PatientID: IV-2

KindredID: 3

Case: M, Age Unknown, Chinese

DiseaseAssertion: asymptomatic

FamilyInfo: The transition mutation was found and confirmed in this patient, his great-aunt, and his first-cousin once removed. 5 additional members had hemangioblastomas of the CNS, but had all passed away before genetic testing. Could be assumed and deduced the genetics due to pedigree showing future linear relations of this mutation. His mother, two uncles, and grandfather are all individuals with hemangioblastomas who have passed away.

CasePresentingHPOs: N/A

CaseHPOFreeText: Stated as carrier, however he is young (likely before the age of onset)

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L116V (c.346C>G)

LegacyVariant: p.L116V (c.559C>G)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753642 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.346C%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L116V (c.346C>G)

MultipleGeneVariants: N/A

GroupID: 36

Case: Sex unknown, Age unknown, Dutch (The Netherlands)

DiseaseAssertion: VHL

FamilyInfo: Unknown. 1 registrant was found with this variant; no family info was mentioned

CasePresentingHPOs: HP:0030393 (Endolymphatic sac tumor)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 1 deletion

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: None (I)

KindredID: 7

Case: Sex and Ethnicity unknown; Age >18Y0M

DiseaseAssertion: assumed VHL

FamilyInfo: Total of 13 family members belonging to Family 7 (see Table 2; or follow KindredID 7)

CasePresentingHPOs: HP:0030424 (epididymal cyst)

CaseHPOFreeText: Originally thought to be asymptomatic pre-testing; found epididymal cyst at first screening

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G34Rfs*98 (c.99_100insA)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA2018007671 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2018007671

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_1_frameshift_variant

CivicName: G34Rfs (c.99_100insA)

MultipleGeneVariants: N/A

Molecular and clinical analysis of 126 French VHL families tested for renal involvement revealed 92 different mutations. 90 of these families had renal involvement. The p.F76* (c.227_228delinsAA) germline variant of the VHL gene was detected in a family (ID 512). Member 11876 presented with moderate renal disease (RCC) and member 13998 had unknown renal involvement. Variants c.227T>A and c.228C>A occurred in cis, resulting in an amino acid change of p.Phe76Ter.

KindredID: 11

DiseaseAssertion: VHL

GroupSize: Unknown

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This is a family belonging to prefigure No. 11. They are described as ‘VHL-affected’.

GroupPresentingHPOs: HP:0005584 (renal cell carcinoma)

GroupHPOFreeText: RCC-affected; other manifestations are possible but not clear.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T152Hfs*22 (c.452_453insA)

LegacyVariant: p.222fs (c.665insA)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131771 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131771

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_1_frameshift_variant

CivicName: T152fs (c.452_453insA)

MultipleGeneVariants: N/A

PatientID: 136

KindredID: 51

Case: M, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 136) has a mother (patient 137) who presented with a CNS hemangioblastoma at 32, and renal cell carcinoma/ pheochromocytoma at 38. However, no DNA sample was available for his mother's genetic testing.

CasePresentingHPOs: HP:0010797, HP:0001737, HP:0001732, HP:0005584 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband (patient 136) presented with multiple pancreatic cysts/tumors at 21, renal cell carcinoma at 23, and a CNS hemangioblastoma at 25.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.P146Gfs*14 (c.435_436ins)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131810, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131810

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_2_frameshift_variant

CivicName: P146Gfs*14 (c.435_436insGG)

MultipleGeneVariants: N/A

PatientID: 52

KindredID: 52

Case: F, 29Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: Family history negative for VHL.

CohortInfo: 26 Korean patients with more than one HAB in the CNS or eye, a single HAB in the CNS or retina plus a visceral manifestation (multiple renal, pancreatic or hepatic cysts, pheochromocytoma and RCC) and positive family history plus any one of the above manifestations.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: CNS hemangioblastomas. Other phenotypes presented but not specified (one or more of: pancreatic cyst or tumor, renal or hepatic cyst). Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666; HP:0009711; HP:0005584 (Pheochromocytoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 19270817

SupplementalData: N/A

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

GroupID: 20

DiseaseAssertion: VHL

GroupSize: N/A GroupNumberMales: 0 GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A

GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.

GroupPresentingHPOs: HP:0005584; HP:0009711; HP:0010797; HP:0009713 (Renal cell carcinoma, Retinal capillary hemangioma, Hemangioblastoma, Spinal hemangioblastoma)

GroupHPOFreeText: # of affected individuals: Renal cell carcinoma (1), Retinal capillary hemangioma (1), Hemangioblastoma/brain/cerebellum (4), Spinal hemangioblastoma (2)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplemental Table 2, Table 1, Table 3

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: None

KindredID: VHL24

Case: M, 22Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 190 patients recruited by the COMETE network over 15 years were included in the study.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient had one benign pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHB/SDHC/SDHD

PreviouslyPublished: N/A

SupplementalData: Table 1 of Supplementary

Variant: Complete Deletion (c.1-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had no LOH found in the BAC array CGH data. Somatic VHL variant c.250G>C was found in the tumor tissue.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 242

KindredID: 242

Case: Sex Unknown, 8Y0M, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: Indication of family history.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0009711, HP:0001737, HP:0002666, HP:0006770, HP:0000107, HP:0010797 (retinal capillary hemangioma, pancreatic cyst, pheochromocytoma, clear cell renal cell carcinoma, renal cyst, hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Table S1, S2, S3.

Variant: c.463+1G>A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 526679 https://www.ncbi.nlm.nih.gov/clinvar/variation/526679/

CAID: N/A

gnomAD: N/A

VariantEvidence: The variant was found to affect the B-domain and disrupt donor splice site intron 2 and lead to abnormal protein folding. The variant was predicted pathogenic.

MutationType: splice_site_variant

CivicName: c.463+1G>A

MultipleGeneVariants: N/A

PatientID: 38

KindredID: F01

Case: M, Age Unknown, Unknown Ethnicity

DiseaseAssertion: Asymptomatic

FamilyInfo: A total of 12 members of this family (F01) had a complete deletion of the VHL gene. Five of these patients (16, 18, 21, 33, 43) presented with clinical features of VHL. This family was previously published except for patients 43 and 48 which were newly diagnosed with VHL disease in the current study.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 17537157

SupplementalData: Figure 2.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of ~250.9kb resulted in deletion of the VHL gene.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 18

KindredID: F01

Case: M, Age Unknown, Unknown Ethnicity

DiseaseAssertion: VHL

FamilyInfo: A total of 12 members of this family (F01) had a complete deletion of the VHL gene. Five of these patients (16, 18, 21, 33, 43) presented with clinical features of VHL. This family was previously published except for patients 43 and 48 which were newly diagnosed with VHL disease in the current study.

CasePresentingHPOs: HP:0010797; HP:0001737 (Hemangioblastoma, Pancreatic cysts)

CaseHPOFreeText: CNS hemangioblastoma and pancreatic cyst.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 17537157

SupplementalData: Figure 2.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of ~250.9kb resulted in deletion of the VHL gene.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 37

KindredID: F01

Case: F, Age Unknown, Unknown Ethnicity

DiseaseAssertion: Asymptomatic

FamilyInfo: A total of 12 members of this family (F01) had a complete deletion of the VHL gene. Five of these patients (16, 18, 21, 33, 43) presented with clinical features of VHL. This family was previously published except for patients 43 and 48 which were newly diagnosed with VHL disease in the current study.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 17537157

SupplementalData: Figure 2.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of ~250.9kb resulted in deletion of the VHL gene.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 29

KindredID: 19

Case: F, 37Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: Relevant family history but details are not made available.

CohortInfo: This retrospective study was conducted at Department of Endocrinology of a tertiary care health centre in Western India. Patients presented to our institute between 2008 and 2016 were included in the study. During the study period a total of 33 patients were suspected to have VHL syndrome based on clinical features among whom 31 patients were found to have mutation in VHL gene. All patients are of Asian Indian descent.

CasePresentingHPOs: HP:0002666; HP:0009711; HP:0001737; HP:0030405 (Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts, Pancreatic endocrine tumor)

CaseHPOFreeText: Unilateral pheochromocytoma. Metastasis found at age 37. Cause of death: metastatic PNET.

CaseNotHPOs: HP:0010797; HP:0002668; HP:0005584 (Hemangioblastoma, Paraganglioma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 1 Deletion (c.1-?_340+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

A retrospective cohort study included all the VHL patients diagnosed at Peking University First Hospital (Beijing, China) prior to June 1 2016. A total of 291 patients from 115 different families were included for analysis. A female patient (patient #41) was confirmed for germline mutation in the VHL gene (c.239del; p.Ser80Ilefs*79). She was diagnosed with renal cell carcinoma at 44Y and multiple pancreatic cysts or tumours at 44Y. This cohort was also published in a paper by Wang et al., 2018 (PMID: 29330336).

PatientID: 47

KindredID: 15

Case: F, 22Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Proband (patient 42) has four family members confirmed with the mutation, and two family members who passed away before diagnosis/ genetic confirmation of the mutation. Family members confirmed with the mutation include: the proband's daughter (patient 43) who had retinal angioma (age 17), renal cell carcinoma (21), multiple pancreatic cysts/tumors (18), and a pheochromocytoma (19). His son (patient 44) who was asymptomatic at the time of assessment. His niece 1 (patient 47) who had a retinal angioma and renal cell carcinoma (22). And his niece 2 (patient 28) who had a CNS hemangioblastoma (19) and a retinal angioma (18). Family members who passed away before diagnosis and were not genetically confirmed include: his sister (oatient 45) who had a CNS hemangioblastoma (22), and his brother (patient 46) who had a retinal angioma and renal cell carcinoma at 52.

CasePresentingHPOs: HP:0005584; HP:0009711 (Renal cell carcinoma, Retinal capillary hemangioma)

CaseHPOFreeText: The proband's niece 1 (patient 47) had a retinal angioma and renal cell carcinoma at 22.

CaseNotHPOs: HP:0001737; HP:0001732; HP:0002666; HP:0010797 (Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.S80Tfs*77 (c.239_245del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA913189246; https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.239_245del

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: S80fs (c.239_245del)

MultipleGeneVariants: N/A

PatientID: 101

KindredID: 34

Case: F, 51Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 99) presented with a CNS hemangioblastoma, retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 40. Their mother (patient 100) presented with a CNS hemangioblastoma at age 50 and multiple pancreatic cysts/tumors at age 63, but passed away before diagnosis/ genetic testing. Their sister (patient 101) had the mutation and presented with a CNS hemangioblastoma and a retinal angioma at age 51. Their second sister (sister 2, patient 102) passed away before diagnosis/genetic testing but presented with a CNS hemangioblastoma at 40, renal cell carcinoma at 43 and multiple pancreatic cysts/tumors at 43. Their brother (patient 103), who also passed away before diagnosis/genetic testing, presented with a CNS hemangioblastoma and retinal angioma at age 47.

CasePresentingHPOs: HP:0010797, HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: The sister (patient 101) presented with a CNS hemangioblastoma and a retinal angioma at age 51.

CaseNotHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0002666 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in an earlier paper by Wang et al., 2014 (PMID 24581539) as well as a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98N (c.292T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351750883, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

A retrospective cohort study included all the VHL patients diagnosed at Peking University First Hospital (Beijing, China) prior to June 1 2016. A total of 291 patients from 115 different families were included for analysis. One proband was genetically confirmed with this germline mutation: an 18 year old male from kindred #88 who was diagnosed with CNS hemangioblastoma, retinal angioma, renal cell carcinoma, and multiple pancreatic cysts/tumors. This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

PatientID: 135

KindredID: 135

Case: Sex Unknown, 53Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive family history but no details provided.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001732; HP:0000107 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the pancreas, Renal cyst)

CaseHPOFreeText: CNS and retinal hemangioblastoma, pancreatic cyst or tumor and renal cystic lesion.

CaseNotHPOs: HP:0002666; HP:0006770 (Pheochromocytoma, Clear cell renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: Table S1, S2 and S3

Variant: Partial Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion

CivicName: Null (Partial deletion)

MultipleGeneVariants: N/A

PatientID: 396

KindredID: 396

Case: Sex Unknown, 29Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history is positive but no details are provided.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: CNS hemangioblastoma.

CaseNotHPOs: HP:0002666; HP:0006770; HP:0001732; HP:0000107; HP:0009711 (Pheochromocytoma, Clear cell renal cell carcinoma, Abnormality of the pancreas, Renal cyst, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: Table S1, S2 and S3

Variant: Exon 2 Deletion (c.341-?_463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant; deletion

CivicName: Exon 2 Deletion

MultipleGeneVariants: N/A

PatientID: 191

KindredID: 191

Case: Sex Unknown, 36Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history noted but details not specified.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0000107 (Hemangioblastoma, Retinal capillary hemangioma, Renal cyst)

CaseHPOFreeText: CNS hemangioblastoma, retinal hemangioblastoma and renal cystic lesion.

CaseNotHPOs: HP:0001732; HP:0002666; HP:0006770 (Abnormality of the pancreas, Pheochromocytoma, Clear cell renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Table S1, S2 and S3

Variant: p.L153P (c.458T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA16621942, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.458T%3EC

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: L153P (c.458T>C)

MultipleGeneVariants: N/A

In a study of 426 unrelated VHL patients, 111 were discovered to have alterations in the VHL gene. 18 novel variants were identified in VHL patients, but none were present in 200 unaffected control individuals. DNA samples from peripheral blood leukocytes underwent polymerase chain reaction (PCR) amplification, denaturing high-performance liquid chromatography (DHPLC), and direct sequence analysis of the entire coding sequence and intron-exon boundaries. The V66G (c.197T>G) germline mutation of the VHL gene was found in a 38 yr old VHL patient with CNS hemangioblastoma, pheochromocytoma, renal cystic lesion and pancreatic cyst or tumor (index case 379). Transmission of the variant could not be determined (n/d) since both parents and family history were not available.

PatientID: 51

KindredID: 51

Case: Sex Unknown, 61Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: CNS hemangioblastoma.

CaseNotHPOs: HP:0006770; HP:0002666; HP:0000107; HP:0001732; HP:0009711 (Clear cell renal cell carcinoma, Pheochromocytoma, Renal cyst, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: Table S1, S2 and S3

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reported as “CP” in supplementary table S1 but this was assumed to be a typo intended to be “CD” (i.e. complete deletion).

MutationType: deletion

CivicName: Null (Complete deletion)

MultipleGeneVariants: N/A

PatientID: 63

KindredID: 63

Case: Sex Unknown, 36Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive family history but no details provided.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0006770; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Clear cell renal cell carcinoma, Abnormality of the pancreas)

CaseHPOFreeText: CNS and retinal hemangioblastoma, pancreatic cyst or tumor and clear cell renal cell carcinoma.

CaseNotHPOs: HP:0002666; HP:0000107 (Pheochromocytoma, Renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: Table S1, S2 and S3

Variant: Partial Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion

CivicName: Nul (Partial deletion)

MultipleGeneVariants: N/A

PatientID: 280

KindredID: 280

Case: Sex Unknown, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0001732 (Hemangioblastoma, Abnormality of the pancreas)

CaseHPOFreeText: CNS hemangioblastoma and pancreatic cyst or tumor.

CaseNotHPOs: HP:0009711; HP:0006770; HP:0002666; HP:0000107 (Retinal capillary hemangioma, Clear cell renal cell carcinoma, Pheochromocytoma, Renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Table S1, S2 and S3

Variant: p.P76del (c.227_229del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA357012, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.227_229del

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion; inframe_deletion

CivicName: P76del (c.227_229del)

MultipleGeneVariants: N/A

In a study of 426 unrelated VHL patients, 111 were discovered to have alterations in the VHL gene. 18 novel variants were identified in VHL patients, but none were present in 200 unaffected control individuals. DNA samples from peripheral blood leukocytes underwent polymerase chain reaction (PCR) amplification, denaturing high-performance liquid chromatography (DHPLC), and direct sequence analysis of the entire coding sequence and intron-exon boundaries. The V170G (c.509T>G) germline missense mutation of the VHL gene was found in a 37 yr old VHL patient with retinal hemangioblastomas and pheochromocytoma (index case 53).

PatientID: 115

KindredID: 115

Case: Sex Unknown, 21Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Proband and father were found to carry the P138T (c.412C>A) germline mutation of the VHL gene. Father, siblings and cousins were analyzed but no phenotype information was provided for these family members. Genotype information for siblings and cousins was not provided.

CasePresentingHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0000107; HP:0006770; HP:0010797; HP:0001732 (Renal cyst, Clear cell renal cell carcinoma, Hemangioblastoma, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Table S1, S2 and S3

Variant: p.P138T (c.412C>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA16621932, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.412C%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: P138T (c.412C>A)

MultipleGeneVariants: N/A

PatientID: 114

KindredID: 114

Case: Sex Unknown, 27Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the pancreas)

CaseHPOFreeText: CNS hemangioblastoma, retinal hemangioblastoma and pancreatic cyst or tumor.

CaseNotHPOs: HP:0006770; HP:0002666; HP:0000107 (Clear cell renal cell carcinoma, Pheochromocytoma, Renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: Table S1, S2 and S3

Variant: Partial Deletion (12kb)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion

CivicName: Partial deletion of 12kb

MultipleGeneVariants: N/A

PatientID: 384

KindredID: 384

Case: Sex Unknown, 40Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history is positive but no details provided.

CasePresentingHPOs: HP:0001732; HP:0006770 (Abnormality of the pancreas, Clear cell renal cell carcinoma)

CaseHPOFreeText: Clear cell renal cell carcinoma and pancreatic cyst or tumor.

CaseNotHPOs: HP:0010797; HP:0002666; HP:0000107; HP:0009711 (Hemangioblastoma, Pheochromocytoma, Renal cyst, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: Table S1, S2 and S3

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion

CivicName: Null (Complete deletion)

MultipleGeneVariants: N/A

PatientID: 378

KindredID: 378

Case: Sex Unknown, 52Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history is positive but no details are provided.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: CNS hemangioblastoma.

CaseNotHPOs: HP:0002666; HP:0006770; HP:0001732; HP:0000107; HP:0009711 (Pheochromocytoma, Clear cell renal cell carcinoma, Abnormality of the pancreas, Renal cyst, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished:N/A

SupplementalData: Table S1, S2 and S3

Variant: Exon 1-2 Deletion (c.1-?_463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant; deletion

CivicName: Exon 1-2 Deletion

MultipleGeneVariants: N/A

GroupID: 3

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: 4 members of this family were found to harbor the c.468T>G germline variant of the VHL gene. Member 37 had no renal involvement. Member 38 presented with moderate renal disease (RCC). Members 47 and 3 presented with severe renal disease (RCC). Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

GroupPresentingHPOs: HP:0005584 (Renal cell carcinoma)

GroupHPOFreeText: Moderate renal disease (less than five solid lesions requiring surgical treatment, either unilateral or bilateral). Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma).

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: Paper states that this family is previously reported in PMID 12202531 and/or 9829912, where 3 and 1 individuals respectively with this mutation are reported. It is unclear if one or both of these previously reported groups are the same as the current family.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.Y156* (c.468T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756053, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.468T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion; stop_gained

CivicName: Y156* (c.468T>G)

MultipleGeneVariants: N/A

GroupID: 287

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: 2 members of this family are reported as carrying the c.197_220del24 germline variant of the VHL gene. Member 6396 presented with mild renal disease. Member 6611 presented with severe renal disease (RCC). Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

GroupPresentingHPOs: HP:0009726; HP:0005584 (Renal neoplasm, Renal cell carcinoma)

GroupHPOFreeText: Mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]). Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma).

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: Paper states that this family is previously reported in PMID 9829912, where 1 patient with this mutation is reported but relation to this patient is unclear.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.N67_V74del (c.197_221del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573130203, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573130203

gnomAD: N/A

VariantEvidence: Variant reported as c.197_220del and was mapped to c.198_221del.

MutationType: inframe_deletion; deletion

CivicName: N67_V74del (c.197_221del)

MultipleGeneVariants: N/A

Molecular and clinical analysis of 126 French VHL families tested for renal involvement revealed 92 different mutations. 90 of these families had renal involvement. The p.F76_C77del (c.226_231del) germline variant of the VHL gene was detected in an individual (ID 13773, Family 599). This patient presented with renal cell carcinoma. No family information is provided.

PatientID: 3194

KindredID: 229

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: Rearrangement

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: rearrangement_region

CivicName: Rearrangement

MultipleGeneVariants: N/A

Molecular and clinical analysis of 126 French VHL families tested for renal involvement revealed 92 different mutations. 90 of these families had renal involvement. The p.V165Lfs*5 (c.492del) germline variant of the VHL gene was detected in an individual (ID 9572, Family 405) who presented with mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]).

Molecular and clinical analysis of 126 French VHL families tested for renal involvement revealed 92 different mutations. 90 of these families had renal involvement. The p.F76del (c.226_228del) germline variant of the VHL gene was detected in a family (ID 44). Member 4975 presented with moderate renal disease (RCC), members 4978, 4977 and 4976 presented with mild renal disease and member 5283 had unknown renal involvement.

PatientID: 9581

KindredID: 401

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: Rearrangement

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: rearrangement_region

CivicName: Rearrangement

MultipleGeneVariants: N/A

PatientID: 9799

KindredID: 416

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Moderate renal disease (less than five solid lesions requiring surgical treatment, either unilateral or bilateral). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.S43_E47del (c.123_137del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA039321, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.123_137del

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion; deletion

CivicName: S43_E47del (c.123_137del)

MultipleGeneVariants: N/A

GroupID: 87

DiseaseAssertion: VHL

GroupSize: 3

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: 3 members of this family were found to harbor the c.466T>G germline variant of the VHL gene. Member 4587 presented with severe renal disease (RCC). Members 4588 and 5177 had unknown renal involvement. Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

GroupPresentingHPOs: HP:0005584 (Renal cell carcinoma)

GroupHPOFreeText: Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma).

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: Paper states that this family is previously reported in PMID 12202531 and/or 9829912, where 1 and 1 individuals respectively with this mutation are reported. It is unclear if one or both of these previously reported groups are the same as the current family.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.Y156D (c.466T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756043, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.466T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y156D (c.466T>G)

MultipleGeneVariants: N/A

PatientID: 2178

KindredID: 113

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: Moderate renal disease (less than five solid lesions requiring surgical treatment, either unilateral or bilateral). Individual RCC phenotype is noted as positive.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.V87A (c.260T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351750654, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.260T%3EC

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: V87A (c.260T>C)

MultipleGeneVariants: N/A

Screening of 92 unrelated patients with VHL disease revealed 61 DNA variants. No variants were found in 96 control cases. Direct sequencing on peripheral blood was systematically performed on exon 1 PCR products. Southern blotting was used to search for larger alterations to the gene. The V170G (c.509T>G) missense mutation was found in a VHL type 1 (no pheochromocytoma) patient (patient no. V81). No unaffected family members were tested. This family was stated as being previously published in PMID 15300849 (no phenotypes specified).

PatientID: V81

KindredID: V81

Case: Sex Unknown, Age Unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Likely 15300849

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756196, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.509T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

Screening of 92 unrelated patients with VHL disease revealed 61 DNA variants. No variants were found in 96 control cases. Direct sequencing on peripheral blood was systematically performed on exon 1 PCR products. Southern blotting was used to search for larger alterations to the gene. The L158dup (c.473_474insTTT) mutation was found in 4 related individuals with VHL type 1 (no pheochromocytoma). Patient/proband no. V43. This family was stated as being previously published in PMID 15300849. Three unaffected family members were negative for this mutation.

PatientID: V87

KindredID: V87

Case: Sex Unknown, Age Unknown, Sex Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: 92 unrelated patients with VHL disease.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: This family was classified as VHL type 2B meaning they had a pheochromocytoma and presence of renal and pancreatic manifestations.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y156D(c.466T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756043 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.466T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:Y156D(c.466T>G)

MultipleGeneVariants: N/A

Germline mutations were found in 20 Brazilian, VHL probands and their families. The L101R (c.302T>G) germline missense mutation was found in 2 affected family members with hemangioblastomas of the central nervous system (VHL family 5).

PatientID: 48

KindredID: N/A

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: The authors evaluated 64 VHL patients (32 women and 32 men) with renal involvement of whom 54/64 had undergone renal surgery or a radiofrequency thermal ablation procedure for RCC. In 10/64 VHL patients, at least one or more RCC were diagnosed, however at the time of diagnosis an indication for treatment was not yet present. For all patients several CT/MRI scans existed for retrospective description of tumour growth kinetics.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: This is a tumor resolution study (VHL patients were investigated based on the presence of renal tumors.) No other phenotypic information is available.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1 describes 19 patients with missense mutations, including this patient.

Variant: p.Q164L (c.491A>T)

LegacyVariant: c.704A>T

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756149

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Q164L (c.491A>T)

MultipleGeneVariants: N/A

PatientID: 25

KindredID: N/A

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: The authors evaluated 64 VHL patients (32 women and 32 men) with renal involvement of whom 54/64 had undergone renal surgery or a radiofrequency thermal ablation procedure for RCC. In 10/64 VHL patients, at least one or more RCC were diagnosed, however at the time of diagnosis an indication for treatment was not yet present. For all patients several CT/MRI scans existed for retrospective description of tumour growth kinetics.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: This is a tumor resolution study (VHL patients were investigated based on the presence of renal tumors.) No other phenotypic information is available.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1 describes 19 patients with missense mutations, including this patient.

Variant: p.V74G(c.221T>G)

LegacyVariant: c.434T>G

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA70042528

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V74G (c.221T>G)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 147

Case: Age, sex ethnicity unknown

DiseaseAssertion: unknown; paper focused only on pheochromocytoma

FamilyInfo: No specific family info was present; although this was recorded as a family germline mutation belonging to Family ID 147

CasePresentingHPOs: N/A

CaseHPOFreeText: Unknown

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: No presence of phaeochromocytoma in family

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D121Mfs*38 (c.361delG)

CaseProblemVariantFreeText: N/A

LegacyVariant: FS (c.574delG)

ClinVarID: N/A

CAID: CA432421803 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.361delG

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: D121Mfs*38 (c.361delG)

MultipleGeneVariants: N/A

PatientID: VHL-24

KindredID: 24

Case: Sex Unknown, Age Unknown, Italian

DiseaseAssertion: VHL

FamilyInfo: Family history of VHL. No further details provided.

CohortInfo: Forty-three index cases were referred to the Service of Medical Genetics, Genova, for germline mutation analysis in the VHL gene between 1995 and 2008.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0005584; HP:0000107; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma, Renal cyst, Abnormality of the pancreas)

CaseHPOFreeText: Multiple CNS hemangioblastomas, bilateral RCC. Clinical classification: A1.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Large Deletion (c.-678-?_340+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of 5’ UTR and exon 1 of VHL: c.-678-?_340+?del

MutationType: deletion; 5_prime_UTR_variant

CivicName: Null (c.-678-?_340+?del)

MultipleGeneVariants: N/A

PatientID: 28

KindredID: F01

Case: F, Age Unknown, Taiwanese

DiseaseAssertion: Asymptomatic

FamilyInfo: A total of 10 members of this family (F01) had a complete deletion of the VHL gene. Four of these patients (16, 18, 21, 33) presented with clinical features of VHL.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 19288063

SupplementalData: Figure 1

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of 142.9kb resulted in deletion of the VHL gene.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 5

KindredID: F03

Case: M, Age Unknown, Taiwanese

DiseaseAssertion: VHL

FamilyInfo: A total of 2 members of this family (F02) had a complete deletion of the VHL gene. One of these patients (3) presented with clinical features of VHL.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts)

CaseHPOFreeText: Brain hemangioblastoma, pancreatic cyst, renal cell carcinoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Figure 1

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Deletion of 3.3kb resulted in deletion of Exon 3 in the VHL gene.

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: Germline, FANCD2, deletion

PatientID: 3

KindredID: 3

Case: M, 15Y0M, Ethnicity Unknown

DiseaseAssertion: adrenal pheochromocytoma

FamilyInfo: None - The family history was negative for hypertension, PHEO or other neuroendocrine tumours. Their parents however, decided not to be tested neither to extend the test to other family members

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: Apparently sporadic pheo. He had a history of occipital headache, slightly elevated blood pressure with normal ophthalmological examination for 2 months was found to have a 4-cm-diameter left adrenal mass at MRI, being the abdominal sonography negative. He underwent surgery of the pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D197N (c.589G>A)

LegacyVariant: p.D197N (g.13,278)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756524 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.589G%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: D197N (c.589G>A)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 2

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: hemangioblastoma

FamilyInfo: N/A - Not specified

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: VHL syndromic HB (both germline and somatic variants were observed

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R120_121S (c.360_362delAGA)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131861 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131861

gnomAD: N/A

VariantEvidence: A VHL subject in our patient population had a full length deletion (FLD) in the germline VHL gene, but a VHL gene tumor second hit mutation (c.360_362delAGA) causing an amino acid change of p.R120-121S detected in the HB tumor

MutationType: delins

CivicName: Deletion AND R120_121S (c.360_362delAGA)

MultipleGeneVariants: Germline, VHL, complete deletion

A cohort of 314 patients with pheochromocytoma and functional paraganglioma had blood samples collected and all five major pheo-pgl susceptibility genes (RET, VHL, SDHB, SDHD, and SDHC) were screened for mutations. 25 patients had germline VHL mutations, 16 of which had a family history and 9 patients had an apparently sporadic presentation, 11 were male and 14 were female, the median age of diagnosis is 23.9 and range of diagnosis was 4-49. Out of the 25 patients 23 had adrenal tumours, 4 had para-adrenal tumours, and 9 had other VHL lesions (renal tumours and hemangioblastomas). 2 patients with postive family history and/or a syndromic presentation were found with pheochromocytoma or functional paraganglioma and a germline missense VHL mutation (c.290C>T). Other phenotypes unique to the patient are unknown. ACMG: PP4

PatientID: 1

KindredID: 1

Case: M, 46Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: known family history of VHL - His father, who had neoplasm and cyst in both kidneys, died of HB-CNS at 50 years old; and his sister was found to have neoplasm in both her pancreas and kidney. Explicit mutations or testing was not mentioned. In PMID: 24112165, these two members are confirmed with the mutation.

CasePresentingHPOs: HP:0006770; HP:0000107; HP:0001737; HP:0001407 (clear cell carcinoma; kidney cysts; pancreatic cysts; hepatic cysts)

CaseHPOFreeText: discovered to have signal abnormalities in his left kidney, liver and pancreas in a computed tomography (CT) evaluation - 2 tumors, one upper and one middle pole of the left kidney, as well as a cyst was found. At 43Y he was diagnosed with ccRCC in the right kidney via a hematuria and right-side lumbago.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 24112165

SupplementalData: N/A

Variant: p.L101R (c.302T>G)

LegacyVariant: L101R (c.515T>G)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751004 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.302T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L101R (c.302T>G)

MultipleGeneVariants: N/A

PatientID: 24 (Aunt)

KindredID: 18

Case: F, 80Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0002666; HP:0009711 (Hemangioblastoma, Pheochromocytoma, Retinal capillary hemangioma)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (36Y), pheochromocytoma (36Y) and retinal angioma (22Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0001732 (Renal cell carcinoma, Abnormality of the kidney, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: N/A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Authors state that the c.712C>T germline familial variant of the VHL gene in this patient is “inferred from the family”. No genetic testing was done on this patient to confirm this. Being that this familial variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: N/A

CivicName: N/A

MultipleGeneVariants: N/A

PatientID: 9 (Grandmother)

KindredID: 13

Case: F, 67Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 5 members of this family were found to harbour the deletion of one VHL allele. The proband (ID 1), sister (ID 2) and uncle (ID 5) were all asymptomatic. The father (ID 3) presented with CNS hemangioblastoma (34Y).

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (57Y).

CaseNotHPOs: HP:0002666; HP:0005584; HP:0009711; HP:0000077; HP:0001732 (Pheochromocytoma, Renal cell carcinoma, Retinal capillary hemangioma, Abnormality of the kidney, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Reported as “del one vHL allele”.

MutationType: deletion

CivicName: Null (del one VHL allele)

MultipleGeneVariants: N/A

PatientID: 88 (Second cousin)

KindredID: 18

Case: F, 52Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0002666 (Hemangioblastoma, Pheochromocytoma)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (18Y) and pheochromocytoma (17Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0001732; HP:0009711 (Renal cell carcinoma, Abnormality of the kidney, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: N/A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Authors state that the c.712C>T germline familial variant of the VHL gene in this patient is “inferred from the family”. No genetic testing was done on this patient to confirm this. Being that this familial variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: N/A

CivicName: N/A

MultipleGeneVariants: N/A

PatientID: 8 (Mother)

KindredID: 3

Case: F, 43Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 3 members of this family were genetically confirmed to be carriers of a germline partial deletion of exon 2 of the VHL gene. ID 2 presented with retinal angioma and pancreatic abnormality. ID 1 was asymptomatic. ID 16 presented with a retinal angioma (33Y), CNS hemangioblastoma at (32Y) and died at age 42. ID 16 was stated as having the germline variant but this was inferred from family/personal history and was not genetically confirmed.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with CNS hemangioblastoma (26Y and 40Y).

CaseNotHPOs: HP:0005584; HP:0001732; HP:0000077; HP:0002666; HP:0009711 (Renal cell carcinoma, Abnormality of the pancreas, Abnormality of the kidney, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: Exon 2 Partial Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion

CivicName: Null (Partial deletion of Exon 2)

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 4

Case: 29Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0030405; HP:0009711 (hemangioblastoma; renal cell carcinoma; pancreatic endocrine tumor; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2-3 deletion

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Stated in paper as “del ex 2.3”

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 22

KindredID: 22

Case: 33Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0009711 (hemangioblastoma; renal cell carcinoma; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2-3 deletion

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Stated in paper as “del ex 2.3”

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

GroupID/ KindredID: 2693NCI, 2956NCI, 20BMS, 2YO, 27BMS, 75CA, 48CA, 144CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken fromvarious families from multiple databases: including: the National Cancer Institute database, the Bristol Myers Squibb database,Department of Uroglogy, Yokohama database, and the Cambridge, Department of Pathology; with an unknown number of members belonging to each. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without phechromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as VHL families with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: 7728151; 9829911

SupplementalData: N/A

Variant: p.F76del (c.226_228delTTC)

LegacyVariant: p.delF76 (c.439delTTC)

CaseProblemVariantFreeText: NM_000551.3:c.226_228delTTC automaps to updated NM_000551.3:c.227_229delTCT

ClinVarID: N/A

CAID: CA357012 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.227_229delTCT

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.227_229delTCT)

MultipleGeneVariants: N/A

GroupID/ KindredID: 3669NCI

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the National Cancer Institute database, with an unknown number of members belonging to Family ID 3669NCI. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S111Afs*48 (c.331delA)

LegacyVariant: FS (c.544delA)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432420649 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.331delA

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: minus_1_frameshift_variant

CivicName: S111fs (c.331delA)

MultipleGeneVariants: N/A

GroupID/ KindredID: 53CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 53CA. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G104Hfs*27 (c.309_310delTG)

LegacyVariant: FS (c.522delTG)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA658795178 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.309_310delTG

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: minus_2_frameshift_variant

CivicName: G104fs (c.309_310del)

MultipleGeneVariants: N/A

GroupID/ KindredID: 23BMS

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Bristol Myers Squibb database, with an unknown number of members belonging to Family ID 23BMS. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L101R (c.302T>G)

LegacyVariant: p.L101R (c.515T>G)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751004 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.302T>G

gnomAD: N/A

VariantEvidence: N/A

MutationType: frameshift_variant; transversion

CivicName: L101R (c.302T>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: 4783NCI

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: Two germline familial VHL mutations were associated with this family. They were: c.382C>T and c.381G>T and this data was taken from the National Cancer Institute database. It is unclear how many members belonging to Family ID 4783NCI had both mutations. Table 4 lists all ID and mutations associated with individuals with pheochromocytoma.

GroupPresentingHPOs: HP:0002666 (pheochromocytoma)

GroupHPOFreeText: Described as a VHL family with pheochromocytoma. Other phenotypes are likely, including renal cell carcinoma, however not detailed here.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G127G (c.381G>T)

LegacyVariant: p.G127G (c.594G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432421824 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.381G>T

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion; synonymous_variant

CivicName: G127G (c.381G>T)

MultipleGeneVariants: Germline, VHL, c.382C>T (p.Leu128Phe)

PatientID: None

KindredID: 1

Case: F, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: Positive. Patient's mother did not undergo genetic testing but had a hemangioblastoma at age 50 and a pancreatic cyst or tumour at age 62. The patient's sister (the proband) also had this mutation and presented with hemangioblastoma (age 35), retinal angioma (age 37), pancreatic cysts or tumours (age 37), and renal cell carcinoma (age 39). Another one of the patient's sisters presented with hemangioblastoma (age 40), renal cell carcinoma (age 43), and pancreatic cysts or tumours (age 43). This patient died before diagnosis. The proband's brother also died before diagnosis and presented with hemangioblastoma and retinal angioma at age 27.

CasePresentingHPOs: None

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666, HP:0009715, HP:0010797, HP:0005584, HP:0001732, HP:000971(pheochromocytoma, Papillary cystadenoma of the epididymis, hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 16

Case: Sex Unknown, 31Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The patient's father had a hemangioblastoma of the central nervous system at age 45. He was deceased before diagnosis could occur. The patient's sister, daughter, and nephew were all confirmed to have the same genetic mutation but were asymptomatic.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas)

CaseHPOFreeText: The patient presented with hemangioblastoma at age 18. Later at age 31, he/she presented with renal cell carcinoma and pancreatic cysts or tumours.

CaseNotHPOs: HP:0009711, HP:0002666, HP:0009715 (retinal capillary hemangioma, pheochromocytoma)

CaseNotHPOFreeText: The patient did not have epididymal or ovarian cystadenoma.

CasePreviousTesting: N/A

PreviouslyPublished:29330336

Variant: Exon 1 deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: Sex Unknown, 39Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: Positive. Patient's mother did not undergo genetic testing but had a hemangioblastoma at age 50 and a pancreatic cyst or tumour at age 62. The patient's sister also had this mutation but was asymptomatic. Another one of the patient's sisters presented with hemangioblastoma (age 40), renal cell carcinoma (age 43), and pancreatic cysts or tumours (age 43). This patient died before diagnosis. The proband's brother also died before diagnosis and presented with hemangioblastoma and retinal angioma at age 27.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732, HP:0009711 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, retinal capillary hemangioma)

CaseHPOFreeText: The patient presented with hemangioblastoma at age 35. At age 37 she presented with retinal angioma and pancreatic cysts or tumours. At age 39 she presented with renal cell carcinoma.

CaseNotHPOs: HP:0002666, HP:0009715 (pheochromocytoma, Papillary cystadenoma of the epididymis)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: IV-6

KindredID: 1

Case: F, 38Y0M, Chinese

DiseaseAssertion: Glioblastoma

FamilyInfo: Eight affected individuals in the patient’s family were retrospectively identified by reviewing medical records and from the recall of relatives. Three had passed away before 40 years of age because of central nervous system hemangioblastoma. Among the 10 living family members that carried the same NM_000551.3:c.326_339dupTCCACAGCTACCGA the patient carried, 3 had renal cysts and 1 had developed renal cell carcinoma, 2 had central nervous system hemangioblastoma, 1 had retinal hemangioblastomas, 1 was diagnosed with glioblastoma, and 5 were asymptomatic.

CasePresentingHPOs: ORPHA:360 (Glioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0009711; HP:0010797; HP:0000107; HP:0005584 (Retinal hemangioblastoma, hemangioblastoma, renal cyst, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Gly114Serfs*50(c.326_339dupTCCACAGCTACCGA)

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA2573051018 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573051018

gnomAD: N/A

VariantEvidence: N/A

MutationType: duplication

CivicName: G114fs (c.326_339dupTCCACAGCTACCGA)

MultipleGeneVariants: N/A

PatientID: III-16

KindredID: 1

Case: F, 52Y0M, Chinese

DiseaseAssertion: Assumed VHL

FamilyInfo: Eight affected individuals in the patient’s family were retrospectively identified by reviewing medical records and from the recall of relatives. Three had passed away before 40 years of age because of central nervous system hemangioblastoma. Among the 10 living family members that carried the same NM_000551.3:c.326_339dupTCCACAGCTACCGA the patient carried, 3 had renal cysts and 1 had developed renal cell carcinoma, 2 had central nervous system hemangioblastoma, 1 had retinal hemangioblastomas, 1 was diagnosed with glioblastoma, and 5 were asymptomatic.

CasePresentingHPOs: HP:0000107; HP:0010797 (Renal cyst, CNS hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0009711; HP:0005584 (Retinal hemangioblastoma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Gly114Serfs*50(c.326_339dupTCCACAGCTACCGA)

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA2573051018 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573051018

gnomAD: N/A

VariantEvidence: N/A

MutationType: duplication

CivicName: G114fs (c.326_339dupTCCACAGCTACCGA)

MultipleGeneVariants: N/A

GroupID: 31

Case: Sex, Age, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: Unknown. One registrant from France has this mutation of c.500C>A

CasePresentingHPOs: HP:0030393 (Endolymphatic sac tumor)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y175* (c.525C>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351756231 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.525C%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Y175* (c.525C>A)

MultipleGeneVariants: N/A

GroupID: 4

Case: Sex unknown, Age unknown, German

DiseaseAssertion: VHL

FamilyInfo: Unknown. 1 registrant was found with this variant; no family info was mentioned

CasePresentingHPOs: HP:0030393 (Endolymphatic sac tumor)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R79_S80del (c.236_241delGCAGTC)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA645524744 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.236_241delGCAGTC

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: R79_S80del (c.236_241delGCAGTC)

MultipleGeneVariants: N/A

GroupID: 38

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Countries: France, Germany, Italy

GroupAgeRange: N/A

GroupInfo: 4 registrants from France, Germany, and Italy were grouped in this study via the deletion of exon 3

GroupPresentingHPOs: HP:0030393 (Endolymphatic sac tumor)

GroupHPOFreeText: N/A

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 3 Deletion

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 401

Case: Age unknown, Sex unknown, Ethnicity unknown

DiseaseAssertion: assumed VHL

FamilyInfo: Paper states: Germline, de novo (no clear confirmation)

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: multiple bilateral retinal capillary hemangiomas

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes (Specifically Supp. Table S2)

Variant: p.F148* (c.443_455delinsA)

LegacyVariant: N/A

CaseProblemVariantFreeText: stated as a p.F148fs (del/ins/FS), however stop_gained rather than frameshift is the protein result

ClinVarID: N/A

CAID: CA2573050544 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573050544

gnomAD: N/A

VariantEvidence: N/A

MutationType: delins

CivicName: F148* (c.443_455delinsA)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 330

Case: Age unknown, Sex unknown, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: Paper states familial VHL

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes (Specifically Supp. Table S2)

Variant: Exon 1 Deletion (c.1-?_340+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 2034

Case: Age unknown, Sex unknown, Ethnicity unknown

DiseaseAssertion: assumed VHL

FamilyInfo: Paper states familial VHL; germline mutation

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0005584 (hemangioblastoma; retinal capillary hemangioma; renal cell carcinoma)

CaseHPOFreeText: Patient had CNS HB, RA and a Grawitz tumor (RCC)

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 32179488

SupplementalData: Yes (Specifically Supp. Table S2)

Variant: p.F76del (c.227_229delTCT)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA357012 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.227_229delTCT

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.227_229delTCT)

MultipleGeneVariants: N/A

GroupID: 33

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

GroupPresentingHPOs: N/A

GroupHPOFreeText: These 2 patients with a c.388G>A mutation did NOT have retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.

GroupNotHPOs: HP:0009711 (retinal capillary hemangioma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V130I (c.388G>A)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753916 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.388G>A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: V130I (c.388G>A)

MultipleGeneVariants: N/A

GroupID: 7b

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: N/A

CaseHPOFreeText: This individual patient was 1/9 with an exon 3 deletion that did NOT have retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: Exon 3 deletion

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: exon 3 deletion

MultipleGeneVariants: N/A

PatientID: 23

KindredID: 23

Case: F, 45Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: None - apparently sporadic

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F76del (c.224_226delTCT)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA357012 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.224_226delTCT

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.224_226delTCT)

MultipleGeneVariants: N/A

All patients included in the study were VHL mutation carriers of 18 years or older examined between 1972 and 2012 in the VHL expertise centers University Medical Center Groningen (UMCG) and University Medical Center Utrecht (UMCU). Clinical data of 75 VHL mutation carriers were retrospectively retrieved from electronic and written patient record. Of these patients, one was found to harbour the c.89_297del germline mutation of the VHL gene. They presented with a retinal hemangioblastoma, cerebellar hemangioblastoma, spinal hemangioblastoma, renal cell carcinoma, pancreatic endocrine tumor, renal cyst and pancreatic cysts. Their age at the last follow-up was 70. They were previously published in PMID 24132471.

PatientID: N/A (brother of index case)

KindredID: 1

Case: M, 45Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: The patient's sister was the index case in this VHL family, as she was diagnosed with bilateral pheochromocytoma at age 23 and underwent bilateral adrenalectomy. Genetic screening revealed the VHL variant, which prompted screening of family members. DNA sequencing from blood of consenting family members confirmed the presence of the VHL variant in seven family members (three generations) (see figure 1 for familial pedigree). This included the sister (index case), two nephews, mother, and two daughters. The patient's two daughters both had the mutation. One of which was found to have pheochromocytoma at age 15 due to routine screening. The other 8 year old daughter has not had any manifestations. The patient’s nephew was asymptomatic until age 7, where an abdominal ultrasound revealed a left adrenal mass. A total adrenalectomy was performed and at age 1 another mouse was found in the right adrenal gland, which was also removed. 6 years later he was asymptomatic. The patient’s other nephew presented with an adrenal mass at 11Y0M, which required total adrenalectomy and remains well 2.5 years later. No phenotype was noted for the patient’s mother.

CasePresentingHPOs: HP:0006748;HP:0010797; HP:0005584 (adrenal pheochromocytoma; Hemangioblastoma; Renal cell carcinoma)

CaseHPOFreeText: Patient developed hemangioblastoma, multiple bilateral renal cell carcinomas, bilateral pheochromocytomas, and succumbed to his disease at age 45.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756196, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.509T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; tranversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

PatientID: 46

KindredID: 46

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1b.

Variant: p.Y156H (c.466T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756040

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y156H (c.466T>C)

MultipleGeneVariants: N/A

PatientID: 74

KindredID: 74

Case: Sex Unknown, 31Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Single benign PCC.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1a.

Variant: Complete Deletion (c.1-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Carbonic anhydrase 9 (CA9) mRNA level of 34.31 was detected. Membrane CA9 immunostaining was observed.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 47

KindredID: 47

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1b.

Variant: p.Y156S (c.467A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756049

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y156S (c.467A>C)

MultipleGeneVariants: N/A

PatientID: V5

KindredID: 3

Case: M, 47Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Sister presented with the same germline mutation and at least one cerebellar hemangioblastoma at the age of 29.

CasePresentingHPOs: HP:0006880(Cerebellar hemangioblastoma)

CaseHPOFreeText: Presented with at least two brainstem hemangioblastoma at the age of 35 and and 47.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.H110P (c.329A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751310, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351751310

gnomAD: N/A

VariantEvidence: The c.329A>C variant was not genetically confirmed to be germline but was found in samples from both tumors presented by this patient.

MutationType: missense_variant;transversion