PatientID: 6

KindredID: 4 (D)

Case: M, 25Y0M, Hungarian

DiseaseAssertion: VHL

FamilyInfo: Patient was the only available member of the family. His father had died several years ago due to a central nervous system tumour, probably a complication of VHL disease

CasePresentingHPOs: HP:0006880; HP:0009713; HP:0006770 (cerebellar hemangioblastoma, spinal hemangioblastoma, clear cell renal cell carcinoma)

CaseHPOFreeText: Cerebellar and spinal cord hemangioma diagnoses.

CaseNotHPOs: HP:0002666; HP:0009711 (pheochromocytoma, retinal capillary hemangioma)

CaseNotHPOFreeText: No other manifestations of VHL disease were detected. See table 1.

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y185* (c.555C>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVar: N/A

CAID: CA351756378 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.555C%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: T185* (c.555C>A)

MultipleGeneVariants: N/A

PatientID: III:2

KindredID: 1

Case: F, 62, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient's father (II:3) had a brain tumour at age 53 and died at age 78. The patient's paternal aunt (II:1) died of stomach cancer at age 80. The patient's paternal grandfather died at age 50 due to a brain tumour. The patient had three children all of whom carried the P25L mutation and were asymptomatic (IV:4 and IV:6) except patient IV:2 who presented with a retinal hemangioma and renal cyst. Her daughter (IV:2) had three children and one was found to carry the mutation. The patient had seven siblings, five of whom underwent genetic testing. Two were found to carry the mutation but both were asymptomatic (patient III:3 and III:11). Patient III:3 had six children one of whom died due to clear cell renal carcinoma at age 48 but did not carry the P25L mutation. Of the 13 family members tested, V:2, IV:4, IV:6, III:3, and III:11 were all found to carry the P25L mutation in the VHL gene. Refer to Figure 1 for pedigree.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: VHL12

Case: M, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 190 patients recruited by the COMETE network over 15 years were included in the study.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient had two benign pheochromocytomas.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHB/SDHC/SDHD

PreviouslyPublished: N/A

SupplementalData: Table 1 of Supplementary

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had LOH found in the BAC array CGH data.

MutationType: missense_variant;transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 7

Case: M, 58Y0M, Chinese

DiseaseAssertion: Assumed VHL

FamilyInfo: Patient had family history of VHL disease. Patient’s nephew presented with renal cell carcinoma at 30, patient's sister/brother presented with a hemangioblastoma at age 39 and then retinal capillary hemangioma, renal cell carcinoma, and abnormality of the pancreas at age 57. Patient’s sister presented with a hemangioblastoma at age 40. All three of these family members were genetically tested and possessed the same mutation. Patient’s other brother presented with a hemangioblastoma at age 35 but died before diagnosis and genetic testing.

CohortInfo: 16 Chinese patients clinically diagnosed with VHL disease.

CasePresentingHPOs: HP:0009711, HP:0005584 (retinal capillary hemangioma, renal cell carcinoma)

CaseHPOFreeText: Patient presented with retinal hemangioma at age 25 and renal cell carcinoma at age 54.

CaseNotHPOs: HP:0002666, HP:0030393, HP:0010797, HP:0001732 (pheochromocytoma, endolymphatic sac tumor, hemangioblastoma, abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

GroupID: 27

Case: 45Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0006880; HP:0005584 (cerebellar hemangioblastoma; renal cell carcinoma)

CaseHPOFreeText: patient had cerebellar hemangioblastoma diagnosed at 25Y, and RCC diagnosed at 45Y

CaseNotHPOs: HP:0009711; HP:0002666 (retinal capillary hemangioma; pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.Q145* (c.433C>T) 

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625249 https://www.ncbi.nlm.nih.gov/clinvar/variation/625249/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q145* (c.433C>T) 

MultipleGeneVariants: N/A

PatientID: 136

KindredID: 51

Case: M, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 136) has a mother (patient 137) who presented with a CNS hemangioblastoma at 32, and renal cell carcinoma/ pheochromocytoma at 38. However, no DNA sample was available for his mother's genetic testing.

CasePresentingHPOs: HP:0010797, HP:0001737, HP:0001732, HP:0005584 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband (patient 136) presented with multiple pancreatic cysts/tumors at 21, renal cell carcinoma at 23, and a CNS hemangioblastoma at 25.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.P146Gfs*14 (c.435_436ins)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131810, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131810

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_2_frameshift_variant

CivicName: P146Gfs*14 (c.435_436insGG)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: RCC-23

KindredID: 1

Case: Sex and Age unknown, Italian

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0006770 (Clear cell renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 19

Case: F, 33Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive. The patient's son was the proband (1) and carried the mutation but was asymptomatic. The proband's uncle (7) carried the mutation and presented with symptoms. The proband's cousin (9) and first cousin once removed (22) were also found to have the mutation but were asymptomatic.

CohortInfo: 20 unrelated VHL families from an ethnically diverse cohort containing both affected and unaffected individuals.

CasePresentingHPOs:HP:0010797, HP:0005584, HP:0001732, HP:0000077 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, abnormality of the kidney)

CaseHPOFreeText: The patient presented with a hemangioblastoma at ages 17, 24, 30. At age 25 she presented with renal cell carcinoma and abnormalities of the kidney and pancreas.

CaseNotHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma )

CaseNotHPOFreeText: The patient did not have epididymal or ovarian cysts.

CasePreviousTesting: N/A

PreviouslyPublished: 31368132

SupplementalData: Supplementary file 1.

Variant: p.W88* (c.263G>A)

LegacyVariant: p.W88* (c.476G>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 182978 https://www.ncbi.nlm.nih.gov/clinvar/variation/182978/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: W88* (c.263G>A)

MultipleGeneVariants: N/A

PatientID: 1 (case)

KindredID: 1

Case: F, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Not significant - the paper states that the parents and siblings were negative for the mutation (indicating de novo).

CasePresentingHPOs: HP:0002666; HP:0009711; HP:0000479; HP:0012045 (pheochromocytoma, retinal capillary hemangioma, abnormal retinal morphology, retinal flecks)

CaseHPOFreeText: patient was referred for eye exam as part of a VHL screening program at 25Y. She has been diagnosed with bilateral pheochromocytoma at the age of 14 after an episode of acute hypertensive encephalopathy. Ophthalmoscopy disclosed in her right eye a small retinal hemangioma (1 disc diameter wide) along with feeder vessels in the mid-periphery and multiple, small, whitish, dome-shaped lesions scattered in the deeper layers of the posterior retina. Fluorescein and indocyanine green angiography confirmed the presence of the retinal hemangioma; multiple window-defects were also seen at the posterior pole and pericentral retina and hypofluorescent dots. (Unusual alterations of the deep retinal layers).

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T157I (c.470C>T)

LegacyVariant: p.T157I (c.683C>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 223223 https://www.ncbi.nlm.nih.gov/clinvar/variation/223223/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: T157I (c.470C>T)

MultipleGeneVariants: N/A

PatientID: II:7

KindredID: 1

Case: M, Age Unknown, Jewish

DiseaseAssertion: VHL

FamilyInfo: This kindred of Jewish-Kurdish origin consisted of 3 generations of 25 members. 7 were clinically affected subjects with pheochromocytoma (5 of which had the confirmed mutation - I:1, II:2, II:4, II:7 and II:9, as the other 2, II:5 and II:10 were said to have passed due to complications of the disease - prior to any genetic testing), and 4 others were carriers, or pre-symptomatic (III:1, III:3, III:7 and III:12). Subject 11:7 developed a cerebellar hemangioblastoma 25 yr after his initial diagnosis of pheochromocytoma, leading to the clinical diagnosis of VHL in the kindred.

CasePresentingHPOs: HP:0002666; HP:0006880; HP:0030074 (pheochromocytoma, cerebellar hemangiolastoma, chemodectoma)

CaseHPOFreeText: patient had cerebellar HB at 25Y, after his initial diagnosis with bilateral pheochromocytoma, and then also extra-adrenal chromafin tumors (carotid body chemodectoma).

CaseNotHPOs: HP:0005584 (renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 33471715

SupplementalData: N/A

Variant: p.V166F (c.496G>T)

LegacyVariant: p.V166F (c.709G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 2224, https://www.ncbi.nlm.nih.gov/clinvar/variation/2224/

CAID: N/A

VariantEvidence: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V166F (c.496G>T)

MultipleGeneVariants: N/A

PatientID: 83 (Cousin)

KindredID: 18

Case: F, 50Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the pancreas)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (25Y), retinal angioma (16Y) and pancreatic tumors or cysts (undefined) (22Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0002666 (Renal cell carcinoma, Abnormality of the kidney, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: c.712C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: A point mutation (c.712C>T) was found. Being that this variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 6B

DiseaseAssertion: assumed VHL

GroupSize: 9

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Chinese

GroupAgeRange: 33.8Y +/- 17.6Y

GroupInfo: Clinical characteristics of 258 patients from 80 unrelated Chinese families were reported in this study. Grouped by the 21 mutations found, 3 families with 13 members total were described. it is unclear how many distinct families are reported in group 6B. 9 individuals were described. Phenotypic information was given for this mutation.

GroupPresentingHPOs: HP:0010797; HP:0009711; HP:0005584; HP:0001737; HP:0009715 (hemangioblastoma, retinal capillary hemangioma, renal cell carcinoma, pancreatic cysts, papillary cystadenoma of the epididymis)

GroupHPOFreeText: 7 of the 9 members presented with CNS hemangioblastoma (mean age of 29.9Y), 2/9 had retinal angiomas at 25Y and 35Y, 1 had renal cell carcinoma (at 30Y), pancreatic cysts in 2 members (with an age of onset of 30 and 31Y), and 1 member with a genital system tumor (epididymis or broad ligament) at 24Y

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: No patients were given with pheochromocytoma

GroupPreviousTesting: N/A

PreviouslyPublished: 29330336; 28388566

SupplementalData: N/A

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220, https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 200

KindredID: 77

Case: F, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 200) has six family members who passed away before diagnosis/ had no DNA sample available. Of the family who passed away before diagnosis: the proband's aunt 1 (patient 202) had a CNS hemangioblastoma at 27; the daughter of aunt 1 (patient 203) had a pheochromocytoma at 31; aunt 2 (patient 205) had a CNS hemangioblastoma at 43, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 48. Of the family for whom no DNA sample was available: the proband's mother (patient 201) had a CNS hemangioblastoma at 51, multiple pancreatic cysts/tumors at 46, and a pheochromocytoma at 25; the grandson of aunt 1 (patient 204) had a pheochromocytoma at age 9; and the son of aunt 2 (patient 206) had a pheochromocytoma at 16 and renal cell carcinoma + multiple pancreatic cysts/tumors at 21.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a pheochromocytoma and renal cell carcinoma at 36.

CaseNotHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0002666; HP:0005584 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma, Renal cell carcinoma )

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218; https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954; https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 60

KindredID: 23

Case: M, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 23) had three family members genetically confirmed with the mutation: his son/ patient 61 (asymptomatic at time of assessment), his daughter/ patient 62 (asymptomatic at time of assessment), and his cousin/ the son of his Aunt 3/ patient 68 (CNS hemangioblastoma at 26). The proband also had 5 family members who passed away before they could be confirmed with the mutation: his father/patient 63 (CNS hemangioblastoma at 35, retinal angioma at 35); his sister/ patient 64 (CNS hemangioblastoma at 24 and multiple pancreatic cysts/tumors at 31); his aunt 1/ patient 65 had a CNS hemangioblastoma at 35; his aunt 2/ patient 66 had a CNS hemangioblastoma at 20; and his aunt 3/ patient 67 had a CNS hemangioblastoma at 44.

CasePresentingHPOs: HP:0001732; HP:0001737 HP:0010797; HP:0009711; HP:0005584 (Abnormality of the pancreas, Pancreatic cysts, Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma and retinal angioma at 25, renal cell carcinoma and multiple pancreatic cysts/tumors at 30.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220; https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 1

Case: F, 47Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: No family history.

CasePresentingHPOs: HP:0006880; HP:0002894; HP:0005584 (Cerebellar Hemangioblastoma; neoplasm of the pancreas; renal cell carcinoma)

CaseHPOFreeText: At 35-year old, the female patient was diagnosed with VHL due to clinical presentation of pancreatic serous cystic neoplasm and renal cell carcinoma, and cerebellar hemangioblastomas that were surgically removed at age 21. The patient had underwent total pancreatectomy and right nephrectomy for pancreatic serous cystic neoplasm (SCN) and renal cell carcinoma (RCC), respectively. 4 years later, tumors in the liver were detected by CT scan and radiographically diagnosed as metasta-ses of the pancreatic SCN or RCC. Again, morphology and immunohistochemical findings of the resected tumors again were similar to the primary pancreatic SCN, thus diagnosed as multiple metachronous liver metastases of pancreatic SCN. As of 47Y, the patient has remained disease-free without any recurrence after the third operation.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 21673464

SupplementalData: N/A

Variant: p.N78I (c.233A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223169 https://www.ncbi.nlm.nih.gov/clinvar/variation/223169/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: N78I (c.233A>T)

MultipleGeneVariants: N/A

PatientID: 10

KindredID: 2

Case: F, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Patient has 2 siblings (patients 11 and 12) with the same mutation and pheochromocytoma.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytomas (60mm and 40mm)

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: SDHB (NM_003000.2), SDHC (NM_003001.3), SDHD (NM_003002.2), SDHAF2 (NM_017841.2), RET (exons 10–11 and 13–16, NM_020975.4), TMEM127 (NM_017849.3), MAX (NM_002382.3).

PreviouslyPublished: N/A

SupplementalData: Table 2

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: SNParray analysis of tumour DNA did not show LOH at any locus.

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: VHL_2 (tumor ID)

KindredID: 2

Case: M, 25Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (Adrenal pheochromocytoma)

CaseHPOFreeText: The patient had a benign adrenal pheochromocytoma at 25Y.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2236, https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A