238 Matching Annotations
  1. Last 7 days
    1. Case report: Disease phenotype associated with simultaneous biallelic mutations in ABCA4 and USH2A due to uniparental disomy of chromosome 1

      Case#: Patient 9, female, Mexican, symptoms onset 6 yrs. ago, Mexico City

      DiseaseAssertion: IRD

      FamilyInfo: parents are non-sanguineous and asymptomatic, they also denied any history related to ocular diseases. Information disclosed that the mother had one stillbirth and three miscarriages, but denied any related diseases/health issues to this child.

      CasePresentingHPOs: HP:00305, HP:00080, HP:0000493, HP:0025586, HP:0030329, HP:0012713

      CaseHPOFreeText: Proband presented with light sensitivity as well as adaptation difficulties when going from dark-to-light. Right eye was 20/200 and left eye was 20/160 from the visual acuity test. Macular bull's eye appearance. Subnormal rod and cone responses. Peripapillary sparing retina.

      CaseNotHPOs: HP:0007737, HP:0000750, HP:0000510

      CaseNotHPOFreeText: No afferent pupillary defect. No anomalies in anterior segment.

      Genotyping Method: QIAamp DNA Blood Kit was used to extract gDNA and quantification/purity of the sample was found using a NanoDrop 2000 spectrophotometer. 293 genes were sequenced. gDNA was sequenced via Illumina technology. Following, certain sequences were additionally analyzed against a reference genome in order to identify changes and interpret.

      PreviouslyPublished: n/a

      Variant: NM_000350.3(ABCA4):c.4926C>G (p.Ser1642Arg), NM_000350.3(ABCA4):c.5044_5058del (p.Val1682_Val1686del)

      ClinVar: 99332, 99340

      CAID: n/a

      SupplementalData: Phenotype data in results section as well as figures 1, 2, and 3 showing phenotypic testing results.

  2. Feb 2026
  3. Apr 2025
  4. Mar 2025
  5. Jan 2025
    1. Disease for patient 1: Von Willebrand Disease Type1, transmitter VWD-type 3

      Disease for patient 2: Von Willebrand Disease Type 3

      Patient1: 90 YO female (Afro-Caribbean)

      Patient2: 40 YO female (Afro-Caribbean)

      Notes multiple variants in the VWF gene but have focused on variants in the D4 domain. However cannot discount the impact of some other variants.

      Variant 1: VWF NM_000552.5: c.6647del p.(Cys2216Phefs*9), results in VWF protein missing D4 domain and C-terminal end of molecule

      Phenotype patient 1: Reduced VWF levels in VWF:Ag, VWF:ristocetin cofactor, FVIII:C, FVIII(VWF:FVIIIB). Bleeding score 0, required Helixate treatment before and after receiving surgery.

      Variant 2: VWF NM_000552.5: c.6432dup p.(Pro2145Thrfs*5)

      Three sequence variations in family study showed other variants highlighted p.(Cys1149Arg) and p.(Pro2145Thrfs*5) are not on the same allele.

      Does have other variants in VWF but they are stated by authors to not be detrimental. p.(Val510=) is noted to be potentially deleterious.

      Phenotype patient 2: severely reduced VWF levels, absence of multimers, bleeding score 32, epistaxis, bruising, oral cavity bleeding, prolonged bleeding from minor wounds, menorrhagia, hemarthrosis, ankle arthropathy.

      Suggests premature termination codons in these variants may lead to NMD but that this mechanism was found to be PTC position-dependent. Degradation was not 100% and need to perform cellular experiments.

    1. A shared car association, every shared car replaces 9 to 13 private cars for the same amount of travel freedom, point to point. You don't lose any freedom like you would in public transport. It's just like a neighborhood shares a dozen cars. 95% of the cars are in the garage at any time.

      for - example - efficacy of mutualisation - transportation - cars - SOURCE - Youtube Ma Earth channel interview - Devcon 2024 - Cosmo Local Commoning with Web 3 - Michel Bauwens - 2025, Jan 2 - stats - mutualisation - transportation - cars - 1 car can replace 13 - car is parked most of the time - 10% of existing cars doubles our requirement - SOURCE - Youtube Ma Earth channel interview - Devcon 2024 - Cosmo Local Commoning with Web 3 - Michel Bauwens - 2025, Jan 2

  6. Dec 2024
    1. it was so hard to get outside of the project of neoliberalism that we couldn't actually see what was possible in that Horizon three construct. So for us, we started to look at we need a just transition, plus an entire shift of ontology, ethical, epistemological, what we shorthand call auto shifts or ontological shifts

      for - definition - ontological shift - Post Capitalist Philanthropy Webinar 1 - Alnoor Ladha - Lynn Murphy - 2023 - adjacency - Deep Humanity - can provide new vocabulary and ideas to support - the horizon 3 - ontological shift - Post Capitalist Philanthropy Webinar 1 - Alnoor Ladha - Lynn Murphy - 2023

      adjacency - between - ontological shift to reach horizon 3 - Deep Humanity - adjacency relationship - Deep Humanity may offer a new language and vocabulary for this Horizon 3 shift ontology

    2. neoliberalism and its predecessors of industrial capitalism and even proto capitalism were based on separation from the natural world. And and we can we call it sort of separation or dualism

      for - key insight - neoliberalism and industrial capitalism were based on Descarte and our separation from the natural world - Post Capitalist Philanthropy Webinar 1 - Alnoor Ladha - Lynn Murphy - 2023 - adjacency - materialism, science and neoliberalism - will technology save us? - Post Capitalist Philanthropy Webinar 1 - Alnoor Ladha - Lynn Murphy - 2023 - to - The Three Great Separations

      key insight / summary - neoliberalism and industrial capitalism were based on Descarte and our separation from the natural world - Post Capitalist Philanthropy Webinar 1 - Alnoor Ladha - Lynn Murphy - 2023 - FIrst, Descarte separated the mind from the body. We have the paradox of: - godlike mind housed in - animalistic bodies - (incidentally, this sets us up for the exageration of the existential crisis of the denial of death in modernity - Ernest Becker) - Then we impose separation of external vs internal world - Then, we have separate categories of mind and nature, and we begin othering of: - women - other (indigenous) cultures - What Alnoor and Lynn forgot to mention was that there is another separation that preceded the industrial revolution, the separation of people into distinct classes of: - producer - consumer - Then with the advance of Newtonian physics and the wild success of materialist theory applied to create a plethora of industrial technologies, a wedding occurred between: - dualism and - materialism - Materialism decomposes everything into subatomic particles that a rational mind can understand - To those who think science and technology can save us from the crisis it helped create - the deeper understanding reveals that science and technology are themselves agents of separation.

      to - See the three great separations - https://hyp.is/go?url=https%3A%2F%2Finthesetimes.com%2Farticle%2Findustrial-agricultural-revolution-planet-earth-david-korten&group=world

  7. Jul 2024
  8. Mar 2024
    1. "Il résulte donc de ce qui précède, qu’en l’absence d’obstacle juridique, l’organe délibératif de l’EPLE est parfaitement libre d’adopter le principe d’une répartition de l’année scolaire en deux semestres, au lieu de trois trimestres. Une fois cette résolution arrêtée, il conviendra également de modifier en conséquence le règlement intérieur de l’établissement."

  9. Nov 2023
    1. the Americanization of the culture of Alberta and the importance of American capital for the 00:24:23 energy industry but there was a lot of migration from the United States from Nebraska and Montana um up north yeah a third of the people who settled 00:24:35 the Prairies between 1880 and 1913 and a third of the three million who came were American my mother born in the U.S yes a lot of 00:24:48 the established you know people who've been here a while uh on the Canadian prairies we look South and we literally see cousins
      • for: interesting fact - many Albertans are from America

      • interesting fact

        • 3 million people settled the Canadian Praries between 1880 and 1913
        • 30% of them were fromNebrask and Montana
  10. Jul 2023
  11. Jun 2023
  12. Mar 2023
  13. drive.google.com drive.google.com
    1. 1930s Wilson Memindex Co Index Card Organizer Pre Rolodex Ad Price List Brochure

      archived page: https://web.archive.org/web/20230310010450/https://www.ebay.com/itm/165910049390

      Includes price lists

      List of cards includes: - Dated tab cards for a year from any desired. - Blank tab cards for jottings arranged by subject. - These were sold in 1/2 or 1/3 cut formats - Pocket Alphabets for jottings arranged by letter. - Cash Account Cards [without tabs]. - Extra Record Cards for permanent memoranda. - Monthly Guides for quick reference to future dates. - Blank Guides for filing records by subject.. - Alphabet Guides for filing alphabetically.

      Memindex sales brochures recommended the 3 x 5" cards (which had apparently been standardized by 1930 compared to the 5 1/2" width from earlier versions around 1906) because they could be used with other 3 x 5" index card systems.

      In the 1930s Wilson Memindex Company sold more of their vest pocket sized 2 1/4 x 4 1/2" systems than 3 x 5" systems.

      Some of the difference between the vest sized and regular sized systems choice was based on the size of the particular user's handwriting. It was recommended that those with larger handwriting use the larger cards.

      By the 1930's at least the Memindex tag line "An Automatic Memory" was being used, which also gave an indication of the ubiquity of automatization of industrialized life.

      The Memindex has proved its success in more than one hundred kinds of business. Highly recommended by men in executive positions, merchants, manufacturers, managers, .... etc.

      Notice the gendering of users specifically as men here.

      Features: - Sunday cards were sold separately and by my reading were full length tabs rather than 1/6 tabs like the other six days of the week - Lids were custom fit to the bases and needed to be ordered together - The Memindex Jr. held 400 cards versus the larger 9 inch standard trays which had space for 800 cards and block (presumably a block to hold them up or at an angle when partially empty).

      The Memindex Jr., according to a price sheet in the 1930s, was used "extensively as an advertising gift".

      The Memindex system had cards available in bundles of 100 that were labeled with the heading "Things to Keep in Sight".

    1. 312 Oak Midget Tray WWeesCoverEquipped same as]No.324,price.55CTohold cards14x3.No.423.Equippedasabove,tohold65Ccards 24x4, priceNo. 533. Standard size.to hold card 3x5, equip-ped as above,price..........No. 7- Nickel ....PrepaidinU. S.onreceiptofpriceNo. 324OakMidgetTraytheCoverWeis75cNo. 644. To hold cards4x6,equipped$1.10(StyleNos.312,423.533and644)asabove......(Style No. 324,213.335and446.)Send for catalog showing many other time-saving office devices. Our goods are soldyour dealer does not carry our line we can supply you direct from the factory.To hold cards 24x4. lengthof tray2%in..equippedwithAtoZindexand100record cards 45cNo. 213. To hold cards 14x3in,, lenght of tray 24in..equipped asabove40cNo.335.Standardsize,tohold3x5 cards.equipped asabove50c80cNo. 446. To hold 4x6 cards,equipped asabove.Any of these trays sent pre-paid in U. S. on receipt ofpriceby stationers everywhere. IfNo. 6 Union St.The WeisManufacturing Co.,Monroe,Mich.,U. S.A.Please mention SYSTEM when writing to advertisers

      Notice the 1 1/4" x 3" cards, 2 1/4 x 4" cards in addition to the 3 x 5" and 4 x 6".

  14. Jul 2022
    1. so let's suppose let's suppose your listeners are with me and you know we kind of agree like okay yes transformation's necessary and uh again i want to emphasize i'm not talking about reform i'm not talking 00:58:59 about a softer better capitalism i'm not talking about you know improved voter registration or like any of those things i'm talking about de novo starting over from scratch what might be 00:59:13 best and if it turns out that the old systems were better than anything that humanity can come up with well then you know that's the answer but i can't imagine that's true because the old systems were never designed in any kind of 00:59:25 you know thoughtful science driven [Music] you know process to to to test to explore and to come up with fitness like what is the you know we don't even have a fitness for our current society 00:59:39 much less of fitness for societal designs i mean we have the gdp but that's a terrible terrible limited fitness metric 00:59:51 okay so suppose you're with me suppose we're we're on board we we want to do this de novo design thing where do we start what's the what's what where do we even get off the 01:00:03 ground on this and i suggest that the way to do it is through first address worldview from world view once we understand what the world view is 01:00:15 what a reasonable useful world view will be for this project then then purpose derives worldview begets purpose once you understand what it is you want 01:00:28 what you value what do you value once you understand what you value then you can say well i value a and therefore the purpose is to 01:00:39 have a manifest in society for example so once you have purpose then you can think about what metrics how would you measure whether are you so 01:00:53 here's a new design is it fit for purpose does it do does it fulfill its purpose you know that's the question and then metrics go with some kind of fitness evaluation 01:01:05 and then finally last of all of those would be the design okay we know what we know what we value we know what this thing is supposed to do we know what the purpose is we know that attractor is supposed to you know plow the ground or something we 01:01:18 know what this is supposed to do we know how to measure success and uh now finally then let's talk about design what are the what are the you know the specifics and mechanics and 01:01:31 how does that happen and the the series is really kind of laid out this way the first paper really talks about world view and purpose the second paper talks about the you know the more the mechanics of things 01:01:44 like viability how would you make this thing viable things like that and then the very last paper that's titled the subtitle design okay so uh that's how we uh and 01:01:56 and maybe i will just mention here that i put metrics before design because we might have some ideas uh getting back to that preference factor we might have some ideas like we would like people not to die at 01:02:08 30 you know we'd like people to mostly live to a ripe old age and have you know enough water water to drink and food to eat and all that kind of stuff so uh you know what kind of design once 01:02:20 now that we have metrics to measure that kind of stuff longevity and nutrition and things what kind of designs would help us to reach those targets you know so that's one reason why design 01:02:31 why metrics comes before design okay

      Process flow: Worldview, purpose, metric and finally design

      Paper 1: Worldview and purpose Paper 2: practical implementation Paper 3: Design

  15. Mar 2022
  16. ivanov-petrov.livejournal.com ivanov-petrov.livejournal.com
    1. Есть маргинальная теория, на стыке психологии и философии, активно эксплуатирующая принцип 3+1. Теория предлагает рассматривать каждый аспект человеческой жизни как адаптацию ...Когда удаётся сформулировать, что именно в природе человека не совпадает с природой окружающего мира, то почти на каждую формулировку приходится 1+3 стратегии адаптации (одна прямая и 3 косвенных)...Для человека довольно естественно полагать себя бессмертным (в том или ином смысле) или, как минимум, полагать что он должен быть связан с чем-то не подверженным разрушению. В то же время, наблюдаемый бренный мир постоянно и непрерывно движется к распаду. ...Можно кратко обозначить начальные условия адаптации: мы пытаемся ощутить свою бессмертную природу в умирающем бренном мире. Психологически, такого рода адаптация регулируется чувством ничтожности. ...Если чувство собственной ничтожности невыносимо, значит бренный мир хорошенько нам врезал, разрушив ту часть нас, которую мы считали незыблемой.По теории, должны быть 4 стратегии, как адаптировать знание/представление о своей бессмертной природе к наблюдаемому бренному миру. Прямая стратегия - ориентация на вечное. Попытаться связать свою жизнь с тем что выходит за пределы времени, найти в себе то что принадлежит вечности. Например, ощутить себя частью замысла творца, найти смысл жизни и т.п. Прямая стратегия - стратегия независимости, она почти всегда игнорирует природу наблюдаемого мира, т.е. в данном случае - время. Три оставшихся стратегии, по теории, должны быть вспомогательными и уж они ничего не игнорируют. Стратегия ориентации на прошлое борется с чувством ничтожности через поиск артефактов, прошедших проверку временем. Связь с семьёй, устойчивые черты характера, проверенные временем таланты, память о незабываемых событиях, написанные статьи. Пока всё это живо, жив и я и чуть менее ничтожен в мире, где время всё разрушает. Стратегия ориентации на настоящее борется с чувством ничтожности через поиск лучшего места в бренном мире. Тот кто прямо сейчас находится в лучшем для себя месте и в лучших условиях, ощущает себя менее ничтожным, чем все остальные. Стратегия ориентация на будущее борется с ничтожностью с помощью понимания логики времени, видения текущих процессов. Тот кто знает, где мир окажется завтра, более живуч и утонет последним.Получается красиво: 3+1 (прошлое/кто я?, настоящее/где я?, будущее/куда я иду?) и вечность/зачем я?
  17. Mar 2021
    1. Results for individual PALB2 variants were normalized relative to WT-PALB2 and the p.Tyr551ter (p.Y551X) truncating variant on a 1:5 scale with the fold change in GFP-positive cells for WT set at 5.0 and fold change GFP-positive cells for p.Y551X set at 1.0. The p.L24S (c.71T>C), p.L35P (c.104T>C), p.I944N (c.2831T>A), and p.L1070P (c.3209T>C) variants and all protein-truncating frame-shift and deletion variants tested were deficient in HDR activity, with normalized fold change <2.0 (approximately 40% activity) (Fig. 1a).

      AssayResult: 5

      AssayResultAssertion: Normal

      StandardErrorMean: 0.58

    1. Most Suspected Brugada Syndrome Variants Had (Partial) Loss of Function

      AssayResult: 28.5

      AssayResultAssertion: Abnormal

      ReplicateCount: 21

      StandardErrorMean: 7.6

      Comment: This variant had partial loss of function of peak current (10-50% of wildtype) and a >10mV loss of function shift in Vhalf activation, therefore it was considered abnormal (in vitro features consistent with Brugada Syndrome Type 1). (Personal communication: A. Glazer)

  18. Feb 2021
  19. Sep 2019
  20. Jul 2019
  21. Jun 2019
  22. May 2019
    1. The metagenomic DNA extracted from above defined protocol was digested with Sau3A1 at conditions optimized to generate maximum fragment in the size range of 2-6 kb. Different concentration (0.05 to 1 unit) of enzyme was used to optimize the digestion of 1 μg of DNA. Reactions were carried out in a final volume of 30 μl each in an Eppendorf of 1.5 mL. Reaction mixture (1 μg DNA having 3 μL NEB buffer 3 and 0.3 μL of 10X BSA) were kept at 37 °C for 10 min and stopped by heat inactivation at 80 °C for 20 min. Different digested reactions were checked for the desired fragments using 0.8 % (w/v) agarose gel electrophoresis. After optimization of DNA fragments for the appropriate size, a large scale digestion was carried out and the fragments (2-8 kb) were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany)
    2. The isolated DNA was diluted (1:100) with MQ. The concentration (mg mL-1) of the DNA [N] was determined spectrophotometrically by recording absorbance at 260 nm (A260) as: A260 = ε 260[N]where ε 260 is the extinction coefficient of DNA (50 for ds DNA) [N] = concentration (mg mL-1) of DNA The concentration of ds DNA [N] was calculated as [DNA] (mg mL-1) = A260/ε 260 [DNA] (μg mL-1) = A260 × 50 × dilution factor Purity of DNA was checked by measuring absorbance at 260 and 280 nm and calculating the A260/A280 ratio (Sambrook et al., 1989). A DNA sample was considered pure when A260/A280 ranged between 1.8-1.9. An A260/A280 < 1.7 indicated contamination of the DNA preparation with protein or aromatic substances such as phenol, while an A260/A230 < 2.0 indicated possible contamination of high molecular weight polyphenolic compounds like humic substances.
    3. Alternatively metagenomic DNA was extracted from the alkaline soil samples by using different commercial kits (UltraClean™, PowerSoil™ [Mo Bio Laboratories Inc., Carlsbad, CA, USA], Nucleospin kit [Macherey-Nagal, Germany] and Zymo soil DNA isolation kit [CA, USA]). The DNA was finally suspended in 100 μL of sterile Milli Q water for further analysis.
    4. Soil (1 gm) was suspended with 0.4 gm (w/w) polyactivated charcoal (Datta and Madamwar, 2006) and 20 μL proteinase K (10 mg mL-1) in 2 mL of modified extraction buffer [N,N,N,N cetyltrimethylammonium bromide (CTAB) 1% w/v, polyvinylpolypyrrolidone (PVPP) 2% w/v, 1.5 M NaCl, 100mM EDTA, 0.1 M TE buffer (pH 8.0), 0.1M sodium phosphate buffer (pH 8.0) and 100 μL RNaseA] [Zhou et al., 1996] in 20 mL centrifuge tubes to homogenize the sample and incubated at 37 °C for 15 min in an incubator shaker at 200 rpm. Subsequently, 200 μL of 10% SDS was added to the homogenate and kept at 60 °C for 2 h with intermittent shaking. DNA was precipitated by adding 0.5 V PEG 8000 (30 % in 1.6 M NaCl) and left at room temperature for an hour (Yeates et al., 1998). The precipitated DNA was collected by centrifugation at 8000 x g at 4 °C. The supernatant was discarded and pellet was dissolved in 1 mL of TE buffer (pH 8.0) and then100 μL of 5 M potassium acetate (pH 4.5) was added and incubated at 4 °C for 15 min. The supernatant was collected after centrifugation at 8000 x g and treated with equal volumes of phenol: chloroform (1:1) followed by chloroform: isoamylalcohol (24:1) at 8000 x g for 15 min
    1. secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.
    1. (gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.
    2. Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect
    3. All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
    1. (1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.
    2. solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H
    3. Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred
    4. incubated at 23°C in a cooling incubator (CI-12S; Remi). Fresh passaging was done weekly in a similar fashion. After about 15 passages, a fresh cryostock from liquid nitrogen was expanded and passaging done as mentioned before. Random samples from culture flasks free from any visible microbial contamination and full of all healthy, motile parasites under microscopic examinations formed the basis of selection of the culture suitable for further use. After culturing, used flasks, pipettes, glassware etc were decontaminated by immersing them in 5% formaldehyde solution and then discarded. All other routine standard cell culture practices were observed.
    5. For both routine as well as bulk culture of L.donovani 008 strain promastigotes, medium dMEM was used. This media was prepared by dissolving one sachet of powdered media dMEM (GIBCO BRl) in 800 ml of distilled water. To this was added 25 mM HEPES and other supplements (0.05 mM adenosine, 0.05 mM xanthine, 1 mg biotin, 0.04% tween 80, 5 mg hemin, 0.5% triethanolamine, 0.3% bovine serum albumin, 50 mg gentamycin sulfate). pH of the media was adjusted to 7.2 , volume made upto one litre and the media was sterilized using bell filter (0.22 Il, Sterivex GV; Millipore). The media was used within two months of preparation. To this media, as per requirement of routine culture, heat inactivated fetal bovine serum (HI-FBS) was added @ 10%. In the present study Leishmania donovani, 008 strain, promastigotes were used throughout obtained from Prof. K.P.Chang, Chicago Medical Centre, USA. These were initially isolated from patients native to central Bihar. Upon arrival these promastigotes were expanded in medium 199 and cell bank was raised where -107 viable parasites were taken in 1 ml of complete medium 199 containing 10% glycerol. These were stored in liquid nitrogen. The revival capacity of these frozen cells was checked after one week storage by snap thawing the contents of one vial at 37°C, inoculating 50 ml of dMEM media with the entire contents and incubation at 23°C for one week. A luxuriant growth with healthy viable parasites was observed under the microscope. Routinely, L.donovani promastigotes were cultured in T-125 culture flasks having 50 ml of dMEM media each supplemented with 10% FBS. Media was inoculated with 100 III of a previous culture containing _106 promastigotes. These flasks were
    6. mg, 0.03 mmol) in 95% aqueous pyridine (1 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 ml) and cold 1 M TEA hydrogen carbonate (2 x 5 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (1.5% CH30H in CH2Cb with 0.1 % Et3N); Rf = 0.54 in 20% CH30H in CH2CI2; 1 H NMR: 8 -0.01 (s, 6H, Me~iCMe3), 0.84 (s, 9H, Me2SiCMe3), 1.95-2.11 (m, 18H, OAc), 3.62 (m), 3.88 (m), 4.2 (m), 4.5 (m), 4.9 (m, 2H, H-2', 3'), 5.28 (m, 3H, H-1, 2, 3), 5.44 (m, 1 H, CH=CH2); 31 P NMR .8-2.68; ESMS (mlz) : 925.3 (M-Et3N-H)". Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phospha te triethylammonium salt (55). A solution of aqueous HF (48%) in CH3CN (5:95, 400 Ill) was added to compound 54 (10 mg, 0.009 mmol) at 0 aC. The solution was stirred at 0 aC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2. The organic layer was extracted with water and TEAS solution thoroughly, dried over Na2S04 and concentrated to give dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D-galactopyranosyl-a-D­mannopyranosyl phosphate triethylammonium salt; ESMS (m/z): 811.4 (M-EtsN-H)". A solution of oxalyl chloride (0.38 mg, 1.5 Ill, 0.003 mmol) in anhydrous CH2CI2 (50 Ill) was cooled to -78 aC and DMSO (0.47 mg, 1.7 Ill, 0.006 mmol) was added, followed by the addition of a solution of dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D­galactopyranosyl-a-D-mannopyranosyl phosphate (7 mg, 0.007 mmol) in CH2CI2 (100 Ill). The mixture was stirred for another 30 minutes and then triethylamine (10 Ill) was added. The solution was brought to rt, water was added and the mixture was extracted with CH2Cb. The organic layer was dried over Na2S04 to give the aldehyde 55. Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phosphate triethylammonium salt (56). The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 56.
    7. Dec-9-enyl-2,3,4-tri-O-acetYI-[6-0-(t-butYldimethYlsilyl)-4-~-D-galactopyranosyl] -a-D-mannopyranosyl phosphate tri ethylammonium salt (54). A mixture of H-phosphonate 6 (from scheme 1, 50 mg, 0.057 mmol) and dec-9-en-1-01 (30 Ill, 0.172 mmol) was dried by evaporation of pyridine (2 x 0.5 ml). The residue was dissolved in anhydrous pyridine (1 ml), pivaloyl chloride (22 Ill, 0.172 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (6
    8. was diluted with water and the aqueous layer was thoroughly extracted with ethyl acetate (15 ml x 2). The organic layer was dried over Na2S04, concentrated and dried to yield C4C] labelled stearyl alcohol 51. [14C]-Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4 ,6-tretra-O-acetyl-~-D-gal actopyrano syl)-a-D-mannopyranosyl phosphate triethylammonium salt (52). A mixture of H-phosphonate 47 (296 mg, 0.37 mmol) and [14C] stearyl alcohol (51,100 mg, 0.37 mmol) was dried by evaporation of pyridine (2 x 3 ml). The residue was dissolved in anhydrous pyridine (5 ml), adamantane carbonyl chloride (160 mg, 0.8 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (160 mg, 0.63 mmol) in 95% aqueous pyridine (5 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 10 ml) and cold 1 M TEA hydrogen carbonate (2 x 10 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 52. [14C]-Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosyI phosphate triethyl ammonium salt (53). To a solution of compound 4 (75 mg, 0.07 mmol) in anhydrous CH30H (12.5 ml) was added anhydrous sodium carbonate (80 mg, 0.75 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 53; R,= 0.55 in 10: 1 0:3 CH30H:CH2CI2:O.25% KC!.
    9. [14C]-Stearyl alcohol (51). Stearic acid (50,100 mg) in anhydrous THF (1 mL) was diluted with C4C] stearic acid (1.2 mL, 120 !lCi). To this was added THF-borane complex (4 mL). The mixture was refluxed at 90°C for 36 h. The contents were then poured onto CH3COOH:H20 (8 mL, 1:1), taken in a separating funnel. The mixture
    10. 5.2 (m, 3H, H-1, 4, 3), 5.28 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 7.95 (d, JHP=637 Hz, 1 H); 31 P NMR f> 0.129; ESMS (mlz) 699.27 (M-Et3N-H)" Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a­D-mannopyranosyl phosphate triethylammonium salt (48). A mixture of H-phosphonate 47 (25 mg, 0.031 mmol) and stearyl alcohol (11 mg, 0.04 mmol) was dried by evaporation of pyridine (2 x 0.5 mL). The residue was dissolved in anhydrous pyridine (1 mL), adamantane carbonyl chloride (16 mg, 0.08 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (16 mg, 0.063 mmol) in 95% aqueous pyridine (3 mL) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 mL) and cold 1 M TEA hydrogen carbonate (2 x 5 mL), dried over Na2S04 and concentrated .The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 48; Rt = 0.46 in 20% CH30H in CH2CI2; 1H NMR: 8 0.84 (t, 3H, CH3), 1.23-1.45 (lipid protons), 1.85-2.12 (m, 21 H, OAc), 3.84-4.16 (m), 4.51 (d, J = 7.8 Hz, 1H, H-1'), 4.85-5.01 (m, 2H, H-2', 3'), 5.25 (m, 3H, H-1, 4, 3), 5.52 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.69 (dd, 1 H, JHP = 6.8 and J1,2 =1.9 Hz, H-1); 13C NMR: 8 13.99, 20.48-20.77, 22.56, 27.8-29.59, 31.80, 36.44, 38.78, 52.82, 60.69, 68.99, 69.48, 70.23, 70.91, 76.52, 93.26, 100.93, 168.99-170.42; 31p NMR: 8 -2.90; ESMS (mlz): 967 (M-Et3N-H)' Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosylphosphate triethylammo nium salt (49). To a solution of compound 48 (15 mg, 0.014 mmol) in anhydrous CH30H (2.5 mL) was added anhydrous sodium carbonate (16 mg, 0.15 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 49 in quantitative yield; Rt= 0.55 in 10:10:3 CH30H:CH2CI2:O.25% KCI; 31p NMR.8 -1.72; ESMS (mlz): 673 (M-Et3N-H)'
    11. 1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D­mannopyranose (46). Acetic anhydride (4 ml) was added dropwise to a stirring solution of Gal (1-4)~ Man (45, 700 mg, 2.04 mmol) in anhydrous pyridine (6 ml) at 0 °C. The reaction mixture was gradually brought to room temperature and stirred for 16 h. After completion of the reaction, the mixture was poured over ice and the product crystallized out to afford 46 in quantitative yield. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4,6-tetra-O-acetyl-~-D-galacto pyranosyl]-a.-D-mannopyranosyl hydrogen phosphonate (47). Compound 46 (600 mg, 0.89 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (40 mL) at -20°C and stirred for 3 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to provide 2,3,6-tri-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D-mannopyra nose. To a stirred solution of imidazole (1 g, 14.68 mmol) in anhydrous CH3CN (20 mL) at 0 °C was added phosphorus trichloride (0.8 ml, 9.14 mmol) and triethylamine (2.4 mL, 0.86 mmol). The mixture was stirred for 20 min, after which a solution of the above anomeric deprotected compound (500 mg, 0.786 mmol) in anhydrous CH3CN (20 mL) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M triethylammonium (TEA) hydrogen carbonate solution (pH=7.2, 10 mL). The clear solution was stirred for 15 min. CH2CI2 was added and the organic layer was washed with ice cold water (2 x 10 ml) and cold 1 M TEA hydrogen carbonate solution (2 x 10 ml), dried over Na2S04 and concentrated to yield 47 (500 mg, 86.2%); Rt = 0.35 in 20% CH30H in CH2CI2; 1H NMR: 8 1.9-2.08 (m, 21 H, 7 x OAc), 3.84-4.13 (m, 6H, H-5, 5', 6, 6'), 4.35 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1 '), 4.9 (dd, J =3.3 and 7.8 Hz, 1 H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'),
    12. Polycondensation. Compound 26 (25 mg, 0.033 mmol) was dried by evaporation of pyridine (500 III x 3) therefrom. The residue was dissolved in 10:1 pyridine:triethylamine (40 Ill), and pivaloyl chloride (9 Ill, 0.073 mmol) was added. Another lot of pivaloyl chloride (6 Ill, 0.04B mmol) was added in 45 min. After 3 h, the mixture became viscous, and a freshly prepared solution of iodine (220 Ill, 35 mg, 0.137 mmol in pyridine-water, 95:5) was added. After 2 h, CHCI3 was added and the organic layer was successively washed with cold 1 M aqueous Na2S203 solution and 1 Mice-cold TEAB buffer, dried over Na2S04 and concentrated to dryness to afford 27. For final deprotection, above residue was dissolved in 0.1 M NaOMe solution in CH30H (440 Ill), 1,4-dioxane (BOO Ill), and CHCI3 (BOO Ill). The mixture was stirred at rt for 7 h and left at 4 °C for 16 h, then diluted with CH30H, deionized with Dowex 50W-X4 (H+) resin, filtered and immediately neutralized with drops of triethylamine. The mixture was concentrated to dryness to afford fully deprotected phosphoglycans (28). 31 P (D~O): 8 -1.73, O.BB. Preliminary CD analysis of Phosphoglycans. The above polycondensation product (28) was lyophilized repeatedly and then redissolved in H20 (400 Jll). This solution was taken in a glass cuvette (300 Ill, 1 mm pathlength). It's CD spectra was recorded on a spectropolarimeter (JASCO, J-710) between 175-250 nm at 25°C. For reference, the CD spectra of agarose (15% W/V)87 was also recorded under the same conditions as mentioned above.
    13. Triethylammonium 2,3,6-tri-o.acetyl-4-o.(2,3,4-tri-o.acetyl-~-D-galactopyrana syl)-a-D-manno pyranosyl hydrogen phosphonate (26). Compound 6 (30 mg, 0.034 mmol) was dissolved in a mixture of acetic acid-water-THF (3:1:1,2.5 ml). The mixture was stirred at 40°C for 9 h, after which the solvent was evaporated off under vacuo at rt. To remove excess of acid, water (1 ml) was added and evaporated off twice to afford 26 in quantitative yield; 1H NMR (CDCI3, 300 MHz) 0 1.95-2.09 (m, 21 H), 3.49-3.68 (m, 4H), 3.88 (m, 1 H), 4.14 (m, 1 H), 4.36 (d, J = 4.5 Hz, 1 H), 4.47 (d, J = 7.8 Hz, 1 H), 4.95 (dd, J = 3_3 and 7_8 Hz, 1 H), 5.05 (dd, J = 2_1 and 7.8 Hz, 1 H), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H), 5.41 (d, J = 3.3 Hz, 1 H), 5.48 (dd, J = 2.1 and 7.8 Hz, 1 H), 7.99 ( d, JH,p = 637_0 Hz, 1 H); 13C NMR (CDCI3, 75 MHz) 0 20.48-20.76, 60.10, 62.42, 66.57, 69.36, 69.53, 69.69, 71.20, 73.30, 73.86, 91.59, 92.54, 101_09, 169.13-170.49; 31p (CDCI3): 00.22; ESMS mlz657.3 (M-EhN-Hr.
    1. To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
    2. To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
    1. smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results
    2. fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH
    3. GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur
    4. Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).
    1. Lysis Buffer: 0.1% Triton X-100/0.1 M Tris-HCl (pH 8.0). 450 ml distilled water 50 ml 1M Tris-HCl (pH 8.0) 0.5 ml Triton X-100 detergent • 100X Mg++ solution: 0.1 M magnesium chloride 4.5 M 2-mercaptoethanol Stored at 4°C. • 0.1 M sodium phosphate (pH 7.5)41 ml 0.2 M Na2HPO4 9 ml 0.2 M Na H2PO4 50 ml distilled water • 4 mg/ml ONPG (o-nitrophenyl-β-D-galactopyranoside) in 0.1 M sodium phosphate (pH 7.5) containing 2 mM β-mercaptoethanol, Stored at –20°C. • 0.1 mg/ml β-gal standard: 0.1 mg/ml β-gal in 0.1 M sodium phosphate (pH 7.5) containing 2 mM 2-mercaptoethanol Stored at 4°C. • 1 M sodium carbonate in water
    2. stored. To prepare competent cells pre-inoculum was prepared. A single bacterial colony was picked from LB agar plate, inoculated into 3 ml LB medium, and incubated overnight at 37°C temperature with shaking at 200 rpm. 1% of this pre-inoculums was sub cultured in 100 ml LB-broth and incubated at 18°C with shaking until OD at 600nm reached 0.5 - 0.6 (approx.). Culture was kept on ice for 10 min. with constant shaking.Cells were pelleted by centrifugation at 2000 g at 4°C for 8 min. Pellet was resuspended in 40 ml of ice-cold TB buffer. Bacterial suspension was kept on ice for 30 min, re-spun at 2000 g at 4°C for 8 min. Pellet was resuspended in 8 ml of TB buffer in which final concentration of DMSO was 7% and left on ice for 10 min. 100 μl aliquots were made and snap frozen in liquid nitrogen and stored at -80°C
    3. All the salts (10 mM PIPES, 15 mM CaCl2.2H2O, 250 mM KCl, 55 mM MnCl2.2H2O) except MnCl2 were dissolved in milliQ water and pH was adjusted to 6.7 with 1N KOH. MnCl2 was dissolved separately in mill Q water. MnCl2 was added drop wise while stirring (MnCl2 if added directly will give a brown color to the solution and precipitate out, hence it needs to be dissolved separately). Solution was then filter sterilized and
    1. genome cloned in a ColEI-based replicon, and obtained from Dr. Manjula Reddy. pHYD2556 is spectinomycin resistant and carries the minimal nusA+ open-reading frame with its native ribosome-binding site between genomic nucleotide co-ordinates 3314061and 3315548 cloned downstream of the ara regulatory region in a pSC101-based replicon, and obtained from Dr. Ranjan Sen. pHYD2557 is chloramphenicol resistant and carries a 2.3-kb PCR-amplified region between genomic nucleotide co-ordinates 3314061 and 3316393 (containing yhbC nusA region with its own promoter) cloned in a pSC101-based Ts replicon, and obtained from Dr. Ranjan.Plasmid DNA preparations were routinely prepared from recA strains such as DH5αand were stored in 10mM Tris-Cl (pH 8.0) plus 1mM EDTA at ─20 ̊C
    2. pWSK30 an Ampicillin resistant vector with pSC101 origin of replication and blue-white screening facility (Wang and Kushner, 1991). pHYD272 is a derivative of pMU575, an IncW-based single copy vector with Trimethoprim resistance marker carrying lacZYA reporter genes under proU promoter (Dattananda et al., 1991). pHYD751 a ColE1 replicon plasmid with ampicillin resistance marker and 2.1kb EcoRI-SalI fragment carrying nusG+cloned into EcoRI-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD763 is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying 3.8 kb BamHI-SacI fragment of nusG+ cloned into BamHI-SacI sites of pMAK705 (Harinarayanan and Gowrishankar, 2003). pHYD1201 a ColE1 replicon plasmid with ampicillin resistance marker and 3.3kb HindIII-SalI fragment carrying rho+cloned into HindIII-SalI sites of pAM34 vector. The plasmid exhibits IPTG dependent replication (Harinarayanan and Gowrishankar, 2003). pHYD1622 is the derivative of pHYD1201 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD1623 is the derivative of pHYD751 where the Ampicillin resistance marker has been replaced with Chloramphenicol using Wanner method of gene replacement. Cm gene was amplified from pKD3 plasmid (K. Anupama, unpublished). pHYD2368 is a derivative of pBAD18 (AmpR) with 1.7 kb fragment encompassing RBS and coding region of uvsW from phage T4gt7 into SacI site of pBAD18 (K. Leela, unpublished). pHYD2554 is a derivative of pMBL18 with ampicillin resistance, carrying the 10-kb EcoRI-HindIII fragment between kilobase co-ordinates 3310.06 and 3320.08 of the E. coli
    3. to CCT mutation leading to a Glutamic acid to Glycine change at the 53rd amino acid and a Threonine to Proline change at the 55th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-I119T is a derivative of pLG-H-NS plasmid with ATC to ACC mutation leading to a Isoleucine to Threonine change at the 119th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-P116S is a derivative of pLG-H-NS plasmid with CCA to TCA mutation leading to a Proline to Serine change at the 116th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-Y97C is a derivative of pLG-H-NS plasmid with TAT to TGT mutation leading to a Tyrosine to Cysteine change at the 97th amino acid in the H-NS protein (Willams et al., 1996). pPMrhoCam is a Ts (maintained at 30 ̊C but not at 37 ̊ or 39 ̊C), CmR, pSC101 derivative carrying PuvII-HindIII fragment containing trxArho+ cloned into PuvII-HindIII sites of pPM103 (Martinez et al., 1996). pTrc99A an expression vector with ColE1 origin of replication and ampicillin resistance marker. Provides IPTG dependent induction of the insert (Amann et al., 1988). pUC19 is a high-copy-number ColE1 based E.coli cloning vector (500-700 copies/cell) with an Ampr selectable marker. It is one of a series of related plasmids constructed by Messing and co-workers and contains portions of pBR322 and M13mp19 (Yanisch-Perron et al., 1985). It carries a multiple-cloning site (MCS) region in the lacZα fragment, and therefore allows for blue-white screening of recombinant clones
    4. pAM34 is a pBR322-derived cloning vector with Ampr and Specr selectable markers. The replication of this plasmid is dependent on the presence of IPTG, the gratuitous inducer of the lac operon (Gil and Bouche, 1991). pBAD18 is an expression vector with a pBR322 derived origin of replication and allows for tightly regulated expression of the genes cloned under the PBAD promoter of the araBADoperon (Guzman et al., 1995). The vector also carries the araC gene, encoding the positive and negative regulator of this promoter. pBluescript II KS (pBKS) is also a high-copy-number ColE1 based cloning vector with Ampr selectable marker and blue-white screening facility (obtained from Stratagene). pCL1920 is a low-copy-number vector with pSC101 replicon (~ 5 copies/cell), that carries streptomycin (Str)/spectinomycin (Spec)-resistance marker (encoded by aadA) and also carries a MCS region within the lacZα that allows blue-white screening to detect recombinants (Lerner and Inouye, 1990). pCP20 pSC101-based Ts replicon, CmR AmpR, for in vivo expression of Flp recombinase (Datsenko and Wanner, 2000). pLG339 is a low-copy-number cloning vector with pSC101 replicon that has a Kanrselectable marker (Stoker et al., 1982). pLG-H-NS is a pLG339 derivative where the hns ORF had been cloned into the EcoRI-SalIsites of pLG339 vector (KanR, pSC101) (Willams et al., 1996). pLG-H-NSΔ64 is a derivative of pLG-H-NS plasmid with AT base pair deletion after codon 63 in the hns gene resulting in a frameshift (Willams et al., 1996). pLG-H-NS-L26P is a derivative of pLG-H-NS plasmid with CTG to CCG mutation leading to a Leucine to Proline change at the 26th amino acid in the H-NS protein (Willams et al., 1996). pLG-H-NS-E53G/T55P is a derivative of pLG-H-NS plasmid with GAG to GGG and ACT
    5. pACYC184 is a medium-copy-number cloning vector (~ 20 copies/cell) with Cmr and Tetrselectable markers. It carries the origin of replication from plasmid p15A (Chang and Cohen, 1978), which is related to and yet is compatible with that of ColE1. This property enables pACYC184 to co-exist in cells with ColE1 plasmid vectors, including all the ones mentioned above
    1. argP+, argPd-S94L, argPd-P108S, argPd-P274Sfragment downstream of the phage T7-promoter, such that the encoded proteins beara C-terminal His6-tag provided by the vector DNA sequence. Theresultant plasmid was transformed into strain BL21(DE3) which has the T7 RNA Polymerase under the isopropyl thio-β-D-galactoside (IPTG) inducible lacUV5promoter.The resultant strains were grownin LB (500-1000 ml) to an A600of around 0.6and were then induced with 1 mM IPTG and harvested after 4-hrs of induction.Bacterial cells were recovered by centrifugation, resuspended in 20 ml of lysis buffer(20 mM Tris-Cl, pH-8; 300 mM NaCl; 10 mM DTT and 10 mM imidazole) containing20 μg/ml lysozyme, and lysed by sonication with 30-sec pulses for 10-min. Theprotocol for His6-ArgP(ArgPds)protein purification involved (i) passing the lysate through a 5ml Ni-NTA (Qiagen) chromatographic columnequilibrated with lysis buffer, (ii) washing thecolumn with 100 ml of washing buffer (20 mM Tris-Cl, pH-8; 300 mM NaCl; 10 mMDTT; 30 mM imidazole), and (iii) elution of His6-ArgP(ArgPds)from the column with elutionbuffer (20 mM Tris-Cl, pH-8;300 mM NaCl; 10 mM DTT and 250 mM imidazole) andcollection of 1.5 ml eluate fractions (10 fractions). The fractions were tested forprotein by Bradford method and the protein-carrying fractions (generally tubes 2 to 5)were pooled and dialysed in a 1:200 volume ratio against 20 mM Tris-Cl, pH-8 with 10mM DTT, 300 mMNaCl for 5 hrs followedby a change to buffer of composition 20 mM Tris-Cl, pH-8 with 10 mM DTT, 300 mM NaCl and 40% glycerol for 24 hrs. The proteins were concentrated by centrifugation toaround 1 mg/ml by using Amicon filter (pore size 10-KDa) and stored at −20ºC or −70ºC
    2. For preparing ArgP and ArgPd-S94L, -P108S and -P274S proteins, derivatives(designated as pHYD1705, pHYD2678, pHYD2679 and pHYD2680 respectively) of the plasmidvector pET21b (Novagen) was constructed which carries the PCR-amplified
    3. CAN is a toxic analog of Arg and is an inhibitor of bacterial growth. Strains were tested for sensitivity/resistance to CAN by streaking them on minimal A-glucose platessupplemented withoutand with40 μg/ml CAN(or other concentrations as indicated) and 40 μg/ml uracil
    4. Competent cells for high efficiency transformations were prepared by a method ofInoue et al. (1990) with few modifications. An overnight culture of the strain (routinelyDH5α) was sub-cultured into fresh sterile LB-brothin 1:100 dilutions and grown at 18ºC to an A600of 0.55. The cells were harvested by centrifugation at 2500 rpm for 10-min at 4ºC. This was re-suspended in 0.4 volumes of INOUE buffer and incubated inice for 10 min. The cells were recovered by centrifugation at 2500 rpm at 4ºC for 10-min and finally re-suspended in 0.01 volume of the same buffer. Sterile DMSO wasadded to a final concentration of 7%. After incubating for 10-min in ice, the cells werealiquoted in 100 μl volumes, snap frozen in liquid nitrogen and stored at –70ºC
    5. For routine plasmid transformations, following method which is modification of thatdescribed by Cohen et al. (1972) was used. An overnight culture of recipient strain wassub-cultured 1:100 in fresh LB medium and grown till mid-exponential phage. Theculture was chilled on ice for 15-min, and the steps thereafter were performed at 4ºC.20 ml of culture was centrifuged and pellet was re-suspended in 10 ml of 0.1 M CaCl2.After 15-min of incubation on ice, the cells were again centrifuged and re-suspended in2 ml of 0.1 M CaCl2. The suspension was incubated on ice for 30-min. To the 200 μl aliquot of the cell suspensionplasmid DNA (20 to 200 ng in less than 10 μl volume)was added, incubated for half an hron ice and given a heat shock for 90-sec at 41ºC.The cultures was rapidly chilled, mixed with 0.8 ml of LB-broth and incubated at 37ºCfor 1-hr, and plated on an appropriate selective medium at various dilutions. An aliquotof cell suspension to which plasmid DNA was not added served as a negative control
    1. For SEM, C. glabratacells were fixed for 24 h in 2.5% glutaraldehyde in phosphate buffer (0.1 M, pH 7.2) at 4 ̊C, post-fixed in 2% aqueous osmium tetroxide for 4 h and dehydrated. After drying to critical point, mounted samples were coated with a thin layer of gold for 3 min using an automated sputter coater and visualized by SEM (JEOL-JSM 5600)
    2. min. Cells were normalized to equal OD600, resuspendedin 1 ml 50 mM Tris-HCl (pH 7.5) and transferred to 2 ml microcentrifuge tubes. Cells were lysed with glass beadsin a homogenizer (FastPrep®-24,MP Biomedicals)asdescribed earlier.Brokencells were washed from glass beadswith 500 μl Tris-HCl (50 mM, pH 7.5) and pelleteddown at 15,000 g for 10 minto obtainall cell wall and membrane content. Pellet was then boiled for 10 minin 1mlTris-HCl(50mM; pH 7.5)solutioncontaining 2%SDS. SDS-extractable material(mannoproteins)was savedand remaining pellet wasboiled again in 500 μl Tris-HCl(50 mM; pH 7.5)buffer containing 2%SDS. Cell wallwas collectedby centrifugation at 15,000 g for 10 min, washed twice with1 ml waterandresuspendedin 100 μl 67 mM potassium phosphatebuffer. This washed cell wall materialwas used for β-glucan estimation as described below
    3. Crude fractionation of total membraneswas carried outviadifferential centrifugation asdescribed previously (Moranoand Klionsky,1994)with slight modifications. Cells grown tolog-phase in YPDmedium werecollected, washed,normalizedto 10 OD600and resuspendedin 1 ml spheroplast buffer containing 1-2mg of zymolyase20T (MP Biomedicals).Following incubation at 30 ̊Cfor 30-45 min,spherolplastswerecollected by centrifugation at 800 g for 3 minat 4 ̊C and resuspendedin 1 mlice-cold Tris-EDTA (pH 7.5). Spheroplastswere lysed with 100 μl 0.5mm glass beads on a vortex mixer with 10 secpulsegiven thricewith intermittent ice-breaks.Cellsuspension was centrifuged at 800 g for 5 minat 4 ̊C to pellet unbrokenspheroplastsdown andthesupernatant was centrifuged at 15,000 g for 5 minat 4 ̊C to obtainthemembrane fraction pellet.Pellet was washed once with ice-cold Tris-EDTA (pH 7.5), resuspendedin 50 μl of the samebuffer and stored at -20 ̊Ctill further use. Protein concentration of pellet fraction was estimated using BCAprotein assay kit with BSA as thestandard
    4. Trehalose from C. glabratacells was extracted by trichloro acetic acid (TCA)solutionas described previously (Lillie et al.,1980). Cells grown in YPDmediumwere collected at different time pointsof growth and washed thrice with ice-cold sterile water. Cells were immediatelystored at-20 ̊Ctill further use.For trehalose isolation, 10-20 OD600cells were thawed in 500 μl TCA (0.5 M) solutionon ice and incubated at room temperaturefor 1 h.Supernatant fraction was collected by sedimenting cells at 14,000 rpm for 5 minat 4 ̊C.TCA extractionwas repeated withcells once more and the resultingsupernatant was mixed with the earlier fraction.Extractedtrehalose was measuredby phenol-sulphuric acid methodof carbohydratedeterminationwithcommercially available purified trehalose(Becton, Dickinson and Co.) as a standard.Total trehalosecontent was normalized to the cell densityand expressed as μg/2 x 107cells
    5. To assess the activity of plasma membrane proton pump, CgPma1, in cells grown in differentexternal pH environment,whole cell acidification assaywas carried out.This assay is a measurement of glucose-responsive proton pump activityin live cellsand is based on a decrease inthe pH of a weakly-buffered solutionupon extrusion of H+ions from thecell. The amount of change in the pH of the medium represents a crude measurement of the activity of functional plasma membrane proton pump in live cells. Whole cell acidification assay was conductedwithcellsgrown in YNB pH 5.5 and YNB pH 2.0medium as described previously (Martinez-Munoz and Kane, 2008) with slight modifications.After growth at30 ̊C for 2 h, cells were harvested, washed and resuspended(1.5-3.0 mg wet weight/ml) in 15ml MES/TEA (1mM; pH 5.0) buffer. Cell suspension was kept at 25 ̊C with continuousagitation. Extracellular pH of the buffer solution was recorded at 1 mininterval for 20 minwith the help of a pH meter(BT-600, BoecoGermany). To activate plasma membrane proton pumping, glucose and KCl were added to a final concentration of 40mM after 3 and 8 minincubation, respectively. Plasma membrane proton pump activitywas plotted as a change in the pH of the extracellular solutionversustime
    6. Log-phase yeast cell cultures were harvested and total protein was extracted by lysingyeast cells using glass beads. Briefly,10 mllog-phase yeast culturesgrownin appropriate medium were harvested,washed once with ice-cold water and suspended in 250 μl homogenizing buffer containing 1 mM phenylmethylsulfonylfluoride(inhibitsserine proteases), 10 mM sodium fluoride(inhibit Ser/Thr and acid phosphatases), 1 mM sodium orthovanadate (inhibits Tyr and alkaline phosphatases) and 1X concentration of protease inhibitor cocktail(RocheCat # 04693159001). Cells were lysedwith glass beads by vortexing five times at high speed for 1 min with intermittent 1 min ice breaks. Unbroken cells and cell debris were removed by centrifugation at 1,000 g for 5 min at 4 ̊C. Cell lysate was collected and protein was quantified using bicinchoninic acid (BCA)protein assay kit (Thermo Scientific # 23227) as per supplier’s instructions
    7. Themethod was used for isolation of good quality genomic DNA that wasused to map Tn7insertionin C. glabratamutants.Briefly,10 mlsaturated yeast culturewasharvested, resuspendedin 1 ml sterile water and transferred toa2 ml microcentrifuge tube. Cells were pelleteddown by centrifugation at 4,000 rpm for 5 min. Supernatant was discarded and the pellet was resuspendedin 500 μl freshly prepared solutioncontaining100mM EDTAand 5% β-mercaptoethanol andincubated at 42 ̊C for 10 min. After incubation,cells were spun down at 5,000 rpm for 1 minand resuspendedin 500μl freshly-prepared BufferB. One tip full of lyticase(Sigma # L4025) was added and cellsuspension was incubated at 37 ̊C for 1 h. Following incubation,cell suspension was spun down at 6,000 rpm to recover spheroplasts.Spheroplasts weregently resuspendedin 500μl BufferCand DNA was twice extracted with 500μl phenol:chloroform:isoamyl alcohol (25:24:1)solution.Aqueous layer was collected in a new 2ml microcentrifuge tube and DNA was precipitated with 1ml ethanol and 1/10thvolume of 3M sodium acetate (pH 5.2)by centrifugation at 13,000 rpm for 5 min. Pellet was resuspendedin 200 μl TE containing 0.3 μl of RNase Cocktail™and incubated at 37 ̊C for 30 min.After incubation, 300 μl additional TE was added and DNAwas re-precipitated withethanol and 3 M sodium acetateas described above. Pellet was washed with 70% ethanol anddried under air. DNA pellet was finally suspended in 100 μl TE and stored at -20 ̊C
    8. Yeast cell viability was measured by plating appropriate dilutions of cell cultureonYPD plates at various time intervalsduringgrowth.Cell suspension was diluted in1X PBS. YPD plates were incubated at 30 ̊C for 2-3 daysand total colony forming units(CFUs)were calculated by counting the number of coloniesthat appeared onYPDplatesand dividing that number by anappropriate dilution factor
    9. Luria Bertani (LB):0.5% Yeast Extract1% Tryptone 1% NaCl LB-ampicillinand LB-kanamycin plates:LB medium50 μg/ml ampicillin30 μg/ml kanamycinSuper Optimal Broth (SOB): 0.5% Yeast extract2% Peptone 10 mM NaCl2.5 mM KCl10 mM MgCl210 mM MgSO4
    1. E. colistrains carrying plasmids were inoculated and grown overnight at 37ºC and 200 rpm in LB-liquid medium supplemented with either 50 μg/ml ampicillinor 30 μg/ml kanamycin. Cells were harvested by centrifugation at 2,500g for 5 min. Plasmids were extracted using Qiagen plasmid miniprep kit following the manufacturer’s instructions. Concentration of the extracted plasmid DNAs was measured using spectrophotometerat 280 nmandstored at -20ºC
    2. weretransferred toa sterile 100 mm cell culture dishcontaining 11 mlfresh and prewarmed completemedium andculturedin tissue culture incubatorat37°C and 5% CO2.After 12hincubation, medium was replacedwith fresh prewarmed mediumand cells were allowed to proliferate till they acquire 80% confluence
    3. Freezer stocks of THP-1 and Lec-2 cells were prepared either in commercial cell preservation medium (Gibco) or completemedium supplemented with 10%heat inactivated serum and 10% DMSO. For cryopreservation, 5-6 million cells were resuspended in 0.5 mlfreezing medium in 2 ml cryopreservation vials,stored in an isopropanol bath and were transferred to-70°C freezer. Aftertwo days, freezer stocks were transferred to liquid nitrogen containertill further use. To revive the cells, freezer stocks were taken outfrom liquid nitrogen container and transferred immediately to37°C water bath. After2-3 min, when freezing medium hadthawed completely,cells
    1. Overnight grown bacterial culture (3ml)was pellet down by centrifugationat4ºC for10-min at 6000 rpm. The cells were re-suspended in 200μl of Resuspension solution(solutionI). 400μl of freshly prepared Lysissolution(solution II)was then added and mixed by gently inverting the tubesfor 4-6 times and allowed to lyse for 5 min at room temperature.The complete lysis was ascertained by uniformity and clarityof the contents. Subsequently, 400μl of Neutralization solution(solution III)was added and the tubes were inverted 4-6 timesand gently for homogeneous mixing followed byincubation for 5 min on ice. After centrifuging at 12,000 rpm for 15-min, supernatant was decanted into a fresh tube, and0.7 volume of iso-propanol was added.Theprecipitated nucleic acids were then recovered by centrifugation at 12,000 rpm for 30-min. The pellet was washed once with 70% ethanol, air-dried and re-suspended in 100μl of TE-buffer. It was treated with RNase at a concentration of 20μg/ml by incubating at 37ºC for 1hour. It was further extracted with an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) mixture. After centrifugation, the clear supernatant was used for recovering the nucleic acids. The nucleic acids were precipitated with 2.5 volumesof ethanolin presence of3 M sodium acetate. In case where high purity plasmid preparations are required (for transfection to cells) the plasmid isolation was carried out with the commercially available midiprep or miniprep kits following the manufacturer’s instruction. Plasmids were observed on 1% agarose gel
    2. drop wiseaddition and kept at 4⁰C for 24h. Cells were then washed with PBS and stained with DNA staining solutionat 370C in darkwith intermittent shaking. The DNA content of cells was measured by flow cytometryusing FACS-Aria (Beckton-Dickenson) at 695 ±20 nm using a 655 long pass filter.The DNA content was then analysed by FACSDivaor FlowJosoftwareto evaluate the various phases of cell cycle. The diploid 2N DNA content was referred as G1/G0 population and the 4N DNA content was referred as G2/M population. Cells with intermediary DNA content (between 2N -4N) content were considered as S phasecells and those below 2N DNA content as sub G0 cells