, re-entrance behaviors etc.) as well as in the authors' current manuscript. It will be very helpful to the readers of eLife to include this preprint in the authors' discussion, perhaps as per the authors' discretion-along the manner in which other preprints are referenced and discussed in the current version of the manuscript.

    1. Reviewer #2 (Public Review):

      Individuals with chronic kidney disease often have dyslipidemia, with the latter both a risk factor for atherosclerotic heart disease and a contributor to progressive kidney disease. Prior studies suggest that oxidized LDL (oxLDL) may cause renal injury through the activation of the LOX1 receptor. The authors had previously reported that LOX1 and AT1 interact to form a complex at the cell surface. In this study, the authors hypothesize that oxLDL, in the setting of angiotensin II, is responsible for driving renal injury by inducing a more pronounced conformational change of the AT1 receptor which results in enhanced Gq signaling.

      They go about testing the hypothesis in a set of three studies. In the first set, they engineered CHO cell lines to express AT1R alone, LOX1 in combination with AT1R, or LOX1 with an inactive form of AT1R and indirectly evaluated Gq activity using IP1 and calcium activity as read-outs. They assessed activity after treatment with AngII, oxLDL, or both in combination and found that treatment with both agents resulted in the greatest level of activity, which could be effectively blocked by a Gq inhibitor but not a Gi inhibitor nor a downstream Rho kinase inhibitor targeting G12/13 signaling. These results support their hypothesis, though variability in the level of activation was dramatically inconsistent from experiment to experiment, differing by as much as 20-fold. In contrast, within the experiment, differences between the AngII and AngII/oxLDL treatments, while nominally significant and consistent with their hypothesis, generally were only 10-20%. Another example of unexplained variability can be found in Figures 1g-1j. AngII, at a concentration of 10-12, has no effect on calcium flux in one set of studies (Figure 1g, h) yet has induced calcium activity to a level as great as AngII + oxLDL in another (Figure 1i). The inconsistency of results lessens confidence in the significance of these findings. In other studies with the LOX1-CHO line, they tested for conformational change by transducing AT1 biosensors previously shown to respond to AngII and found that one of them in fact showed enhanced BRET in the setting of oxLDL and AngII compared to AngII alone, which was blocked by an antibody to AT1R. The result is supportive of their conclusions. Limiting enthusiasm for these results is the fact that there isn't a good explanation as to why only 1 sensor showed a difference, and the study should have included a non-specific antibody to control for non-specific effects.

      The authors then repeated similar studies using publicly available rat kidney epithelial and fibroblast cell lines that have an endogenous expression of AT1R and LOX1. In these studies, oxLDL in combination with AngiI also enhanced Gq signaling, while knocking down either AT1R or LOX1, and treatment with inhibitors of Gq and AT1R blocked the effects. Like the prior set of studies, however, the effects are very modest and there was significant inter-experimental variability, reducing confidence in the significance of the findings. The authors then tested for evidence that the enhanced Gq signaling could result in renal injury by comparing qPCR results for target genes. While the results show some changes, their significance is difficult to assess. A more global assessment of gene expression patterns would have been more appropriate. In parallel with the transcriptional studies, they tested for evidence of epithelial-mesenchymal transition (EMT) using a single protein marker (alpha-smooth muscle actin) and found that its expression increased significantly in cells treated with oxLDL and AngII, which was blocked by inhibition of Gq inhibition and AT1R. While the data are sound, their significance is also unclear since EMT is a highly controversial cell culture phenomenon. Compelling in vivo studies have shown that most if not all fibroblasts in the kidney are derived from interstitial cells and not a product of EMT. In the last set of studies using these cell lines, the authors examined the effects of AngII and oxLDL on cell proliferation as assayed using BrdU. These results are puzzling---while the two agents together enhanced proliferation which was effectively blocked by an inhibitor to either AT1R or Gq, silencing of LOX1 had no effect.

      The final set of studies looked to test the hypothesis in mice by treating WT and Lox1-KO mice with different doses of AngII and either a normal or high-fat diet (to induce oxLDL formation). The authors found that the combination of high dose AngII and a high-fat diet (HFD) increased markers of renal injury (urinary 8-ohdg and urine albumin) in normal mice compared to mice treated with just AngII or HFD alone, which was blunted in Lox1-KO mice). These results are consistent with their hypothesis. However, there are other aspects of these studies that are either inconsistent or complicating factors that limit the strength of the conclusions. For example, Lox1- KO had no effect on renal injury marker expression in mice treated with low-dose AngII and HFD. It also should be noted that Lox1-KO mice had a lower BP response to AngII, which could have reduced renal injury independent of any effects mediated by the AT1R/LOX1 interaction. Another confounding factor was the significant effect the HFD diet had on body weight. While the groups did not differ based on AngII treatment status, the HFD consistently was associated with lower total body weight, which is unexplained. Next, the authors sought to find more direct evidence of renal injury using qPCR of candidate genes and renal histology. The transcriptional results are difficult to interpret; moreover, there were no significant histologic differences between groups. They conclude the study by showing the pattern of expression of LOX1 and AT1R in the kidney by immunofluorescence and conclude that the proteins overlap in renal tubules and are absent from the glomerulus. Unfortunately, they did not co-stain with any other markers to identify the specific cell types. However, these results are inconsistent with other studies that show AT1R is highly expressed in mesangial cells, renal interstitial cells, near the vascular pole, JG cells, and proximal tubules but generally absent from most other renal tubule segments.

      In sum, this study tackles an important clinical issue and provides some in vitro evidence to support a mechanism whereby dyslipidemia could accelerate renal functional decline through activation of the AT1R/LOX1 complex by oxLDL and AngII.

      However, a very high degree of variability in the results, modest within-experiment differences, some internal inconsistencies that aren't explained, and the lack of compelling and strongly supportive in vivo results suggest this is still more a hypothesis than an established likely mechanism.

    1. Reviewer #2 (Public Review):

      Based on bioinformatics and expression analysis using mouse and human samples, the authors claim that the adhesion G-protein coupled receptor ADGRA3 may be a valuable target for increasing thermogenic activity and metabolic health. Genetic approaches to deplete ADGRA3 expression in vitro resulted in reduced expression of thermogenic genes including Ucp1, reduced basal respiration, and metabolic activity as reflected by reduced glucose uptake and triglyceride accumulation. In line, nanoparticle delivery of shAdgra3 constructs is associated with increased body weight, reduced thermogenic gene expression in white and brown adipose tissue (WAT, BAT), and impaired glucose and insulin tolerance. On the other hand, ADGRA3 overexpression is associated with an improved metabolic profile in vitro and in vivo, which can be explained by increasing the activity of the well-established Gs-PKA-CREB axis. Notably, a computational screen suggested that ADGRA3 is activated by hesperetin. This metabolite is a derivative of the major citrus flavonoid hesperidin and has been described to promote metabolic health. Using appropriate in vitro and in vivo studies, the authors show that hesperetin supplementation is associated with increased thermogenesis, UCP1 levels in WAT and BAT, and improved glucose tolerance, an effect that was attenuated in the absence of ADGRA3 expression.

      Overall, the data suggest that ADGRA3 is a constitutively active Gs-coupled receptor that improves metabolism by activating adaptive thermogenesis in WAT and BAT. The conclusions of the paper are partly supported by the data, but some experimental approaches need further clarification.

      (1) The in vivo approaches to modulate Adgra3 expression in mice are carried out using non-targeted nanoparticle-based approaches. The authors do not provide details of the composition of the nanomaterials, but it is highly likely that other metabolically active organs such as the liver are targeted. This is critical because Adgre3 is expressed in many organs, including the liver, adrenal glands, and gastrointestinal system. Therefore, many of the observed metabolic effects could be indirect, for example by modulating bile acids or corticosterone levels. Consistent with this, after digestion in the gastrointestinal tract, hesperetin is rapidly metabolized in intestinal and liver cells. Thus, hesperetin levels in the systemic circulation are likely to be insufficient to activate Adgra3 in thermogenic adipocytes/precursors. Overall, the authors need to repeat the key metabolic experiments in adipose-specific Adgra3 knockout/overexpression models to validate the reliability of the in vivo results. In addition, to validate the relevance of hesperetin supplementation for adaptive thermogenesis in BAT and WAT vivo, the levels of hesperetin present in the systemic circulation should be quantified.

      (2) Standard measurements for energy balance are not presented. Quantitative data on energy expenditure, e.g. by indirect calorimetry, and food intake are missing and need to be included to validate the authors' claims.

      (3) The thermographic images used to determine the BAT temperature are not very convincing. The distance and angle between the thermal camera and the BAT have a significant effect on the determination of the temperature, which is not taken into account, at least in the images presented.

      (4) The 3T3-L1 cell line is not an adequate cell culture model to study thermogenic adipocyte differentiation. To validate their results, the key experiments showing that ADGRA3 expression modulates thermogenic marker expression in a hesperetin-dependent manner need to be performed in a reliable model, e.g. primary murine adipocytes.

      (5) The experimental setup only allows the measurement of basal cellular respiration. More advanced approaches are needed to define the contribution of ADGRA3 versus classical adrenergic receptors to UCP1-dependent thermogenesis.

    1. Reviewer #2 (Public Review):

      Summary:

      This study uses an elegant design, using cross-decoding of multivariate fMRI patterns across different types of stimuli, to convincingly show a functional dissociation between two sub-regions of the parietal cortex, the anterior inferior parietal lobe (aIPL) and superior parietal lobe (SPL) in visually processing actions. Specifically, aIPL is found to be sensitive to the causal effects of observed actions (e.g. whether an action causes an object to compress or to break into two parts), and SPL to the motion patterns of the body in executing those actions.

      To show this, the authors assess how well linear classifiers trained to distinguish fMRI patterns of response to actions in one stimulus type can generalize to another stimulus type. They choose stimulus types that abstract away specific dimensions of interest. To reveal sensitivity to the causal effects of actions, regardless of low-level details or motion patterns, they use abstract animations that depict a particular kind of object manipulation: e.g. breaking, hitting, or squashing an object. To reveal sensitivity to motion patterns, independently of causal effects on objects, they use point-light displays (PLDs) of figures performing the same actions. Finally, full videos of actors performing actions are used as the stimuli providing the most complete, and naturalistic information. Pantomime videos, with actors mimicking the execution of an action without visible objects, are used as an intermediate condition providing more cues than PLDs but less than real action videos (e.g. the hands are visible, unlike in PLDs, but the object is absent and has to be inferred). By training classifiers on animations, and testing their generalization to full-action videos, the classifiers' sensitivity to the causal effect of actions, independently of visual appearance, can be assessed. By training them on PLDs and testing them on videos, their sensitivity to motion patterns, independent of the causal effect of actions, can be assessed, as PLDs contain no information about an action's effect on objects.

      These analyses reveal that aIPL can generalize between animations and videos, indicating that it is sensitive to action effects. Conversely, SPL is found to generalize between PLDs and videos, showing that it is more sensitive to motion patterns. A searchlight analysis confirms this pattern of results, particularly showing that action-animation decoding is specific to right aIPL, and revealing an additional cluster in LOTC, which is included in subsequent analyses. Action-PLD decoding is more widespread across the whole action observation network.

      This study provides a valuable contribution to the understanding of functional specialization in the action observation network. It uses an original and robust experimental design to provide convincing evidence that understanding the causal effects of actions is a meaningful component of visual action processing and that it is specifically localized in aIPL and LOTC.

      Strengths:

      The authors cleverly managed to isolate specific aspects of real-world actions (causal effects, motion patterns) in an elegant experimental design, and by testing generalization across different stimulus types rather than within-category decoding performance, they show results that are convincing and readily interpretable. Moreover, they clearly took great care to eliminate potential confounds in their experimental design (for example, by carefully ordering scanning sessions by increasing realism, such that the participants could not associate animation with the corresponding real-world action), and to increase stimulus diversity for different stimulus types. They also carefully examine their own analysis pipeline, and transparently expose it to the reader (for example, by showing asymmetries across decoding directions in Figure S3). Overall, this is an extremely careful and robust paper.

      Weaknesses:

      I list several ways in which the paper could be improved below. More than 'weaknesses', these are either ambiguities in the exact claims made, or points that could be strengthened by additional analyses. I don't believe any of the claims or analyses presented in the paper show any strong weaknesses, problematic confounds, or anything that requires revising the claims substantially.

      (1) Functional specialization claims: throughout the paper, it is not clear what the exact claims of functional specialization are. While, as can be seen in Figure 3A, the difference between action-animation cross-decoding is significantly higher in aIPL, decoding performance is also above chance in right SPL, although this is not a strong effect. More importantly, action-PLD cross-decoding is robustly above chance in both right and left aIPL, implying that this region is sensitive to motion patterns as well as causal effects. I am not questioning that the difference between the two ROIs exists - that is very convincingly shown. But sentences such as "distinct neural systems for the processing of observed body movements in SPL and the effect they induce in aIPL" (lines 111-112, Introduction) and "aIPL encodes abstract representations of action effect structures independently of motion and object identity" (lines 127-128, Introduction) do not seem fully justified when action-PLD cross-decoding is overall stronger than action-animation cross-decoding in aIPL. Is the claim, then, that in addition to being sensitive to motion patterns, aIPL contains a neural code for abstracted causal effects, e.g. involving a separate neural subpopulation or a different coding scheme? Moreover, if sensitivity to motion patterns is not specific to SPL, but can be found in a broad network of areas (including aIPL itself), can it really be claimed that this area plays a specific role, similar to the specific role of aIPL in encoding causal effects? There is indeed, as can be seen in Figure 3A, a difference between action-PLD decoding in SPL and aIPL, but based on the searchlight map shown in Figure 3B I would guess that a similar difference would be found by comparing aIPL to several other regions. The authors should clarify these ambiguities.

      (2) Causal effect information in PLDs: the reasoning behind the use of PLD stimuli is to have a condition that isolates motion patterns from the causal effects of actions. However, it is not clear whether PLDs really contain as little information about action effects as claimed. Cross-decoding between animations and PLDs is significant in both aIPL and LOTC, as shown in Figure 4. This indicates that PLDs do contain some information about action effects. This could also be tested behaviorally by asking participants to assign PLDs to the correct action category. In general, disentangling the roles of motion patterns and implied causal effects in driving action-PLD cross-decoding (which is the main dependent variable in the paper) would strengthen the paper's message. For example, it is possible that the strong action-PLD cross-decoding observed in aIPL relies on a substantially different encoding from, say, SPL, an encoding that perhaps reflects causal effects more than motion patterns. One way to exploratively assess this would be to integrate the clustering analysis shown in Figure S1 with a more complete picture, including animation-PLD and action-PLD decoding in aIPL.

      (3) Nature of the motion representations: it is not clear what the nature of the putatively motion-driven representation driving action-PLD cross-decoding is. While, as you note in the Introduction, other regions such as the superior temporal sulcus have been extensively studied, with the understanding that they are part of a feedforward network of areas analyzing increasingly complex motion patterns (e.g. Riese & Poggio, Nature Reviews Neuroscience 2003), it doesn't seem like the way in which SPL represents these stimuli are similarly well-understood. While the action-PLD cross-decoding shown here is a convincing additional piece of evidence for a motion-based representation in SPL, an interesting additional analysis would be to compare, for example, RDMs of different actions in this region with explicit computational models. These could be, for example, classic motion energy models inspired by the response characteristics of regions such as V5/MT, which have been shown to predict cortical responses and psychophysical performance both for natural videos (e.g. Nishimoto et al., Current Biology 2011) and PLDs (Casile & Giese Journal of Vision 2005). A similar cross-decoding analysis between videos and PLDs as that conducted on the fMRI patterns could be done on these models' features, obtaining RDMs that could directly be compared with those from SPL. This would be a very informative analysis that could enrich our knowledge of a relatively unexplored region in action recognition. Please note, however, that action recognition is not my field of expertise, so it is possible that there are practical difficulties in conducting such an analysis that I am not aware of. In this case, I kindly ask the authors to explain what these difficulties could be.

      (4) Clustering analysis: I found the clustering analysis shown in Figure S1 very clever and informative. However, there are two things that I think the authors should clarify. First, it's not clear whether the three categories of object change were inferred post-hoc from the data or determined beforehand. It is completely fine if these were just inferred post-hoc, I just believe this ambiguity should be clarified explicitly. Second, while action-anim decoding in aIPL and LOTC looks like it is consistently clustered, the clustering of action-PLD decoding in SPL and LOTC looks less reliable. The authors interpret this clustering as corresponding to the manual vs. bimanual distinction, but for example "drink" (a unimanual action) is grouped with "break" and "squash" (bimanual actions) in left SPL and grouped entirely separately from the unimanual and bimanual clusters in left LOTC. Statistically testing the robustness of these clusters would help clarify whether it is the case that action-PLD in SPL and LOTC has no semantically interpretable organizing principle, as might be the case for a representation based entirely on motion pattern, or rather that it is a different organizing principle from action-anim, such as the manual vs. bimanual distinction proposed by the authors. I don't have much experience with statistical testing of clustering analyses, but I think a permutation-based approach, wherein a measure of cluster robustness, such as the Silhouette score, is computed for the clusters found in the data and compared to a null distribution of such measures obtained by permuting the data labels, should be feasible. In a quick literature search, I have found several papers describing similar approaches: e.g. Hennig (2007), "Cluster-wise assessment of cluster stability"; Tibshirani et al. (2001) "Estimating the Number of Clusters in a Data Set Via the Gap Statistic". These are just pointers to potentially useful approaches, the authors are much better qualified to pick the most appropriate and convenient method. However, I do think such a statistical test would strengthen the clustering analysis shown here. With this statistical test, and the more exhaustive exposition of results I suggested in point 2 above (e.g. including animation-PLD and action-PLD decoding in aIPL), I believe the clustering analysis could even be moved to the main text and occupy a more prominent position in the paper.

      (5) ROI selection: this is a minor point, related to the method used for assigning voxels to a specific ROI. In the description in the Methods (page 16, lines 514-24), the authors mention using the MNI coordinates of the center locations of Brodmann areas. Does this mean that then they extracted a sphere around this location, or did they use a mask based on the entire Brodmann area? The latter approach is what I'm most familiar with, so if the authors chose to use a sphere instead, could they clarify why? Or, if they did use the entire Brodmann area as a mask, and not just its center coordinates, this should be made clearer in the text.

    1. Reviewer #2 (Public Review):

      Summary:

      The study links Alzheimer's disease (AD) with metabolic disorders through elevated Kallistatin levels in AD patients. Kallistatin-overexpressing mice show cognitive decline, increased Aβ and tau pathology, and impaired hippocampal function. Mechanistically, Kallistatin enhances Aβ production via Notch1 and promotes tau phosphorylation through GSK-3β activation. Fenofibrate improves cognitive deficits by reducing Aβ and tau phosphorylation in these mice, suggesting therapeutic potential in AD linked to metabolic syndromes.

      Strengths:

      This study presents novel insights into AD pathogenesis and provides strong evidence about the mechanistic roles of Kallistatin, and the therapeutic potential of fenofibrate in AD.

      Weaknesses:

      It was suggested that Kallistatin is primarily produced by the liver. The study demonstrates increased Kallistatin levels in the hippocampus tissue of AD mice. It would be valuable to clarify if Kallistatin is also increased in the liver of AD mice, providing a comprehensive understanding of its distribution in disease states.

      Does Kallistatin interact directly with Notch1 ligands? Clarifying this interaction mechanism would enhance understanding of how Kallistatin influences Notch1 signaling in AD pathology.

      Is there any observed difference in AD phenotype between male and female Kallistatin-transgenic (KAL-TG) mice? Including this information would address potential gender-specific effects on cognitive decline and pathology.

      It is recommended to include molecular size markers in Western blots for clarity and accuracy in protein size determination.

      The language should be revised for enhanced readability and clarity, ensuring that complex scientific concepts are communicated effectively to a broader audience.

    1. Reviewer #2 (Public Review):

      Cuevas et al. investigate the stimulus selectivity of surround-induced responses in the mouse primary visual cortex (V1). While classical experiments in non-human primates and cats have generally demonstrated that stimuli in the surround receptive field (RF) of V1 neurons only modulate activity to stimuli presented in the center RF, without eliciting responses when presented in isolation, recent studies in mouse V1 have indicated the presence of purely surround-induced responses. These have been linked to prediction error signals. In this study, the authors build on these previous findings by systematically examining the stimulus selectivity of surround-induced responses.

      Using neuropixels recordings in V1 and the dorsal lateral geniculate nucleus (dLGN) of head-fixed, awake mice, the authors presented various stimulus types (gratings, noise, surfaces) to the center and surround, as well as to the surround only, while also varying the size of the stimuli. Their results confirm the existence of surround-induced responses in mouse V1 neurons, demonstrating that these responses do not require spatial or temporal coherence across the surround, as would be expected if they were linked to prediction error signals. Instead, they suggest that surround-induced responses primarily reflect the representation of the achromatic surface itself.

      The literature on center-surround effects in V1 is extensive and sometimes confusing, likely due to the use of different species, stimulus configurations, contrast levels, and stimulus sizes across different studies. It is plausible that surround modulation serves multiple functions depending on these parameters. Within this context, the study by Cuevas et al. makes a significant contribution by exploring the relationship between surround-induced responses in mouse V1 and stimulus statistics. The research is meticulously conducted and incorporates a wide range of experimental stimulus conditions, providing valuable new insights regarding center-surround interactions.

      However, the current manuscript presents challenges in readability for both non-experts and experts. Some conclusions are difficult to follow or not clearly justified.

      I recommend the following improvements to enhance clarity and comprehension:

      (1) Clearly state the hypotheses being tested at the beginning of the manuscript.

      (2) Always specify the species used in referenced studies to avoid confusion (esp. Introduction and Discussion).

      (3) Briefly summarize the main findings at the beginning of each section to provide context.

      (4) Clearly define important terms such as "surface stimulus" and "early vs. late stimulus period" to ensure understanding.

      (5) Provide a rationale for each result section, explaining the significance of the findings.

      (6) Offer a detailed explanation of why the results do not support the prediction error signal hypothesis but instead suggest an encoding of the achromatic surface.

      These adjustments will help make the manuscript more accessible and its conclusions more compelling.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript presenting the discovery of a heparan-sulfate (HS) binding domain in monkeypox virus (MPXV) H3 protein as a new anti-poxviral drug target, presented by Bin Zhen and co-workers, is of interest, given that it offers a potentially broad antiviral substance to be used against poxviruses. Using new computational biology techniques, the authors identified a new alpha-helical domain in the H3 protein, which interacts with cell surface HS, and this domain seems to be crucial for H3-HS interaction. Given that this domain is conserved across orthopoxviruses, authors designed protein inhibitors. One of these inhibitors, AI-PoxBlock723, effectively disrupted the H3-HS interaction and inhibited infection with Monkeypox virus and Vaccinia virus. The presented data should be of interest to a diverse audience, given the possibility of an effective anti-poxviral drug. 

      Strengths:

      In my opinion, the experiments done in this work were well-planned and executed. The authors put together several computational methods, to design poxvirus inhibitor molecules, and then they test these molecules for infection inhibition.

      Weaknesses:

      One thing that could be improved, is the presentation of results, to make them more easily understandable to readers, who may not be experts in protein modeling programs. For example, figures should be self-explanatory and understood on their own, without the need to revise text. Therefore, the figure legend should be more informative as to how the experiments were done.

    1. Reviewer #3 (Public Review):

      Summary: Through a rigorous methodology, the authors demonstrated that within 11 different primates, the shape of the brain followed a universal scaling law with fractal properties. They enhanced the universality of this result by showing the concordance of their results with a previous study investigating 70 mammalian brains, and the discordance of their results with other folded objects that are not brains. They incidentally illustrated potential applications of this fractal property of the brain by observing a scale-dependant effect of aging on the human brain.

      Strengths:<br /> - New hierarchical way of expressing cortical shapes at different scales derived from previous report through implementation of a coarse-graining procedure<br /> - Investigation of 11 primate brains and contextualisation with other mammals based on prior literature<br /> - Proposition of tool to analyse cortical morphology requiring no fine tuning and computationally achievable<br /> - Positioning of results in comparison to previous works reinforcing the validity of the observation.<br /> - Illustration of scale-dependance of effects of brain aging in the human.

      Weaknesses:<br /> - The notion of cortical shape, while being central to the article, is not really defined, leaving some interpretation to the reader<br /> - The organization of the manuscript is unconventional, leading to mixed contents in different sections (sections mixing introduction and method, methods and results, results and discussion...). As a result, the reader discovers the content of the article along the way, it is not obvious at what stages the methods are introduced, and the results are sometimes presented and argued in the same section, hindering objectivity.<br /> To improve the document, I would suggest a modification and restructuring of the article such that: 1) by the end of the introduction the reader understands clearly what question is addressed and the value it holds for the community, 2) by the end of the methods the reader understands clearly all the tools that will be used to answer that question (not just the new method), 3) by the end of the results the reader holds the objective results obtained by applying these tools on the available data (without subjective interpretations and justifications), and 4) by the end of the discussion the reader understands the interpretation and contextualisation of the study, and clearly grasps the potential of the method depicted for the better understanding of brain folding mechanisms and properties.

    1. Reviewer #3 (Public Review):

      In the manuscript titled "Structure and Evolution of Alanine/Serine Decarboxylases and the Engineering of Theanine Production," Wang et al. solved and compared the crystal structures of Alanine Decarboxylase (AlaDC) from Camellia sinensis and Serine Decarboxylase (SerDC) from Arabidopsis thaliana. Based on this structural information, the authors conducted both in vitro and in vivo functional studies to compare enzyme activities using site-directed mutagenesis and subsequent evolutionary analyses. This research has the potential to enhance our understanding of amino acid decarboxylase evolution and the biosynthetic pathway of the plant specialized metabolite theanine, as well as to further its potential applications in the tea industry.

    1. Reviewer #3 (Public Review):

      This is an interesting manuscript that builds off of this group's previous work focused on the interface between Hsf1, heat shock protein (HSP) mRNA production, and 3D genome topology. Here the group subjects the yeast Saccharomyces cerevisiae to either heat stress (HS) or ethanol stress (ES) and examines Hsf1 and Pol II chromatin binding, Histone occupancy, Hsf1 condensates, HSP gene coalescence (by 3C and live cell imaging), and HSP mRNA expression (by RT-qPCR and live cell imaging). The manuscript is well written, and the experiments seem well done, and generally rigorous, with orthogonal approaches performed to support conclusions. The main findings are that both HS and ES result in Hsf1/Pol II-dependent intergenic interactions, along with formation of Hsf1 condensates. Yet, while HS results in rapid and strong induction of HSP gene expression and Hsf1 condensate resolution, ES result in slow and weak induction of HSP gene expression without Hsf1 condensate resolution. Thus, the conclusion is somewhat phenomenological - that the same transcription factor can drive distinct transcription, topologic, and phase-separation behavior in response to different types of stress. While identifying a mechanistic basis for these results would be a tough task perhaps beyond the scope of this study, it would nevertheless be helpful to place these results in context with a series of other studies demonstrating across various organisms showing Hsf1 driving distinct activities dependent on the context of activation. Perhaps even more importantly, this work left out PMID: 32015439 which is particularly relevant considering that it shows that it is human HSF1 condensate resolution rather than simple condensate formation that is associated with HSF1 transcriptional activity - which are similar to the findings here with this particular dose of HS resulting in resolution and high transcriptional activity versus ES resulting in resolution failure and lower activity. It is also worth noting that the stresses themselves are quite different - ethanol can be used as a carbon source and so beyond inducing proteotoxic stress, the yeast are presumably adapting to this distinct metabolic state. Basically, it is not clear whether these differences are due to the dose of stress, versus we are looking at an early timepoint as ES initiates a genome-wide chromatin restructuring and gene expression reprogramming that goes beyond a response to proteotoxic stress. This reviewer is not suggesting a barrage of new experiments, but perhaps discussion points to contextualize results.

      Comments on latest version:

      The authors have addressed my concerns.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript titled "Identification of pharmacological inducers of a reversible hypometabolic state for whole organ preservation" reports the effects of delta opioid receptor activator SNC80 and its modified analog WB3 with ~1,000 times less delta opioid receptor binding activity on metabolic state.

      Strengths:

      This is an interesting study with potentially broad implications for organ preservation.

      Weaknesses:

      However, there are several limitations which raise concerns.

      (1) The authors developed an analog of a known delta opioid receptor activator SNC80 with three orders of magnitude lesser binding with the delta opioid receptor WB3. This will likely reduce the undesirable effects of SNC80 while preserving metabolic slowing needed for organ preservation. Yet, most experiments were done with SNC80, not the superior modification, WB3, shown in only a limited set of experiments, Figure 3.

      (2) The heart is one of the most challenging organs to preserve, and some experiments are done to establish the metabolic effects of SNC80. However, the biodistribution study, shown in Figure 2, conspicuously omitted the heart.

      (3) I do not understand the design of the electrophysiology and contractility experiments with the porcine hearts. How did you defibrillate the hearts after removal and establishing perfusion? Lines 173-175 on Page 7 state: "After defibrillation with epinephrine, the P and QRS waveforms were visible in ECGs from 3 of 4 SNC80-treated hearts (Table S1), suggesting that those hearts regain atrial and ventricular polarization." Please clarify. Defibrillation is done with an electric shock. Also, please show the ECG recordings to support your conclusions about "polarization." What did you mean by "polarization"? Depolarization? Repolarization? Or resting potential. To establish a normal physiological state, please show ECG waveforms and present data on basic ECG characteristics: heart rate, PQ and QT intervals, and P and QRS durations. I recommend perfusion of the porcine heart with WB3, not only SNC80.

      (4) Pathology data also raises concerns. The histology images shown in Figure 4f are not quantified, and they show apparently higher levels of tissue disruption in SNC80-treated tissue vs vehicle-treated. The test (lines 169-171) confirms this concern: "In some hearts treated with SNC80, greater waviness of muscle fibers was observed, possibly indicating a state of muscle contraction." It will be helpful to measure markers of apoptosis and necrosis and to apply TTC viability staining.

      (5) The apparent state of contracture suggests a higher degree of myocardial damage and a high intracellular calcium level in SNC80-treated hearts. The authors suggested that the sodium-calcium exchanger NCX is a possible target of SNC80 and could be responsible for the "hypometabolic state." However, NCX1 is critically important in the extrusion of cytosolic Ca2+ during the diastolic phase. Failure to remove excessive calcium and restore ionic homeostasis would lead to calcium overload and heart failure.

      (6) I am surprised the authors did not consider using the gold standard assay for measuring mitochondrial function in cells by the Seahorse Cell Mito Stress Test.

      Comments on revised version:

      I am satisfied with the revisions. The authors addressed major concerns with new data and/or provided satisfactory rebuttal.

    1. Reviewer #2 (Public Review):

      Summary:<br /> Mistri et al explore the role of SLAM-SAP signaling in the developmental programming of innate-like gd T cell subsets. Using proteo-genomics, they determined that abrogation of SLAM-SAP signaling altered that programming, reducing some IL-17 producing subsets, including a novel Vγ4 γδT1 subset, and diverting gdTCR-expressing precursors to the ab fate. Altogether, this is a very thorough, thoughtfully interpreted study that adds significantly to our understanding of the contribution of the SLAM-SAP pathway to lineage specification. A particularly interesting element is the role of SLAM-SAP in preventing gd17 progenitors from switching fates and adopting the ab fate.

      Comments on revised version:

      The authors have addressed the minor issues raised in the original submission.

    1. Reviewer #2 (Public Review):

      Summary:

      This work demonstrates that when E. coli cells divide, and division is not quite symmetric, the smaller cell has a higher growth rate than the larger cell at the beginning, but not the end, of the cell cycle. The authors then demonstrate that smaller cells have a higher ribosome concentration than larger cells, which is consistent with the idea that the two cells receive roughly equal numbers of ribosomes at division because, as they also observe, ribosomes are excluded by the nucleoid from the middle of the mother cell. The experimental observations are reproduced by a mathematical model that assumes growth is driven by ribosome concentration, with contributions from metabolism and active feedback.

      Strengths:

      The work provides strong evidence in support of the growing consensus that cells correct size fluctuations by modulating growth rate, within a cell cycle and on a single-cell basis. It also offers a plausible explanation for the correction mechanism by showing that ribosomes are excluded from the middle of a mother cell and have a higher concentration in the smaller daughter cell. The work is clearly written and benefits from a strong coupling between the experimental and modeling results. It provides a solid contribution to the field of single-cell bacterial growth control.

      Weaknesses:

      Although the results strongly suggest it, the work does not explicitly demonstrate (e.g. by direct perturbation) that higher ribosome concentration is the cause of the higher growth rate. Also, it is unclear why an active compensation mechanism is needed in the model, i.e., why size-dependent growth (via ribosome concentration) does not correct growth rate perturbations within a cell cycle automatically.

    1. Reviewer #2 (Public Review):

      Summary:

      This work describes the structure of Heparan-alpha-glucosaminide N-acetyltransferase (HGSNAT), a lysosomal membrane protein that catalyzes the acetylation reaction of the terminal alpha-D-glucosamine group required for degradation of heparan sulfate (HS). HS degradation takes place during the degradation of the extracellular matrix, a process required for restructuring tissue architecture, regulation of cellular function and differentiation. During this process, HS is degraded into monosaccharides and free sulfate in lysosomes.

      HGSNAT catalyzes the transfer of the acetyl group from acetyl-CoA to the terminal non-reducing amino group of alpha-D-glucosamine. The molecular mechanism by which this process occur has not been described so far. One of the main reasons to study the mechanism of HGSNAT is that multiple mutations spanning the entire sequence of the protein, such as, nonsense mutations, splice-site variants, and missense mutations lead to dysfunction that causes abnormal accumulation of HS within the lysosomes. This accumulation is a cause of mucopolysaccharidosis IIIC (MPS IIIC), an autosomal recessive neurodegenerative lysosomal storage disorder, for which there are no approved drugs or treatment strategies.<br /> This paper provides a 3.26A structure of HGSNAT, determined by single-particle cryo-EM. The structure reveals that HGSNAT is a dimer in detergent micelles, and a density assigned to acetyl-CoA. The authors speculate about the molecular mechanism of the acetylation reaction, map the mutations known to cause MPS IIIC on the structure and speculate about the nature of the HGSNAT disfunction caused by such mutations.

      Strengths:

      The paper describes a structure of HGSNAT a member of the transmembrane acyl transferase (TmAT) superfamily. The high-resolution of a HGSNAT bound to acetyl-CoA is important for our understanding of HGSNAT mechanism. The density map is of high-quality, except for the luminal domain. The location of the acetyl-CoA allows speculation about the mechanistic role of multiple residues surrounding this molecule. The authors thoroughly describe the architecture of HGSNAT and map the mutations leading to MPS IIIC.

    1. Reviewer #2 (Public Review):

      Summary:

      This paper utilizes a neural network model to investigate how the brain employs an adaptive chunking strategy to effectively enhance working memory capacity, which is a classical and significant question in cognitive neuroscience. By integrating perspectives from both the 'slot model' and 'limited resource models,' the authors adopted a neural network model encompassing the prefrontal cortex and basal ganglia, introduced an adaptive chunking strategy, and proposed a novel hybrid model. The study demonstrates that the brain can adaptively bind various visual stimuli into a single chunk based on the similarity of color features (a continuous variable) among items in visual working memory, thereby improving working memory efficiency. Additionally, it suggests that the limited capacity of working memory arises from the computational characteristics of the neural system, rather than anatomical constraints.

      Strengths:

      The neural network model utilized in this paper effectively integrates perspectives from both slot models and resource models (i.e., resource-like constraints within a slot-like system). This methodological innovation provides a better explanation for the limited capacity of working memory. By simulating the neural networks of the prefrontal cortex and basal ganglia, the model demonstrates how to optimize working memory storage and retrieval strategies through reinforcement learning (i.e., the efficient management of access to and from working memory). This biologically plausible simulation offers a novel perspective on human working memory and potentially provides a novel explanation for the working memory difficulties observed in patients with Parkinson's disease and other disorders. Furthermore, the effectiveness of the model is validated through computational simulation experiments, yielding reliable and robust predictions.

      Weaknesses:

      The model employs a spiking neural network, which is relatively complex. Additionally, while this paper validates the effectiveness of chunking strategies used by the brain to enhance working memory efficiency through computational simulations, further comparison with related phenomena observed in cognitive neuroscience experiments on limited working memory capacity, such as the recency effect, is necessary to verify its generalizability.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Shore et al. investigate the consequent changes in excitability and synaptic efficacy of diverse neuronal populations in an animal model of juvenile epilepsy. Using electrophysiological patch-clamp recordings from dissociated neuronal cultures, the authors find diverging changes in two major populations of inhibitory cell types, namely somatostatin (SST)- and parvalbumin (PV)-positive interneurons, in mice expressing a variant of the KCNT1 potassium channel. They further suggest that the differential effects are due to a compensatory increase in the persistent sodium current in PV interneurons in pharmacological and in silico experiments. It remains unclear why this current is selectively enhanced in PV-interneurons.

      Strengths:

      (1) Heterozygous KCNT1 gain of function variant was used which more accurately models the human disorder.

      (2) The manuscript is clearly written, and the flow is easy to follow. The authors explicitly state the similarities and differences between the current findings and the previously published results in the homozygous KCNT1 gain of function variant.

      (3) This study uses a variety of approaches including patch clamp recording, in silico modeling and pharmacology that together make the claims stronger.

      (4) Pharmacological experiments are fraught with off-target effects and thus it bolsters the authors' claims when multiple channel blockers (TTX and VU170) are used to reconstruct the sodium-activated potassium current.

      Weaknesses:

      (1) This study mostly relies on recordings in dissociated cortical neurons. Although specific WT interneurons showed intrinsic membrane properties like those reported for acute brain slices, it is unclear whether the same will be true for those cells expressing KCNT1 variants, especially when the excitability changes are thought to arise from homeostatic compensatory mechanisms. The authors do confirm that mutant SST-interneurons are hypoexcitable using an ex vivo slice preparation which is consistent with work for other KCTN1 gain of function variants (e.g. Gertler et al., 2022). However, the key missing evidence is the excitability state of mutant PV-interneurons, given the discrepant result of reduced excitability of PV cells reported by Gertler et al in acute hippocampal slices.

    1. Reviewer #2 (Public Review):

      Summary:

      Complexin (Cplx) is expressed at nearly all chemical synapses. Mammalian Cplx comes in four different paralogs which are differentially expressed in different neurons or secretory cell types, either selectively or in combination with one or two other Cplx isoforms. Cplx binds with high affinity to assembled SNARE complexes and promotes evoked synchronous release. Cplx is assumed to preclude premature SV fusion by preventing full SNARE assembly, thereby arresting subsequent SNARE-driven fusion ("fusion-clamp" theory). The protein has multiple domains, the functions of which are controversially discussed. Cplx's function has been studied in a variety of model organisms including mouse, fly, worm, and fish with seemingly conflicting results which led to partly contradicting conclusions.<br /> Makee et al. study the function of mammalian Cplx2 in chromaffin cells by making use of Cplx2 ko mice to overexpress and functionally characterize mutant Cplx2 forms in cultured chromaffin cells. The main conclusion of the present study are:

      The hydrophobic character of the amphipathic helix in Cplx's C-terminal domain is essential for inhibiting premature vesicle fusion at a [Ca2+]i of several hundreds of nM (pre-flash [Ca2+]i). The Cplx-mediated inhibition of fusion under these conditions does not rely on expression of either Syt1 or Syt7.

      Slow-down of exocytosis by N-terminally truncated Cplx mutants in response to a [Ca2+]i of several µM (peak flash [Ca2+]i) occurs regardless of the presence or absence of Syt7 demonstrating that Cplx2 does not act as a switch favoring preferential assembly of the release machinery with Syt1,2 rather than the "slow" sensor Syt7.

      Cplx's N-terminal domain is required for the Cplx2-mediated increase in the speed of exocytosis and faster onset of exocytosis which likely reflect an increased apparent Ca2+ sensitivity and faster Ca2+ binding of the release machinery.

      Strengths:

      The authors perform systematic truncation/mutational analyses of Cplx2. They analyze the impact of single and combined deficiencies for Cplx2 and Syt1 to establish interactions of both proteins.<br /> State-of-the-art methods are employed: Vesicle exocytosis is assayed directly and with high resolution using capacitance measurements. Intracellular [Ca2+] is controlled by loading via the patch-pipette and by UV-light induced flash-photolysis of caged [Ca2+]. The achieved [Ca2+ ] is measured with Ca2+ -sensitive dyes.<br /> The data is of high quality and the results are compelling.

      Weaknesses:

      With the exception of mammalian retinal ribbon synapses (and some earlier RNAi knock down studies which had off-target effects), there is little experimental evidence for a "fusion-clamp"-like function of Cplxs at mammalian synapses. At conventional mammalian synapses, genetic loss of Cplx (i.e. KO) consistently decreases AP-evoked release, and generally either also decreases spontaneous release rates or does not affect spontaneous release, which is inconsistent with a "fusion-clamp" theory. This is in stark contrast to invertebrate (D. m. and C. e.) synapses where genetic Cplx loss is generally associated with a strong upregulation of spontaneous release.

      There are alternative scenarios explaining how Cplx may phenomenological "clamp" vesicle fusion rates without mechanistically assigning a "clamping" function to Cplx (Neher 2010, Neuron). In fact, changes in asynchronous release kinetics following conditioning AP trains observed at Cplx1 ko calyx of Held synapses do not favor a "fusion clamp" model (Chang et al., 2015, J.Neurosci.), while an alternative model, assigning Cplx the role of a "checkpoint" protein in SNARE assembly, quantitatively reproduces all experimental observations (Lopez et al., 2024, PNAS). It might be helpful for a reader to mention such alternative scenarios.

    1. Reviewer #2 (Public Review):

      In this manuscript, Rachubinski and colleagues provide a comprehensive clinical, immunological, and autoantibody assessment of autoimmune/inflammatory manifestations of patients with Down syndrome (DS) in a large number of patients with this disorder. These analyses confirm prior results of excess interferon and cytokine signals in DS patients and extend these observations to highlight early-onset immunological aberrancies, far before symptoms occur, as well as characterizing novel autoantibody reactivities in this patient population. Then, the authors report the interim analysis of an open-label, Phase II, clinical trial of the JAK1/3 inhibitor, tofacitinib, that aims to define the safety, clinical efficacy, and immunological outcomes of DS patients who suffer from inflammatory conditions of the skin. The clinical trial analysis indicates that the treatment is tolerated without serious adverse effects and that the majority of patients have experienced clinical improvement or remission in their corresponding clinical cutaneous manifestations as well as improvement or normalization of aberrant immunological signals such as cytokines.

      The major strength of the study is the recruitment and uniform, systematic evaluation of an impressive number of DS patients. Moreover, the promising early results from the tofacitinib clinical trial pave the way for analysis of a larger number of patients within the Phase II trial and otherwise, which may lead to improved clinical outcomes for affected patients. An inherent weakness of such studies is the descriptive nature of several parameters and the relatively small size of tofacitinib-treated DS patients. However, the descriptive nature of some of the correlative research analyses is of scientific interest and is useful to generate hypotheses for future additional (including mechanistic) work, and treatment of 10 DS patients in a formal clinical trial at interim analysis is not a trivial task for a disease like this. The manuscript achieves the aims of the authors and the results support their conclusions. The authors appropriately acknowledge areas that require more research and areas that are not well understood. The results are represented in a useful manner and statistical methods and analyses appear sound.

    1. Reviewer #2 (Public Review):

      Summary:<br /> In this manuscript, the authors use the Drosophila model system to study the impact of mild head trauma on sex-dependent brain deficits. They identify Sex Peptide as a modulator of greater negative outcomes in female flies. Additionally, they observe that increased age at the time of injury results in worse outcomes, especially in females, and that this is due to chronic suppression of innate immune defense networks in mated females. The results demonstrate a novel signaling pathway that promotes age- and sex-dependent outcomes after head injury.

      Strengths:<br /> The authors have modified their previously reported TBI model in flies to mimic mild TBI, which is novel. Methods are explained in detail, allowing for reproducibility. Experiments are rigorous with appropriate statistics. A number if important controls are included. The work tells a complete mechanistic story and adds important data to increase our understanding of sex-dependent differences in recovery after TBI. The Discussion is comprehensive and puts the work in context of the field.

      Weaknesses: None<br /> The authors answered the following concerns, and I have no other concerns:<br /> A very minor weakness is that exact n values should be included in the figure legends. There should also be confirmation of knockdown by RNAi in female flies either by immunohistochemistry or qRT-PCR if possible.

    1. Reviewer #2 (Public Review):

      Wnt signaling is the name given to a cell-communication mechanism that cells employ to inform on each other's position and identity during development. In cells that receive the Wnt signal from the extracellular environment, intracellular changes are triggered that cause the stabilization and nuclear translocation of β-catenin, a protein that can turn on groups of genes referred to as Wnt targets. Typically these are genes involved in cell proliferation. Genetic mutations that affect Wnt signaling components can therefore affect tissue expansion. Loss of function of APC is a drastic example: APC is part of the β-catenin destruction complex, and in its absence, β-catenin protein is not degraded and constitutively turns on proliferation genes, causing cancers in the colon and rectum. And here lies the importance of the finding: β-catenin has for long been considered to be regulated almost exclusively by tuning its protein turnover. In this article, a new aspect is revealed: Ctnnb1, the gene encoding for β-catenin, possesses tissue-specific regulation with transcriptional enhancers in its vicinity that drive its upregulation in intestinal stem cells. The observation that there is more active β-catenin in colorectal tumors not only because the broken APC cannot degrade it, but also because transcription of the Ctnnb1 gene occurs at higher rates, is novel and potentially game-changing. As genomic regulatory regions can be targeted, one could now envision that mutational approaches aimed at dampening Ctnnb1 transcription could be a viable additional strategy to treat Wnt-driven tumors.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Zhang et al. examine neural activity in the motor cortex as monkeys make reaches in a novel target interception task. Zhang et al. begin by examining the single neuron tuning properties across different moving target conditions, finding several classes of neurons: those that shift their preferred direction, those that change their modulation gain, and those that shift their baseline firing rates. The authors go on to find an interesting, tilted ring structure of the neural population activity, depending on the target speed, and find that (1) the reach direction has consistent positioning around the ring, and (2) the tilt of the ring is highly predictive of the target movement speed. The authors then model the neural activity with a single neuron representational model and a recurrent neural network model, concluding that this population structure requires a mixture of the three types of single neurons described at the beginning of the manuscript.

      Strengths:

      I find the task the authors present here to be novel and exciting. It slots nicely into an overall trend to break away from a simple reach-to-static-target task to better characterize the breadth of how the motor cortex generates movements. I also appreciate the movement from single neuron characterization to population activity exploration, which generally serves to anchor the results and make them concrete. Further, the orbital ring structure of population activity is fascinating, and the modeling work at the end serves as a useful baseline control to see how it might arise.

      Weaknesses:

      While I find the behavioral task presented here to be excitingly novel, I find the presented analyses and results to be far less interesting than they could be. Key to this, I think, is that the authors are examining this task and related neural activity primarily with a single-neuron representational lens. This would be fine as an initial analysis since the population activity is of course composed of individual neurons, but the field seems to have largely moved towards a more abstract "computation through dynamics" framework that has, in the last several years, provided much more understanding of motor control than the representational framework has. As the manuscript stands now, I'm not entirely sure what interpretation to take away from the representational conclusions the authors made (i.e. the fact that the orbital population geometry arises from a mixture of different tuning types). As such, by the end of the manuscript, I'm not sure I understand any better how the motor cortex or its neural geometry might be contributing to the execution of this novel task.

      Main Comments:

      My main suggestions to the authors revolve around bringing in the computation through a dynamics framework to strengthen their population results. The authors cite the Vyas et al. review paper on the subject, so I believe they are aware of this framework. I have three suggestions for improving or adding to the population results:

      (1) Examination of delay period activity: one of the most interesting aspects of the task was the fact that the monkey had a random-length delay period before he could move to intercept the target. Presumably, the monkey had to prepare to intercept at any time between 400 and 800 ms, which means that there may be some interesting preparatory activity dynamics during this period. For example, after 400ms, does the preparatory activity rotate with the target such that once the go cue happens, the correct interception can be executed? There is some analysis of the delay period population activity in the supplement, but it doesn't quite get at the question of how the interception movement is prepared. This is perhaps the most interesting question that can be asked with this experiment, and it's one that I think may be quite novel for the field--it is a shame that it isn't discussed.

      (2) Supervised examination of population structure via potent and null spaces: simply examining the first three principal components revealed an orbital structure, with a seemingly conserved motor output space and a dimension orthogonal to it that relates to the visual input. However, the authors don't push this insight any further. One way to do that would be to find the "potent space" of motor cortical activity by regression to the arm movement and examine how the tilted rings look in that space (this is actually fairly easy to see in the reach direction components of the dPCA plot in the supplement--the rings will be highly aligned in this space). Presumably, then, the null space should contain information about the target movement. dPCA shows that there's not a single dimension that clearly delineates target speed, but the ring tilt is likely evident if the authors look at the highest variance neural dimension orthogonal to the potent space (the "null space")--this is akin to PC3 in the current figures, but it would be nice to see what comes out when you look in the data for it.

      (3) RNN perturbations: as it's currently written, the RNN modeling has promise, but the perturbations performed don't provide me with much insight. I think this is because the authors are trying to use the RNN to interpret the single neuron tuning, but it's unclear to me what was learned from perturbing the connectivity between what seems to me almost arbitrary groups of neurons (especially considering that 43% of nodes were unclassifiable). It seems to me that a better perturbation might be to move the neural state before the movement onset to see how it changes the output. For example, the authors could move the neural state from one tilted ring to another to see if the virtual hand then reaches a completely different (yet predictable) target. Moreover, if the authors can more clearly characterize the preparatory movement, perhaps perturbations in the delay period would provide even more insight into how the interception might be prepared.

    1. Reviewer #2 (Public Review):

      Summary:<br /> After manually labelling 144 human adult hemispheres in the lateral parieto-occipital junction (LPOJ), the authors 1) propose a nomenclature for 4 previously unnamed highly variable sulci located between the temporal and parietal or occipital lobes, 2) focus on one of these newly named sulci, namely the ventral supralateral occipital sulcus (slocs-v) and compare it to neighbouring sulci to demonstrate its specificity (in terms of depth, surface area, gray matter thickness, myelination, and connectivity), 3) relate the morphology of a subgroup of sulci from the region including the slocs-v to the performance in a spatial orientation task, demonstrating behavioural and morphological specificity. In addition to these results, the authors propose an extended reflection on the relationship between these newly named landmarks and previous anatomical studies, a reflection about the slocs-v related to functional and cytoarchitectonic parcellations as well as anatomic connectivity and an insight about potential anatomical mechanisms relating sulcation and behaviour.

      Strengths:<br /> - To my knowledge, this is the first study addressing the variable tertiary sulci located between the superior temporal sulcus (STS) and intra-parietal sulcus (IPS).<br /> - This is a very comprehensive study addressing altogether anatomical, architectural, functional and cognitive aspects.<br /> - The definition of highly variable yet highly reproductible sulci such as the slocs-v feeds the community with new anatomo-functional landmarks (which is emphasized by the provision of a probability map in supp. mat., which in my opinion should be proposed in the main body).<br /> - The comparison of different features between the slocs-v and similar sulci is useful to demonstrate their difference.<br /> - The detailed comparison of the present study with state of the art contextualises and strengthens the novel findings.<br /> - The functional study complements the anatomical description and points towards cognitive specificity related to a subset of sulci from the LPOJ<br /> - The discussion offers a proposition of theoretical interpretation of the findings<br /> - The data and code are mostly available online (raw data made available upon request).

      Weaknesses:<br /> - While the identification of the sulci has been done thoroughly with expert validation, the sulci have not been labelled in a way that enables the demonstration of the reproducibility of the labelling.

      The proposed methodology is convincing in identifying and studying the relationship between highly variable sulci and cognition. This improves our refined understanding of the general anatomical variability in the LPOJ and its potential functional/cognitive correlates. This work is important to the understanding of sulcal variability and its implications on functional and cognitive aspects.

      Comments on revised version:

      Thank you for the elegant and informative work.

    1. Reviewer #2 (Public Review):

      Summary:

      This study shows that when excitatory DREADD receptors are expressed in the ventral area of the cervical spinal cord containing phrenic motoneurons, the systemic administration of the DREADD ligand J60 increases diaphragm EMG activity without altering respiratory rate. The authors took a non-selective expression approach in wild-type mice, as well as a more selective Cre-dependent approach in Chat-Cre mice and Chat-Cre rats to stimulate cervical motoneurons in the spinal cord. This is a proof of principle study that supports the use of DREADD technology to stimulate the motor output to the diaphragm.

      Strengths:

      The strengths of the study lie in the use of both mice and rats and testing activation of diaphragmatic activity with multiple experimental approaches to show that diaphragm EMG and tidal volume are increased.

      Weaknesses:

      Weaknesses of the study consist in the lack of some important control experiments to consolidate the findings: a test of DREADD ligand effects in the absence of viral construct; repeated respiratory challenges within the same recording session in whole body plethysmographs that could compromise the behaving experiments; and lastly, a limited qualitative analysis of the histological data that does not allow for confirmation of expression in phrenic motoneurons.

    1. Reviewer #2 (Public Review):

      Summary:

      The authors set out to determine the role of Rtf1 in Cryptococcal biology, and demonstrate that Rtf1 acts independently of the Paf1 complex to exert regulation of Histone H2B monoubiquitylation (H2Bub1). The biological impact of the loss of H2Bub1 was observed in defects in morphogenesis, reduced production of virulence factors, and reduced pathogenic potential in animal models of cryptococcal infection.

      Strengths:

      The molecular data is quite compelling, demonstrating that the Rtf1-depednent functions require only this histone modifying domain of Rtf1, and are dependent on nuclear localization. A specific point mutation in a residue conserved with the Rtf1 protein in the model yeast demonstrates the conservation of that residue in H2Bub1 modification. Interestingly, whereas expression of the HMD alone suppressed the virulence defect of the rtf1 deletion mutant, it did not suppress defects in virulence factor production.

      Weaknesses:

      The authors use two different species of Cryptococcus to investigate the biological effect of Rtf1 deletion. The work on morphogenesis utilized C. deneoformans, which is well-known to be a robust mating strain. The virulence work was performed in the C. neoformans H99 background, which is a highly pathogenic isolate. The study would be more complete if each of these processes were assessed in the other strain to understand if these biological effects are conserved across the two species of Cryptococcus. H99 is not as robust in morphogenesis, but reproducible results assessing mating and filamentation in this strain have been performed. Similarly, C. deneoformans does produce capsule and melanin.

      There are some concerns with the conclusions related to capsule induction. The images reported in Figure B are purported to be grown under capsule-inducing conditions, yet the H99 panel is not representative of the induced capsule for this strain. Given the lack of a baseline of induction, it is difficult to determine if any of the strains may be defective in capsule induction. Quantification of a population of cells with replicates will also help to visualize the capsular diversity in each strain population.

      The authors demonstrate that for specific mating-related genes, the expression of the HMD recapitulated the wild-type expression pattern. The RNA-seq experiments were performed under mating conditions, suggesting specificity under this condition. The authors raise the point in the discussion that there may be differences in Rtf1 deposition on chromatin in H99, and under conditions of pathogenesis. The data that overexpression of HMD restores H2Bub1 by western is quite compelling, but does not address at which promoters H2Bub1 is modulating expression under pathogenesis conditions, and when full-length Rtf1 is present vs. only the HMD.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript expands the current bulk sequencing data deconvolution toolkit to include ATAC-seq. The EPIC-ATAC tool successfully predicts accurate proportions of immune cells in bulk tumour samples and EPIC-ATAC seems to perform well in benchmarking analyses. The authors achieve their aim of developing a new bulk ATAC-seq deconvolution tool.

      Strengths:

      The manuscript describes simple and understandable experiments to demonstrate the accuracy of EPIC-ATAC. They have also been incredibly thorough with their reference dataset collections and have been robust in their benchmarking endeavours and measured EPIC-ATAC against multiple datasets and tools. This tool will be valuable to the community it serves.

    1. Reviewer #2 (Public Review):

      Summary:

      In this study, the authors identified a previously unrecognized organ interaction where limb immobilization induces thermogenesis in BAT. They showed that limb immobilization by cast fixation enhances the expression of UCP1 as well as amino acid transporters in BAT, and amino acids are supplied from skeletal muscle to BAT during this process, likely contributing to increased thermogenesis in BAT. Furthermore, the experiments with IL-6 knockout mice and IL-6 administration to these mice suggest that this cytokine is likely involved in the supply of amino acids from skeletal muscle to BAT during limb immobilization.

      Strengths:

      The function of BAT plays a crucial role in the regulation of an individual's energy and body weight. Therefore, identifying new interventions that can control BAT function is not only scientifically significant but also holds substantial promise for medical applications. The authors have thoroughly and comprehensively examined the changes in skeletal muscle and BAT under these conditions, convincingly demonstrating the significance of this organ interaction.

      Weaknesses:

      Through considerable effort, the authors have demonstrated that limb-immobilized mice exhibit changes in thermogenesis and energy metabolism dynamics at their steady state. However, The impact of immobilization on the function of skeletal muscle and BAT during cold exposure has not been thoroughly analyzed.

    1. Reviewer #2 (Public Review):

      Intrinsic properties of a neuron refer to the ion channels that a neuron expresses. These ion channels determine how a neuron responds to its inputs. How intrinsic properties link to behavior remains poorly understood. Medina and Margoliash address this question using the zebra finch, a well-studied songbird. Previous studies from their lab and other labs have shown that the intrinsic properties of adult songbird basal-ganglia projecting premotor neurons, are more similar within a bird than across birds. Across birds, this similarity is related to the extent of similarity in the songs; the more similar the song between two birds, the more similar the intrinsic properties between the neurons of these two birds. Finally, the intrinsic properties of these neurons change over the course of development and are sensitive to intact auditory feedback. However, the song features that relate to these intrinsic properties and the function of the within-bird homogeneity of intrinsic properties are unclear.

      In this manuscript, the authors address these two questions by examining the intrinsic properties of basal-ganglia projecting premotor neurons in zebra finch brain slices. Specifically, they focus on the Ih current (as this is related to rhythmic activity in many pattern-generating circuits) and correlate the properties of the Ih current with song features. They find that the sag ratio (a measure of the driving force of the Ih current) and the rebound area (a measure of the post-inhibitory depolarisation) are both correlated with the temporal features of the song. First, they show the presence of correlations between the length of the song motif and the length of the longest syllable (most often a harmonic stack syllable). Based on this, they conclude that longer song motifs are composed of longer syllables. Second, they show that HVCX neurons within a bird have more similar sag ratios and rebound areas than across birds. Third, the mean sag ratio and mean rebound areas across birds were correlated with the duration of the longest harmonic stack within the song. These two results suggest that IPs are correlated with the temporal structure of the song. To further test this, the authors used natural and experimental tutoring procedures to have birds that learned two different types of songs that only differed in length; the longer song had an extra harmonic stack at the end. Using these two sets of birds, the authors find larger sag ratios and higher firing frequencies in birds with longer songs. Fifth, they show that the post-inhibitory rebound area allows neurons to respond to excitatory inputs and produce spikes. Neurons with a larger rebound area have a larger time window for responding to excitatory inputs. Based on this, they speculate that HVCX neurons with larger rebound areas integrate over larger time windows. Finally, they make a network model of HVC and show that one specific model could explain sequence-specific bursting of HVCX neurons.

      Strengths

      The question being addressed is an interesting question and the authors use appropriate techniques. The authors find a new temporal structure within the song, specifically, they find that longer songs typically have more syllables and longer syllables. As far as I know, this has not been shown earlier. The authors build on existing literature to suggest that IPs of HVCX neurons are correlated with the temporal structure of songs.

      Weaknesses

      I have a number of concerns with the statistics and interpretation of the results, insufficient controls for one experiment, and the specifics of the model that affect the implications of these results. These concerns are listed in the recommendations for the authors.

    1. Reviewer #2 (Public Review):

      Summary:

      Hebin et al reported a fascinating story about antibiotic persistence in the biofilms. First, they set up a model to identify the increased persisters in the biofilm status. They found that the adhesion of bacteria to the surface leads to increased c-di-GMP levels, which might lead to the formation of persisters. To figure out the molecular mechanism, they screened the E.coli Keio Knockout Collection and identified the HipH. Finally, the authors used a lot of data to prove that c-di-GMP not only controls HipH over-expression but also inhibits HipH activity, though the inhibition might be weak.

      Strengths:

      They used a lot of state-of-the-art technologies, such as single-cell technologies as well as classical genetic and biochemistry approaches to prove the concept, which makes the conclusions very solid. Overall, it is a very interesting and solid story that might attract diverse readers working with c-di-GMP, persisters, and biofilm.

      Weaknesses:

      (1) Is HipH the only target identified by screening the E.coli Keio Knockout Collection?

      (2) Since the story is complicated, a diagrammatic picture might be needed to illustrate the whole story. And the title does not accurately summarize the novelty of this study.

      (3) The ratio of mVenus NB to mScarlet-I (R) negatively correlates with the concentration of c-di-GMP. Therefore, R -1 demonstrates a positive correlation with the concentration of c-di-GMP. Is this method validated with other methods to quantify c-di-GMP, or used in other studies?

      (4) References are missing throughout the manuscript. Please add enough references for every conclusion.

      (5) The novelty of this study should be clearly written and compared with previous references. For example, is it the first study to report the mechanism that the adhesion of bacteria to the surface leads to increased persister formation?

      (6) in vitro DNA cleavage assay. Why not use bacterial genomic DNA to test the cleaving of HipH on the bacterial genome?

      (7) C-di-gmp -HipH is not a TA, it does not fit in the definition of the TA systems. You can say C-di-gmp is an antitoxin based on your study, but C-di-gmp -HipH is not a TA pair.

    1. Reviewer #2 (Public Review):

      Summary:

      The manuscript by Munday et al. presents real-time predictions of geographic spread during an Ebola epidemic in north-eastern DRC. Predictions were elicited from individual experts engaged in outbreak response and from two mathematical models. The authors found comparable performance between experts and models overall, although the models outperformed experts in a few dimensions.

      Strengths:

      Both individual experts and mathematical models are commonly used to support outbreak response but rarely used together. The manuscript presents an in-depth analysis of the accuracy and decision-relevance of the information provided by each source individually and in combination.

      Weaknesses:

      A few minor methodological details are currently missing.

    1. Reviewer #2 (Public Review):

      Summary:<br /> The authors begin with the stated goal of gaining insight into the known repression of autophagy by Ezrin, a major membrane-actin linker that assembles signaling complexes on membranes. RNA and protein expression analysis is consistent with upregulation of lysosomal proteins in Ezrin-deficient MEFs, which the authors confirm by immunostaining and western blotting for lysosomal markers. Expression analysis also implicates EGF signaling as being altered downstream of Ezrin loss, and the authors demonstrate that Ezrin promotes relocalization of EGFR from the plasma membrane to endosomes. Ezrin loss impacts downstream MAPK/Akt/mTORC1 signaling, although the mechanistic links remain unclear. An Ezrin mutant Medaka fish line wa then generated to test Ezrin's role in retinal cells, which are known to be sensitive to changes in autophagy regulation. Phenotypes in this model appear generally consistent with observations made in cultured cells, though mild overall.

      Strengths:<br /> Data on the impact of Ezrin-loss on relocalization of EGFR from the plasma membrane are extensive, and thoroughly demonstrate that Ezrin is required for EGFR internalization in response to EGF.

      A new Ezrin-deficient in vivo model (Medaka fish) is generated.

      Strong data demonstrates that Ezrin loss suppresses Akt signaling. Ezrin loss also clearly suppresses mTORC1 signaling in cell culture, although examination of mTORC1 activity is notably missing in Ezrin-deficient fish.

      Weaknesses:<br /> LC3 is used as a readout of autophagy, however the lipidated/unlipidated LC3 ratio generally does not appear to change, thus there does not appear to be evidence that Ezrin loss is affecting autophagy in this study.

      The conclusion is drawn that Ezrin loss suppresses EGF signaling, however this is complicated by a strong increase in phosphorylation of the p38 MAPK substrate MK2. Without additional characterization of MAPK and Erk signaling, the effect of Ezrin loss remains unclear.

      Causative conclusions between effects on MAPK, Akt, and mTORC1 signaling are frequently drawn, but the data only demonstrate correlations. For example, many signaling pathways can activate mTORC1 including MAPK/Erk, thus reduced mTORC1 activity upon Ezrin-loss cannot currently be attributed to reduced Akt signaling. Similarly, other kinases can phosphorylate TSC2 at the sites examined here, so the conclusion cannot be drawn that Ezrin-loss causes a reduction in Akt-mediated TSC2 phosphorylation. In Figure 7, the conclusion cannot be drawn that retinal degeneration results from aberrant EGFR signaling.

      It is unclear why TSC1 is highlighted in the title, as there does not appear to be any specific regulation of TSC1 here.

      In Figure 1 the conclusion is drawn that there is an increase in lysosome number with Ezrin KO, however it does not appear that the current analysis can distinguish an increased number from increased lysosome size or activity. Similarly, conclusions about increased lysosome "biogenesis" could instead reflect decreased turnover.

      Immunoprecipitation data for a role for Ezrin as a signaling scaffold appear minimal and seem to lack important controls.

      In Figure 3A it seems difficult to conclude that EGFR dimerization is reduced since the whole blot, including the background between lanes, is lighter on that side.

      In Figure 6C specificity controls for the TSC1 and TSC2 antibodies are not included, but seem necessary since their localization patterns appear very different from each other in WT cells.

      In Figure 7 the signaling effects in Ezrin-deficient fish are mild compared to cultured cells, and effects on mTORC1 are not examined. Further data on the retinal cell phenotypes would strengthen the conclusions.

      In Figure 7F there appears to be more EGFR throughout the cell, so it is difficult to conclude that more EGFR at the PM in Ezrin-/- fish means reduced internalization.

    1. Reviewer #2 (Public Review):

      Summary:

      This study investigates in mice neural mechanisms generating sighs, which are periodic large-amplitude breaths occurring during normal breathing that subserve physiological pulmonary functions and are associated with emotional states such as relief, stress, and anxiety. Sighs are generated by a structure called the preBötzinger complex (preBötC) in the medulla oblongata that generates various forms of inspiratory activity including sighs. The authors have previously described a circuit involving neurons producing bombesin-related peptides Neuromedin B (NMB) and gastrin-releasing peptide (GRP) that project to preBötC neurons expressing receptors for NMB (NMBRs) and GRP (GRPRs) and that activation of these preBötC neurons via these peptide receptors generates sighs. In this study, the authors further investigated mechanisms of sigh generation by applying optogenetic and chemogenetic strategies to selectively activate the subpopulations of preBötC neurons expressing NMBRs and/or GRPRs, and a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs. The authors present convincing evidence that sigh-like inspirations can be evoked by photostimulation of the preBötC neurons expressing NMBRs or GRPRs. Photostimulation of SST neurons can independently evoke sighs, and chemogenetic inhibition of these neurons can abolish sighs. The results presented support the authors' conclusion that the preBötC neurons expressing NMBRs or GRPRs produce sighs via pathways to downstream SST neurons. Thus, these studies have identified some of the preBötC cellular elements likely involved in generating sighs.

      Strengths:

      (1) This study employs an effective combination of electrophysiological, transgenic, optogenetic, chemogenetic, pharmacological, and neuron activity imaging techniques to investigate sigh generation by distinct subpopulations of preBötC neurons in mice.

      (2) The authors extend previous studies indicating that there is a peptidergic circuit consisting of NMB and GRP expressing neurons that project from the parafacial (pF) nucleus region to the preBötC and provides sufficient input to generate sighs, since photoactivation of either pF NMB or GRP neurons evoke ectopic sighs in this study.

      (3) Convincing evidence is presented that sighs can be evoked by direct photostimulation of preBötC neurons expressing NMBRs and/or GRPRs, and also a separate subpopulation of neurons expressing somatostatin (SST) but not NMBRs and GRPRs.

      (4) The mRNA-expression data presented from in situ hybridization indicates that most preBötC neurons expressing NMBR, GRPR (or both) are glutamatergic and excitatory.

      (5) Measurements in slices in vitro indicate that only the NMBR-expressing neurons are normally rhythmically active during normal inspiratory activity and endogenous sigh activity.

      (6) Evidence is presented that activation of preBötC NMBRs and/or GRPRs is not necessary for sigh production, suggesting that sighs are not the unique product of the preBötC bombesin-peptide signaling pathway.

      (7) The novel conclusion is presented that the preBötC neurons expressing NMBRs and/or GRPRs produce sighs via the separate downstream population of preBötC SST neurons, which the authors demonstrate can independently generate sighs, whereas chemogenetic inhibition of preBötC SST neurons selectively abolishes sighs generated by activating NMBRs and GRPRs.

      Weaknesses:

      (1) While these studies have identified subpopulations of preBötC neurons capable of episodically evoking sigh-like inspiratory activity, mechanisms producing the normal slow sigh rhythm were not investigated and remain unknown.

      (2) Several key technical aspects of the study require further clarification to aid in interpreting the experimental results, including issues relating to the validation of the transgenic mouse lines and virally transduced expressions of proteins utilized for optogenetic and chemogenetic experiments, as well as justifying the optogenetic photostimulation paradigms used to evoke sighs.

    1. Reviewer #2 (Public Review):

      Summary:

      Exploring the DEP-MAP database and two drug-screen databases, the authors identify WSB2 as an interactor of several BCL2 proteins. In follow-up experiments, they show that CRL5/WSB2 controls NOXA protein levels via K48 ubiquitination following direct protein-protein interaction, and cell death sensitivity in the context of BH3 mimetic treatment, where WSB2 depletion synergizes with drug treatment.

      Strengths:

      The authors use a set of orthogonal methods across different model cell lines and a new WSB2 KO mouse model to confirm their findings. They also manage to correlate WSB2 expression with poor prognosis in prostate and liver cancer, supporting the idea that targeting WSB2 may sensitize cancers for treatment with BH3 mimetics.

      Weaknesses:

      The conclusions drawn based on the findings in cancer patients are very speculative, as regulation of NOXA cannot be the sole function of CRL5/WSB2 and it is hence unclear what causes correlation with patient survival. Moreover, the authors do not provide a clear mechanistic explanation of how exactly higher levels of NOXA promote apoptosis in the absence of WSB2. This would be important knowledge, as usually high NOXA levels correlate with high MCL1, as they are turned over together, but in situations like this, or loss of other E3 ligases, such as MARCH, the buffering capacity of MCL1 is outrun, allowing excess NOXA to kill (likely by neutralizing other BCL2 proteins it usually does not bind to, such as BCLX). Moreover, a necroptosis-inducing role of NOXA has been postulated. Neither of these options is interrogated here.

    1. Reviewer #2 (Public Review):

      The manuscript by Chen et al. describes how low levels of CPT1A in colorectal cancer (CRC) confer radioresistance by expediting radiation-induced ROS clearance. The authors propose that this mechanism of ROS homeostasis is regulated through FOXM1. CPT1A is known for its role in fatty acid metabolism via beta-oxidation of long-chain fatty acids, making it important in many metabolic disorders and cancers.

      Previous studies have suggested that the upregulation of CPT1A is essential for the tumor-promoting effect in colorectal cancers (CRC) (PMID: 32913185). For example, CPT1A-mediated fatty acid oxidation promotes colorectal cancer cell metastasis (PMID: 2999587), and repression of CPT1A activity renders cancer cells more susceptible to killing by cytotoxic T lymphocytes (PMID: 37722058). Additionally, inhibition of CPT1A-mediated fatty-acid oxidation (FAO) sensitizes nasopharyngeal carcinomas to radiation therapy (PMID: 29721083). While this suggests a tumor-promoting effect for CPT1A, the work by Chen et al. suggests instead a tumor-suppressive function for CPT1A in CRC, specifically that loss or low expression of CPT1A confers radioresistance in CRC. This makes the findings important given that they oppose the previously proposed tumorigenic function of CPT1A. However, the data presented in the manuscript is limited in scope and analysis.

      Major Limitations:

      (1) Analysis of Patient Samples

      - Figure 1D shows that CPT1A levels are significantly lower in COAD and READ compared to normal tissues. It would be beneficial to show whether CPT1A levels are also significantly lower in CRC compared to other tumor types using TCGA data.<br /> - The analysis should include a comparison of closely related CPT1 isoforms (CPT1B and CPT1C) to emphasize the specific importance of CPT1A silencing in CRC.<br /> - Figure 2 lacks a clear description of how IHC scores were determined and the criteria used to categorize patients into CPT1A-high and CPT1A-low groups. This should be detailed in the text and figure legend.<br /> - None of Figure 2B or 2C show how many patients were assigned to the CPT1A-low and CPT1A-high groups.

      (2) Model Selection and Experimental Approaches

      - The authors primarily use CPT1A knockout (KO) HCT116 cells and CPT1A overexpression (OE) SW480 cells for their experiments, which poses major limitations.<br /> - The genetic backgrounds of the cell lines (e.g., HCT116 being microsatellite instable (MSI) and SW480 not) should be considered as they might influence treatment outcomes. This should be acknowledged as a major limitation.<br /> - Regardless of their CPT1A expression levels, for the experiments with HCT116 and SW480 cells in Figure 3C-F, it would be useful to see whether HCT116 cells can be further sensitized to radiotherapy in overexpression and whether SW480 cells can be desensitized through CPT1A KO.<br /> - The use of only two CRC cell lines is insufficient to draw broad conclusions. Additional CRC cell lines should be used to validate the findings and account for genetic heterogeneity. The authors should repeat key experiments with additional CRC cell lines to strengthen their conclusions.

      (3) Pharmacological Inhibition

      Several studies have reported beneficial outcomes of using CPT1 pharmacological inhibition to limit cancer progression (e.g., PMID: 33528867, PMID: 32198139), including its application in sensitization to radiation therapy (PMID: 30175155). Since the authors argue for the opposite case in CRC, they should show this through pharmacological means such as etomoxir and whether CPT1A inhibition phenocopies their observed genetic KO effect, which would have important implications for using this inhibitor in CRC patients.

      (4) Data Representation and Statistical Analysis

      - The relative mRNA expression levels across the seven cell lines (Supplementary Figure 1C) differ greatly from those reported in the DepMap (https://depmap.org/portal/). This discrepancy should be addressed.<br /> - The statistical significance of differences in mRNA and protein levels between RT-sensitive and RT-resistant cells should be shown (Supplementary Figure 1C, D).

      Conclusion

      The study offers significant insights into the role of CPT1A in CRC radioresistance, proposing a tumor-suppressive function. However, the scope and depth of the analysis need to be expanded to fully validate these claims. Additional CRC cell lines, pharmacological inhibition studies, and a more detailed analysis of patient samples are essential to strengthen the conclusions.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript by Wei et al studies the role of ZFP36L1, an RNA-binding protein, in promoting PD-L1 expression in gastric cancer (GC). They used human gastric cancer tissues from six patients and performed H3K27ac CUT&Tag to unbiasedly identify SE specific for the infiltrative type. They identified an SE driving the expression of ZFP36L1 and immune evasion through upregulation of PD-L1. Mechanistically, they show that SPI1 binds to ZFP36L1-SE and ZFP36L1 in turn regulates PD-L1 expression through modulation of the 3'UTR of HDAC3. This mechanism of PD-L1 regulation in gastric cancer is novel, and ZFP36L1 has not been previously implicated in GC progression. However, the data presented are largely correlations and no direct proof is presented that the identified SE regulates ZFP36L1 expression. Furthermore, the effect of ZFP36L1 manipulation elicited a modest effect on PDL1 expression. In fact, several cell lines (XGC1, MNK45) express abundant ZFP36L1 but no PD-L1, suggesting the ZFP36L1 per se is not a key stimulant of PD-L1 expression as IFNg is. Thus, the central conclusions are not supported by the data.

      Strengths:

      Use of human GC specimens to identify SE regulating PD-L1 expression and immune evasion.

      Weaknesses:

      Major comments:

      (1) The difference in H3K27ac over the ZFP36L1 locus and SE between the expanding and infiltrative GC is marginal (Figure 2G). Although the authors establish that ZFP36L1 is upregulated in GC, particularly in the infiltrative subtype, no direct proof is provided that the identified SE is the source of this observation. CRISPR-Cas9 should be employed to delete the identified SE to prove that it is causatively linked to the expression of ZFP36L1.

      (2) In Figure 3C the impact of shZFP36L1 on PD-L1 expression is marginal and it is observed in the context of IFNg stimulation. Moreover, in XGC-1 cell line the shZFP36L1 failed to knock down protein expression thus the small decrease in PD-L1 level is likely independent of ZFP36L1. The same is the case in Figure 3D where forced expression of ZFP36L1 does not upregulate the expression of PDL1 and even in the context of IFNg stimulation the effect is marginal.

      (3) In Figure 4, it is unclear why ELF1 and E2F1 that bind ZFP36L1-SE do not upregulate its expression and only SPI1 does. In Figure 4D the impact of SPI overexpression on ZFP36L1 in MKN45 cells is marginal. Likewise, the forced expression of SPI did not upregulate PD-L1 which contradicts the model. Only in the context of IFNg PD-L1 is expressed suggesting that whatever role, if any, ZFP36L1-SPI1 axis plays is secondary.

      (4) The data presented in Figure 6 are not convincing. First, there is no difference in the tumor growth (Figure 6E). IHC in Figure 6I for CD8a is misleading. Can the authors provide insets to point CD8a cells? This figure also needs quantification and review from a pathologist.

    1. Reviewer #2 (Public Review):

      Trac, Huang, et al used the AZ Drug Combination Prediction DREAM challenge data to make a new random forest-based model for drug synergy. They make comparisons to the winning method and also show that their model has some predictive capacity for a completely different dataset. They highlight the ability of the model to be interpretable in terms of pathway and target interactions for synergistic effects. While the authors address an important question, more rigor is required to understand the full behavior of the model.

      Major Points

      (1) The authors compare DIPx to the winning method of the DREAm challenge, TAJI to show that from molecular features alone they retrain TAJI to create TAJI-M without the monotherapy data inputs. They mention that "of course, we could also use such data in DIPx...", but they never show the behaviour of DIPx with these data. The authors need to demonstrate that this statement holds true or else compare it to the full TAJI.

      (2) It would be neat to see how the DIPx feature importance changes with monotherapy input. For most realistic scenarios in which these models are used robust monotherapy data do exist.

      (3) In Figure 2, the authors compare DIPx and TAJI-M on various test sets. If I understood correctly, they also bootstrapped the training set with n=100 and reported all the model variants in many of the comparisons. While this is a nice way of showing model robustness, calculating p-values with bootstrapped data does not make sense in my opinion as by increasing the value of n, one can make the p-value arbitrarily small. The p-value should only be reported for the original models.

      (4) From Figures 2 and 3, it appears DIPx is overfit on the training set with large gaps in Spearman correlations between Test Set 2/ONeil set and Test Set 1. It also features much better in cases where it has seen both compounds. Could the authors also compare TAJI on the ONeil dataset to show if it is as much overfit?

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, Guayasamin et al. show that early-life stress (ELS) can induce a shift in fear generalisation in mice. They took advantage of a fear conditioning paradigm followed by a discrimination test and complemented learning and memory findings with measurements for anxiety-like behaviors. Next, astrocytic dysfunction in the lateral amygdala was investigated at the cellular level by combining staining for c-Fos with astrocyte-related proteins. Changes in excitatory neurotransmission were observed in acute brains slices after ELS suggesting impaired communication between neurons and astrocytes. To confirm the causality of astrocytic-neuronal dysfunction in behavioral changes, viral manipulations were performed in unstressed mice. Occlusion of functional coupling with a dominant negative construct for gap junction connexin 43 or reduction in astrocytic calcium with CalEx mimicked the behavioral changes observed after ELS suggesting that dysfunction of the astrocytic network underlies ELS-induced memory impairments.

      Strengths:

      Overall, this well-written manuscript highlights a key role for astrocytes in regulating stress-induced behavioral and synaptic deficits in the lateral amygdala in the context of ELS. Results are innovative, and methodological approaches relevant to decipher the role of astrocytes in behaviors. As mentioned by the authors, non-neuronal cells are receiving increasing attention in the neuroscience, stress, and psychiatry fields.

      Weaknesses:

      I do have several suggestions and comments to address that I believe will improve the clarity and impact of the work. For example, there is currently a lack of information on the timeline for behavioral experiments, tissue collection, etc.

    1. The South Florida influencers, for instance, heard a rumor circulating that the government had put microchips in the coronavirus vaccine so it could track people.

      Notice that many fake news stories begin from a place of fear. This fear hijacks our brains and triggers fight or flight options in our system I circuitry and actively prevent the use of the rational parts of system II which would quickly reveal problems in the information.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, the authors use a combination of transgenic animals, intersectional viruses, retrograde tracing, and ex-vivo slice electrophysiology to show that VTA projection neurons synapse locally. First, the authors injected a cre-dependent channelrhodopsin into the VTA of PV, SST, MOR, and NTS-Cre mice. Importantly, PV, SST, MOR, and NTS are molecular markers previously used to describe VTA interneurons. Imaging of known VTA target regions identified that these neurons are not localized to the VTA and instead project to the PFC, NAc, VP, and LHb. Next, the authors used an intersectional viral strategy to label projection neurons with both GFP (membrane localized) and Syn:Ruby (release sites). These experiments identified that VTA projection neurons also make intra-VTA synapses. Finally, the authors use a combination of optogenetics and ex-vivo slice electrophysiology to show that neurons projecting from the VTA to the NAc/VP/PFC also synapse locally. Overall, most of the conclusions seem to be well supported by the data.

      Strengths:

      Previous literature has described Pvalb, Sst, Oprm1, and Nts as selective markers of VTA interneurons. Here, the authors make use of cre driver lines to show that neurons defined by these genes are not interneurons and project to known VTA target regions. Additionally, the authors convincingly use intersectional viral approaches and slice electrophysiology to show that projection neurons synapse onto neighboring cells within the VTA

      Weaknesses:

      While the authors use several cre driver lines to identify GABAergic projection neurons, they then use wild-type mice to show that projection neurons synapse onto neighboring cells within the VTA. This does not seem to lend evidence to the idea that previously described "interneurons" are projection neurons that collateralize within the VTA.

    1. Reviewer #2 (Public Review):

      Summary:

      Franke et al. characterize the representation of color in the primary visual cortex of mice, highlighting how this changes across the visual field. Using calcium imaging in awake, head-fixed mice, they characterize the properties of V1 neurons (layer 2/3) using a large center-surround stimulation where green and ultra-violet colors were presented in random combinations. Clustering of responses revealed a set of functional cell-types based on their preference to different combinations of green and UV in their center and surround. These functional types were demonstrated to have different spatial distributions across V1, including one neuronal type (Green-ON/UV-OFF) that was much more prominent in the posterior V1 (i.e. upper visual field). Modelling work suggests that these neurons likely support the detection of predator-like objects in the sky.

      Strengths:

      The large-scale single-cell resolution imaging used in this work allows the authors to map the responses of individual neurons across large regions of the visual cortex. Combining this large dataset with clustering analysis enabled the authors to group V1 neurons into distinct functional cell types and demonstrate their relative distribution in the upper and lower visual fields. Modelling work demonstrated the different capacity of each functional type to detect objects in the sky, providing insight into the ethological relevance of color opponent neurons in V1.

      Weaknesses:

      It is unfortunate the authors were unable to provide stronger mechanistic insights into how color opponent neurons in V1 are formed.

      Overall, this study will be a valuable resource for researchers studying color vision, cortical processing, and the processing of ethologically relevant information. It provides a useful basis for future work on the origin of color opponency in V1 and its ethological relevance.

    1. Reviewer #3 (Public Review):

      Summary:<br /> Animals can evaluate food quality in many ways. In contrast to the rapid sensory evaluation with smell and taste, the mechanism of slow nutrient sensation and its impact on food choice is unexplored. The authors utilize C. elegans larvae and their bacterial food as an elegant model to tackle this question and reveal the detailed molecular mechanism to avoid nutrient-poor foods.

      Strength:<br /> The strength of this study is that they identified the molecular identities of the critical players in bacterial food and C. elegans using unbiased approaches, namely metabolome analysis, E. coli mutant screening, and RNA sequencing. Furthermore, they strengthened their findings by thorough experiments combining multiple methods such as genetics, fluorescent reporter analysis, and Western blot.

      Weakness:<br /> The major caveat of this study is the reporter genes; specifically, transcriptional reporters used to monitor the UPRER and immune responses in the intestine of C. elegans. However, their tissue-specific rescue experiments suggest that the genes in the UPRER and immune response function in the neurons. Thus, we should carefully interpret the results of the reporter genes. Another point to be aware of is that although they show that lack of carbohydrates elicits the response to "low-quality" food, carbohydrate supplementation with heat-killed E. coli was insufficient to support animal growth.

      Overall, this work provides convincing data to support their model. In the C. elegans field, the behaviors of larvae are not well studied compared to adults. This work will pose an interesting question about the difference between larvae and adults in nutrition sensing in C. elegans and provide a framework and candidate molecules to be studied in other organisms.

    1. Reviewer #2 (Public Review):

      Summary:

      This manuscript by Peters, Rakateli, et al. aims to characterize the contribution of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. In addition, the authors provide a rescue of the miR-26b using lipid nanoparticles (LNPs), with potential therapeutic implications. In addition, the authors provide useful insights into the role of macrophages and some validation of the effect of miR-26b LNPs on human liver samples.

      Strengths:

      The authors provide a well-designed mouse model, that aims to characterize the role of miR-26b in a mouse model of metabolic dysfunction-associated steatohepatitis (MASH) generated by a Western-type diet on the background of Apoe knock-out. The rescue of the phenotypes associated with the model used using miR-26b using lipid nanoparticles (LNPs) provides an interesting avenue to novel potential therapeutic avenues.

      Weaknesses:

      Although the authors provide a new and interesting avenue to understand the role of miR-26b in MASH, the study needs some additional validations and mechanistic insights in order to strengthen the author's conclusions.

      (1) Analysis of the expression of miRNAs based on miRNA-seq of human samples (see https://ccb-compute.cs.uni-saarland.de/isomirdb/mirnas) suggests that miR-26b-5p is highly abundant both on liver and blood. It seems hard to reconcile that despite miRNA abundance being similar in both tissues, the physiological effects claimed by the authors in Figure 2 come exclusively from the myeloid (macrophages).

      (2) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26a-5p is indeed 4-fold higher than miR-26b-5p both in the liver and blood. Since both miRNAs share the same seed sequence, and most of the supplemental regions (only 2 nt difference), their endogenous targets must be highly overlapped. It would be interesting to know whether deletion of miR-26b is somehow compensated by increased expression of miR-26a-5p loci. That would suggest that the model is rather a depletion of miR-26.

      UUCAAGUAAUUCAGGAUAGGU mmu-miR-26b-5p mature miRNA<br /> UUCAAGUAAUCCAGGAUAGGCU mmu-miR-26a-5p mature miRNA

      (3) Similarly, the miRNA-seq expression from isomirdb suggests also that expression of miR-26b-5p is indeed 50-fold higher than miR-26b-3p in the liver and blood. This difference in abundance of the two strands is usually regarded as one of them being the guide strand (in this case the 5p) and the other being the passenger (in this case the 3p). In some cases, passenger strands can be a byproduct of miRNA biogenesis, thus the rescue experiments using LNPs with both strands in equimolar amounts would not reflect the physiological abundance miR-26b-3p. The non-physiological overabundance of miR-26b-3p would constitute a source of undesired off-targets.

      (4) It would also be valuable to check the miRNA levels on the liver upon LNP treatment, or at least the signatures of miR-26b-3p and miR-26b-5p activity using RNA-seq on the RNA samples already collected.

      (5) Some of the phenotypes described, such as the increase in cholesterol, overlap with the previous publication by van der Vorst et al. BMC Genom Data (2021), despite in this case the authors are doing their model in Apoe knock-out and Western-type diet. I would encourage the authors to investigate more or discuss why the initial phenotypes don't become more obvious despite the stressors added in the current manuscript.

      (6) The authors have focused part of their analysis on a few gene makers that show relatively modest changes. Deeper characterization using RNA-seq might reveal other genes that are more profoundly impacted by miR-26 depletion. It would strengthen the conclusions proposed if the authors validated that changes in mRNA abundance (Sra, Cd36) do impact the protein abundance. These relatively small changes or trends in mRNA expression, might not translate into changes in protein abundance.

      (7) In Figures 5 and 7, the authors run a phosphorylation array (STK) to analyze the changes in the activity of the kinome. It seems that a relatively large number of signaling pathways are being altered, I think that should be strengthened by further validations by Western blot on the collected tissue samples. For quite a few of the kinases, there might be antibodies that recognise phosphorylation. The two figures lack a mechanistic connection to the rest of the manuscript.

    1. Reviewer #2 (Public Review):

      Li and colleagues investigate the enzymatic activity-independent function of IDH1 in regulating erythropoiesis. This manuscript reveals that IDH1 deficiency in the nucleus leads to the redistribution of histone marks (especially H3K79me3) and chromatin state reprogramming. Their findings suggest a non-typical localization and function of the metabolic enzyme, providing new insights for further studies into the non-metabolic roles of metabolic enzymes. However, there are still some issues that need addressing:

      (1) Could the authors show the RNA and protein expression levels (without fractionation) of IDH1 on different days throughout the human CD34+ erythroid differentiation?

      (2) Even though the human CD34+ erythroid differentiation protocol was published and cited in the manuscript, it would be helpful to specify which erythroid stages correspond to cells on days 7, 9, 11, 13, and 15.

      (3) It is important to mention on which day the lentiviral knockdown of IDH1 was performed. Will the phenotype differ if the knockdown is performed in early vs. late erythropoiesis? In Figures 1C and 1D, on which day do the authors begin the knockdown of IDH1 and administer NAC and GSH treatments?

      (4) The authors validate that IDH1 regulates erythropoiesis in an enzymatic activity-independent manner by adding ROS scavengers or α-KG. Given the complexity of metabolic pathways, these two strategies may not suffice. Mutating the enzymatic active site could provide a clearer explanation for this point.

      (5) While the cell phenotype of IDH1 deficiency is quite dramatic, yielding cells with larger nuclei and multi-nuclei, the authors only attribute this phenotype to defects in chromatin condensation. Is it possible that IDH1-knockdown cells also exhibit primary defects in mitosis/cytokinesis (not just secondary to the nuclear condensation defect)?), given the function of H3K79Me in cell cycle regulation?

      (6) Why are there two bands of Histone H3 in Figure 4A?

      (7) Are the density and localization of histone modifications (not just H3K79me3) in Sg-NEG-IDH1 HuDEP2 cells similar to those in IDH1-shRNA erythroid cells compared to control cells?

      (8) Displaying a heatmap and profile plots in Figure 5A between control and IDH1-deficient cells will help illustrate changes in H3K79me3 density in the nucleus after IDH1 knockdown.

      (9) Are the distribution and intensity of H3K79me3 in primary healthy erythroid cells in the bone marrow similar to or distinct from those in AML and MDS cells? The authors could present at least one sample of healthy donor cells for comparison.

      (10) In Figure 7E, why are the bands of Luciferase-shRNA in the input and probe both light, while the bands of IDH1-shRNA are both dark? This suggests that the expression of KLF1 is much higher in IDH1-shRNA cells than in control cells. Therefore, this result may not strongly support the increased binding of KLF1 at the SIRT1 promoter after IDH1 knockdown.

    1. Reviewer #2 (Public Review):

      The authors present a computational methodology for de-biasing/denoising high-throughput genomic signals using optimal transport techniques, thus allowing disparate datasets to be merged and jointly analysed. They apply this methodology on liquid biopsy data and they demonstrate improved performance (compared to simpler bias-correcting approaches) for cancer detection using common machine learning algorithms. This is a theoretically interesting and potentially useful approach for addressing a very common practical problem in computational genomics.

      I have the following recommendations:

      (1) When comparing performance metrics between different approaches (e.g., tables 3 and 4), 95% confidence intervals should also be provided and a pairwise statistical test should be applied to establish whether the observed difference in each performance metric between the proposed method and the alternatives is statistically significant, thus justifying the claim that the proposed method offers an improvement over existing methodologies.

      (2) The commonly used center-and-scale and GC debias approaches presented by the authors are fairly simple. How does their methodology compare to more elaborate approaches, such as tangent normalisation (https://academic.oup.com/bioinformatics/article/38/20/4677/6678978) and robust PCA (https://github.com/mskilab-org/dryclean)?

      (3) What is the computational cost of the proposed methodology and how does it compare to the alternatives?

      (4) The proposed approach relies on a reference dataset, against which a given dataset is adapted. What are the implications for cross-validation experiments (which are essential for assessing the out-of-sample error of every methodology), particularly with regards to the requirement to avoid information leakage between training and validation/test data sets?

      In conclusion, this is an interesting and potentially useful paper and I would like to encourage the authors to address the above points, which hopefully will strengthen their case.

    1. Reviewer #2 (Public Review):

      Summary:

      In this manuscript, the authors investigated whether a salticid spider, Phidippus regius, recognizes other individuals of the same species. The authors placed each spider inside a container from which it could see another spider for 7 minutes, before having its view of the other spider occluded by an opaque barrier for 3 minutes. The spider was then either presented with the same individual again (habituation trial) or a different individual (dishabituation trial). The authors recorded the distance between the two spiders during each trial. In habituation trials, the spiders were predicted to spend more time further away from each other and, in dishabituation trials, the spiders were predicted to spend more time closer to each other. The results followed these predictions, and the authors then considered whether the spiders in habituation trials were generally fatigued instead of being habituated to the appearance of the other spider, which may have explained why they spent less time near the other individual. The authors presented the spiders with a different (novel) individual after a longer period of time (which they considered to be a long-term dishabituation trial), and found that the spiders switched to spending more time closer to the other individual again during this trial. This suggested that the spiders had recognized and had habituated to the individual that they had seen before and that they became dishabituated when they encountered a different individual.

      Strengths:

      It is interesting to consider individual recognition by Phidippus regius. Other work on individual recognition by an invertebrate has been, for instance, known for a species of social wasp, but Phidippus regius is a different animal. Importantly and more specifically, P. regius is a salticid spider, and these spiders are known to have exceptional eyesight for animals of their size, potentially making them especially suitable for studies on individual recognition. In the current study, the results from experiments were consistent with the authors' predictions, suggesting that the spiders were recognizing each other by being habituated to individuals they had encountered before and by being dishabituated to individuals they had not encountered before. This is a good start in considering individual recognition by this species.

      Weaknesses:

      The experiments in this manuscript (habituation/dishabituation trials) are a good start for considering whether individuals of a salticid species recognize each other. I am left wondering, however, what features the spiders were specifically paying attention to when recognizing each other. The authors cited Sheehan and Tibbetts (2010) who stated that "Individual recognition requires individuals to uniquely identify their social partners based on phenotypic variation." Also, recognition was considered in a paper on another salticid by Tedore and Johnsen (2013).

      Tedore, C., & Johnsen, S. (2013). Pheromones exert top-down effects on visual recognition in the jumping spider Lyssomanes viridis. The Journal of Experimental Biology, 216, 1744-1756. doi: 10.1242/jeb.071118

      In this elegant study, the authors presented spiders with manipulated images to find out what features matter to these spiders when recognizing individuals.

      Part of the problem with using two living individuals in experiments is that the behavior of one individual can influence the behavior of the other, and this can bias the results. However, this issue can be readily avoided because salticids are well known, for example, to be highly responsive to lures (e.g. dead prey glued in lifelike posture onto cork disks) and to computer animation. These methods have already been successful and helpful for standardizing the different stimuli presented during many different experiments for many different salticid spiders, and they would be helpful for better understanding how Phidippus regius might recognize another individual on the basis of phenotypic variation. There are all sorts of ways in which a salticid might recognize another individual. Differences in face or body structure, or body size, or all of these, might have an important role in recognition, but we won't know what these are using the current methods alone. Also, I didn't see any details about whether body size was standardized in the current manuscript.

      For another perspective, my thoughts turn to a paper by Cross et al.

      Cross, F. R., Jackson, R. R., & Taylor, L. A. (2020). Influence of seeing a red face during the male-male encounters of mosquito-specialist spiders. Learning & Behavior, 48, 104-112. doi: 10.3758/s13420-020-00411-y

      These authors found that males of Evarcha culicivora, another salticid species that is known to have a red face, become less responsive to their own mirror images after having their faces painted with black eyeliner than if their faces remained red. In all instances, the spiders only saw their own mirror images and never another spider, and these results cannot be interpreted on the basis of habituation/dishabituation because the spiders were not responding differently when they simply saw their mirror image again. Instead, it was specifically the change to the spider's face which resulted in a change of behavior. The findings from this paper and from Tedore and Johnsen can help give us additional perspectives that the authors might like to consider. On the whole, I would like the authors to further consider the features that P. regius might use to discern and recognize another individual.

    1. Reviewer #2 (Public Review):

      Summary:

      The present article by Tesler et al proposes a 3-population model of the striatum input-output function including the direct pathway (D1) striatal projection neurons (dSPNs), the indirect pathway (D2) striatal projection neurons (iSPNs), and the fast-spiking striatal interneurons. The authors derive a mean-field version of the model where the firing rate of each population follows the transfer function obtained from a spiking (AdEx) neuron model for each cell population. They report the response of the mean-field circuit to oscillatory inputs from the cortex, the effect of dopamine on dSPNs and iSPNs, and how a simple reinforcement learning rule at cortico-striatal synapses would adapt the model's output in the face of 2 distinct inputs.

      Strengths:

      The model is simple and easy to understand.

      Weaknesses:

      Feedforward inhibition from FSI and interconnections between dSPNs and iSPNs does not seem to have any significant impact on the input-output response of dSPNs and iSPNs to cortical inputs. Therefore, all of the results shown can be derived relatively easily from the basic knowledge we have about mean-field neuronal models and their responses to external inputs: all populations have an output that linearly follows the input. Concerning the reinforcement learning paradigm, showing that 2 distinct inputs can be associated with opposite outputs based on a tri-partite synaptic learning rule does not appear new either. As it is, it's unclear to me how this model contributes to new knowledge concerning striatal neuronal activity. Moreover, the assumptions made concerning the effect of dopamine and the synaptic plasticity rules appear rather simplistic and relatively outdated.

      Many of the goals set in the introduction do not appear met:

      "understanding and modelling the complex dynamics and functions of the striatum constitutes a very relevant and challenging task".<br /> I'm not sure if the authors aim to understand and model the complex dynamics of the striatum here: there are no complex dynamics that are revealed or explained in the model, as the dSPNs and iSPNs mainly appear to have a linear relationship to their inputs (with added noise) in 3 for example. I did not find any non-trivial dynamics highlighted in the presentation of the results either.

      "modelling and studying the functions of the striatum and its associated neuronal dynamics requires to investigate these cellular/microcircuits mechanisms, and how the small-scale mechanisms affect large-scale behavior"<br /> I also did not find a statement about the effect of cellular/microcircuit mechanisms on behavior or large-scale activity in the results or discussion. The effects of micro-circuits are rather transparent as dSPNs and iSPNs do not seem to differ from feedforward responses to cortical inputs.

      "existing mean-fields are based on generic models (sometimes inspired by cortical circuits) [7, 8], which do not consider the rich and specific cellular and synaptic variability observed along brain regions."<br /> The authors argue here that specific input-output relationships of striatal neurons may contribute to the circuit dynamics. However, the input-output they derive from a spiking neuron model (AdEx) in Figure 2, are very typical IF curves used in most mean-field models. Apart from a slight saturation effect at large rates (which is incorporated in many mean-field models and may not even be relevant here given the max firing of these cells), the I-F curve looks exactly like what is expected from the most basic rate model neuron with a rectifying transfer function in the presence of synaptic noise. What cellular or synaptic properties would the authors like to highlight here? Linking to molecular and cellular parameters, as advertised in the intro, seems much beyond the current achievements of the present model.

      "This approach permits an efficient transition between scales and, furthermore, it allows to explore the effects of cellular parameters at the network level, as we will show for the case of dopaminergic effects in the striatum."<br /> If the authors mean the excitation of D1 SPNS and the inhibition of D2 SPNs by dopamine, this statement seems slightly oversold. It's very well known that dopaminergic effects cannot simply be resumed by a change in excitability as it acts on non-linear currents and complex synaptic parameters. They model it as follows: "To model these effects of dopamine in dSPN cells we will assume the increase of excitability due to D1 activation in dPSNs can be described as an increase in the glutamatergic conductance (Qe in our model) together with the action of a depolarizing current" Which basically means an additional excitatory input and a depolarizing current. The expected effect on the firing rate of these 2 effects is rather simple and does not require circuit modelling I believe.

      This effect of dopamine is referred to in the discussion as: "This analysis allowed us to show how modifications at the cellular level can be incorporated within the mean-field model which can in turn predict and capture the emergent changes at the network level generated by them, and in addition has provided further validation to our model."<br /> Again, I don't see any emergent property or model validation here. Maybe the authors can be a bit more precise about what emergent property they refer to.

      "In addition it illustrates how changes at the cellular level can lead to emerging effects at the network level, which can be captured by the mean-field model"<br /> I did not find any description of 'emerging effects at the network level" in the results or discussion. Maybe the authors could elaborate on what they mean here.

      "shows the capabilities of the model to reproduce specific brain functions"<br /> The capacity of a network to associate stim A to a positive output and stim B to a negative one through reward-driven synaptic plasticity is rather well described and is a bit far from 'specific brain functions'. Concerning the discussion, it highlights how the model 'could be useful' rather than highlighting any strength of the model or relation to existing work. In particular, the (large) literature on circuit modelling in the striatum and BG circuits is not cited at all beyond self-citations, except in one book chapter (Houk et al, 1995) and one paper (Bogacz, 2020).

      "The RL model proposed can very easily be improved to capture more biologically complex scenarios"<br /> Why did the authors not implement such an 'easy' improvement?