PatientID: 277

KindredID: 108

Case: M, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 277, presented with a CNS hemangioblastoma at age 16, retinal angioma a 20, and renal cell carcinoma at 28. Their father who passed away before diagnosis presented with a CNS hemangioblastoma at 48.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0005584 (Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband, patient 277, presented with a CNS hemangioblastoma at age 16, retinal angioma a 20, and renal cell carcinoma at 28.

CaseNotHPOs: HP:0002666; HP:0001737; HP:0001732 (Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 30

KindredID: 11

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 30) has a son (patient 31) who was genetically confirmed with the mutation, who was asymptomatic at the time of analysis. She also has a father (patient 32, CNS hemangioblastoma at 42), a brother 1 (patient 33, CNS hemangioblastoma at 28), brother 2 (patient 34, CNS hemangioblastoma at 30), and uncle (patient 35, retinal angioma at 60) who passed away before they could be diagnosed/ genetically confirmed with the mutation.

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Hemangioblastoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma at 28, retinal angioma at 26, renal cell carcinoma at 37, and multiple pancreatic cysts/tumors at 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336). This mutation was also published in PMID 32179488 in reference to one patient with VHL disease type 1 in this paper with the c.227_229del variant. However, it is unclear whether patient #27, #28, or #30 is specifically published in PMID 32179488.

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.F76del (c.227_229del)

LegacyVariant: F76del (c.224_226delTCT)

CaseProblemVariantFreeText: The protein coding change for this variant is listed in this paper as p.F76Cfs*138. However the DNA change listed in this paper (c.224_226delTCT) is equivalent to c.227_229delTCT, and results in p.F76del. This variant is entered on CIViC with p.F76del. As a note the latter c. nomenclature is preferred due to the 3' rule.

ClinVarID: N/A

CAID: CA357012; https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.224_226del

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.224_226delTCT)

MultipleGeneVariants: N/A

PatientID: 259

KindredID: 100

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 259, presented with a CNS hemangioblastoma and multiple pancreatic cysts/tumors at age 28, and a retinal angioma at age 24. The proband's son, patient 260, was asymptomatic at the time of analysis.

CasePresentingHPOs: N/A

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband, patient 259, presented with a CNS hemangioblastoma and multiple pancreatic cysts/tumors at age 28, and a retinal angioma at age 24.

CaseNotHPOs: HP:0002666; HP:0005584 (Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 1-2 Deletion (c.1-?_463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1-2 Deletion

MultipleGeneVariants: N/A

PatientID: III-4 (Proband)

KindredID: 1

Case: M, 28Y0M, Mexican

DiseaseAssertion: VHL

FamilyInfo: Family composed of six affected individuals and three diseased subjects (III-2, III-3, III-4) were studied. III-4 (proband) presented with a CNS hemangioblastoma and a retinal hemangioblastoma. The mother (II-1) developed cerebellar, medullar and bilateral retinal HBs; two maternal aunts (II-2 and II-3) were affected by retinal and CNS HBs and unspecified renal tumors, whereas his grandfather (I-2) had unspecified abdominal tumors. All these relatives died in their early 30s. A 35-year-old sister (III-2) demonstrated cerebellar HB, right eye retinal HB and renal cell carcinoma, whereas a 32-year-old brother (III-3) presented with cerebellar HB, right eye retinal HB, renal cell carcinoma and pheochromocytoma. A mutation-carrier nephew (IV-2) presented only atrophy of the retinal pigment epithelium. All of these family members were found to have the R82P (c.245G>C) germline VHL variant. Eighteen additional healthy relatives were analyzed and tested negative for the mutation.

CohortInfo: Two families and one apparently non-familial case were studied at the Institute of Ophthalmology ‘Conde de Valenciana’ (Mexico City, Mexico).

CasePresentingHPOs: HP:0010797; HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: MRI of brain and spine was performed in this subject demonstrating cerebellar HB. Funduscopic evaluation of the right eye showed a well defined orange-red mass corresponding to a peripheral retinal HB of approximately 1 disc diameter associated with a prominent feeding artery and to a draining vein. FAG demonstrated hyperfluorescence of this retinal angioma as well as enlargement and tortuosity of retinal blood vessels.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Family pedigree (Figure 1(a))

Variant: p.R82P (c.245G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 526675, https://www.ncbi.nlm.nih.gov/clinvar/variation/526675/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R82P (c.245G>C)

MultipleGeneVariants: N/A

PatientID: 1 (case)

KindredID: 1

Case: F, 30Y0M, Vietnamese

DiseaseAssertion: VHL

FamilyInfo: None - The diagnosis of VHL had not been established in her parents or her relatives, who lived in Vietnam without further evaluation.

CasePresentingHPOs: HP:0009711; HP:0001737 (retinal capillary hemangioma; pancreatic cysts)

CaseHPOFreeText: At 28Y presented with multiple retinal capillary hemangioma (complicated tractional retinal detachment and multiple large angiomas) and multiple pancreatic cysts. Underwent PPV combined with relaxing retinectomy.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 8

Case: 37Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0005584; HP:0009711; HP:0006880 (renal cell carcinoma; retinal capillary hemangioma; cerebellar hemangioblastoma)

CaseHPOFreeText: patient had retinal angiomas diagnosed at 28Y, cerebellar hemangioblastomas diagnosed at 22Y, and renal cell carcinoma diagnosed at 37Y.

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.R177* (c.529A>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 625258 https://www.ncbi.nlm.nih.gov/clinvar/variation/625258/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R177* (c.529A>T)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 1 (Proband)

KindredID: 12

Case: M, 57Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: This patient had a father that was assumed to have the c.406T>C germline mutation of the VHL gene but was not confirmed genetically. His father presented with renal cell carcinoma and died at 47Y.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0000077; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the kidney, Abnormality of the pancreas)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (37Y), retinal angioma (27Y) and renal and pancreatic cyst or tumor (unspecified) (28Y).

CaseNotHPOs: HP:0002666; HP:0005584 (Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: p.S65P (c.193T>C)

LegacyVariant: c.406T>C

CaseProblemVariantFreeText: N/A

ClinVarID: 547829, https://www.ncbi.nlm.nih.gov/clinvar/variation/547829/

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reference sequence is unclear in the current paper. After consulting the SickKids patient database, and finding the protein change to be recorded as: p.Ser65Pro, it was concluded that the current paper reported the cDNA change according to the legacy reference sequence (AF010238.1) and was mapped to c.193T>C (NM_000551.3).

MutationType: missense_variant;transition

CivicName: S65P (c.193T>C)

MultipleGeneVariants: N/A

PatientID: 6 (Mother)

KindredID: 18

Case: F, 75Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (54Y) and retinal angioma (28Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0001732; HP:0002666 (Renal cell carcinoma, Abnormality of the kidney, Abnormality of the pancreas, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: N/A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Authors state that the c.712C>T germline familial variant of the VHL gene in this patient is “inferred from the family”. No genetic testing was done on this patient to confirm this. Being that this familial variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: N/A

CivicName: N/A

MultipleGeneVariants: N/A

GroupID: 18

Case: 28Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: retinal capillary hemangioma

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: patient had retinal angiomas diagnosed at 28Y

CaseNotHPOs: HP:0005584; HP:0002666; HP:0006880 (renal cell carcinoma; pheochromocytoma; cerebellar hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.R113Efs*46 (c.337del)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA432420675 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.337del

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: R113FS (c.337delC)

MultipleGeneVariants: N/A