PatientID: IP (Proband)

KindredID: E

Case: M, 21Y0M, Hungarian

DiseaseAssertion: VHL

FamilyInfo: Index patient was a 21-year-old man who had bilateral renal masses and renal cysts. Family history indicated a high suspicion for VHL disease, as his mother was operated for renal cell carcinoma, his uncle had spinal cord tumor, and his grandmother underwent operation for renal cell carcinoma. However, detailed clinical evaluation could not be performed in family members.

CasePresentingHPOs: HP:0005584; HP:0005562 (Renal cell carcinoma, Multiple renal cysts)

CaseHPOFreeText: Presented with bilateral highly vascularized renal masses and a large number of renal cysts. Diagnosed with VHL Type 1. Renal masses are noted as renal cell carcinoma in Table 1.

CaseNotHPOs: HP:0002666; HP:0009711; HP:0010797 (Pheochromocytoma, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F119Qfs*12 (c.354_355del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA915940709, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.354_355del

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion; minus_2_frameshift_variant

CivicName: F119fs (c.354_355del)

MultipleGeneVariants: N/A

ArticleReferenceSequence: Not specified – only protein change was documented by the author, nucleotide variant was found under reference sequence NM_000551.3

GenotypingMethod: Genetic analysis consists in the search of germ line mutation of VHL, SDHB, SDHD, SDHC (all coding exons and intron-exon junctions are investigated) or RET (only exons 10, 11, 15 and 16 are studied) by PCR-sequencing on both strands of DNA

SamplingMethod: Not specified

PatientID: None (daughter)

KindredID: 1

Case: F, 5Y0M, ethnicity unknown

DiseaseAssertion: asymptomatic

FamilyInfo: The patient's family members (grandparents, mother (33Y0M; Case 1) and sister (10Y0M) underwent genetic testing. Sister and grandparents were not positive, however mother was found positive with the same mutation.

CasePresentingHPOs: None

CaseHPOFreeText: Full evaluation did not reveal any tumor localization.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D92G (c.275A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750765 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.275A%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: D92G (c.275A>G)

MultipleGeneVariants: N/A

Fourty-four of 389 patients with VHL (between 1988-1999) screened positive for pancreatic neuroendocrine tumours (PNETs) either by pathologic analysis of tissue specimens or by characteristic radiographic appearance on CT and MRI. VHL gene germline mutations were determined by quantitative Southern blotting to detect deletions of the gene and gene rearrangements as well as complete gene sequencing. Patient 44 (39 year old male) was found to harbour the c.563T>C mutation in the VHL gene (stated as 776 T to C in the paper which used the Latif sequence as reference) resulting in a Leu to protein change at position 188. The patient presented with two pathologic pancreatic neuroendocrine tumors. ACMG evidence codes: 'PP4' since the patient presents phenotypes highly specific for a disease with a single genetic etiology.

PatientID: 17

KindredID: 6007

Case: F, 31Y9M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: She presented with 1 radiographic pancreatic neuroendocrine tumor diagnosed at age 29Y. Follow up 33M after WP surgery, currently no evidence of disease.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F76del (c.227_229delTCT)

LegacyVariant: p.delF (c.439_441delTTC)

CaseProblemVariantFreeText: NM_000551.3:c.226_228delTTC automaps to NM_000551.3:c.227_229delTCT

ClinVarID: N/A

CAID: CA357012, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.227_229del

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.227_229del)

MultipleGeneVariants: N/A

PatientID: 30

KindredID: 3407

Case: M, 50Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Another member of his family (patient 31) presented with one radiologic pancreatic neuroendocrine tumor and had the same VHL gene mutation.

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: He presented with one radiologic pancreatic endocrine tumour.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: p.R167W (c.712C>T)

CaseProblemVariantFreeText: N/A

ClinVar: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: CA020450 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.499C%3ET

gnomAD: 0.000007954 https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 43

KindredID: 5959

Case: F, 35Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: She presented with four pathologic pancreatic neuroendocrine tumors.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P81S (c.241C>T)

LegacyVariant: p.P81S (c.454C>T)

CaseProblemVariantFreeText: N/A

ClinVar: 2233 https://www.ncbi.nlm.nih.gov/clinvar/variation/2233/

CAID: CA020148 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.241C%3ET

gnomAD: 0.0002179 https://gnomad.broadinstitute.org/variant/3-10183772-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P81S (c.241C>T)

MultipleGeneVariants: Germline, VHL, c.562C>G (p.Leu88Val)

Germline mutational data on VHL was gathered from various countries to assess variation in germline mutations that produce disease within different populations. Families were grouped according to three possible outcomes of disease: renal cell carcinoma without pheochromocytoma, renal cell carcinoma with pheochromocytoma, or pheochromocytoma alone. SSCP and denaturing gradient gel electrophoresis identified mutations in 300/469 (63%) of families affected with VHL. This germline familial VHL mutation (G93fs (c.277delG)) was taken from the Bristol Myers Squibb database, with an unknown number of members belonging to Family ID 16BMS. It was reported in the paper as c.490delG due to a difference in transcript reference. As reported in Table 3, this mutation is found in VHL families without pheochromocytoma, and with renal cell carcinoma.

GroupID/ KindredID: 6CE

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Munich, university of Freiburg and Institute of Pathology database, with an unknown number of members belonging to Family ID 6CE. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S183* (c.548C>A)

LegacyVariant: p.S183* (c.761C>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 2215 https://www.ncbi.nlm.nih.gov/clinvar/variation/2215/

CAID: N/A

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site either by truncating the protein or by location between codons 157 and 189.

MutationType: stop_gained

CivicName: S183* (c.548C>A)

MultipleGeneVariants: N/A

GroupID/ KindredID: 11YO

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Department of Uroglogy, Yokohama database, with an unknown number of members belonging to Family ID 11YO. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.C162Y (c.485G>A)

LegacyVariant: p.C162Y (c.698G>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 223225 https://www.ncbi.nlm.nih.gov/clinvar/variation/223225/

CAID: N/A

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by location between codons 157 and 189.

MutationType: missense_variant; transition

CivicName: C162Y (c.485G>A)

MultipleGeneVariants: N/A

Germline mutational data on VHL was gathered from various countries to assess variation in germline mutations that produce disease within different populations. Families were grouped according to three possible outcomes of disease: renal cell carcinoma without pheochromocytoma, renal cell carcinoma with pheochromocytoma, or pheochromocytoma alone. SSCP and denaturing gradient gel electrophoresis identified mutations in 300/469 (63%) of families affected with VHL. This germline familial VHL mutation (E186K (c.556G>A)) was taken from the National Cancer Institute database, with an unknown number of members belonging to Family ID 3736NCI. It was reported in the paper as c.769G>A due to a difference in transcript reference. As reported in Table 3, this mutation is found in VHL families without pheochromocytoma, and with renal cell carcinoma. Later publications reference this cohort as being reported in PMIDs: 7728151 and 9829911.

Germline mutational data on VHL was gathered from various countries to assess variation in germline mutations that produce disease within different populations. Families were grouped according to three possible outcomes of disease: renal cell carcinoma without pheochromocytoma, renal cell carcinoma with pheochromocytoma, or pheochromocytoma alone. SSCP and denaturing gradient gel electrophoresis identified mutations in 300/469 (63%) of families affected with VHL. This germline familial VHL mutation (E186del (c.558_560del)) was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 113CA. It was reported in the paper as c.771_773delGlu due to a difference in transcript reference. Table 5 lists all ID and mutations associated with individuals without detailed clinical information. Other phenotypes are possible, however not detailed here.

Germline mutational data on VHL was gathered from various countries to assess variation in germline mutations that produce disease within different populations. Families were grouped according to three possible outcomes of disease: renal cell carcinoma without pheochromocytoma, renal cell carcinoma with pheochromocytoma, or pheochromocytoma alone. SSCP and denaturing gradient gel electrophoresis identified mutations in 300/469 (63%) of families affected with VHL. This germline familial VHL mutation (Y175* (c.525C>G)) was taken from the Neuro Olcologie database in Paris, with an unknown number of members belonging to Family ID 63F. It was reported in the paper as c.738C>G due to a difference in transcript reference. As reported in Table 3, this mutation is found in VHL families without pheochromocytoma, and with renal cell carcinoma.

GroupID/ KindredID: 133CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 133CA. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114C (c.340G>T)

LegacyVariant: p.G114C (c.553G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751376 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.340G>T

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: G114C (c.340G>T)

MultipleGeneVariants: N/A

GroupID/ KindredID: 4479NCI, 50CE

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the National Cancer Institute database as well as the Munich, university of Freiburg and Institude of Pathology database, with an unknown number of members belonging to Family ID 4479NCI and 50CE. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without phechromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL families with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: 8707293

SupplementalData: N/A

Variant: p.E70* (c.208G>T)

LegacyVariant: p.E70* (c.421G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 428806 https://www.ncbi.nlm.nih.gov/clinvar/variation/428806/

CAID: N/A

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: stop_gained

CivicName: E70* (c.208G>T)

MultipleGeneVariants: N/A

PMID: 11284029

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

GroupID: 53

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: 2 members of this family were found to harbor the c.407T>C germline variant of the VHL gene. Members 939 and 1460 presented with severe renal disease (RCC). Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

GroupPresentingHPOs: HP:0005584 (Renal cell carcinoma)

GroupHPOFreeText: Severe renal disease (any solid lesion before 25 years of age, five or more solid lesions within one or two kidneys, or metastasis of renal cell carcinoma).

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: Paper states that this family is previously reported in PMID 12202531 and/or 9829912, where 2 and 2 individuals respectively with this mutation are reported. It is unclear if one or both of these previously reported groups are the same as the current family. One or both of these previously reported patients could correspond to family 94 in the current paper.

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.F136S (c.407T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 496064, https://www.ncbi.nlm.nih.gov/clinvar/variation/496064/

CAID: N/A

gnomAD: 0.000003976, https://gnomad.broadinstitute.org/variant/3-10188264-T-C?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: F136S (c.407T>C)

MultipleGeneVariants: N/A

Molecular and clinical analysis of 126 French VHL families tested for renal involvement revealed 92 different mutations. 90 of these families had renal involvement. The p.W88S (c.263G>C) germline variant of the VHL gene was detected in an individual (ID 5654, Family 266). The patient presented with renal cell carcinoma. No family information is provided. The paper states that this patient is previously reported in PMIDs ​​12202531 and/or 9829912.

GroupID: 285

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: French

GroupAgeRange: N/A

GroupInfo: 4 members of this family are reported as carrying the E52K (c.154G>A) germline variant of the VHL gene. Member 6493 had no renal involvement, member 1422 had mild renal involvement and member 6495 had moderate renal involvement (RCC) and member 6497 phenotypes were unknown. Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.

GroupPresentingHPOs: HP:0009726; HP:0005584 (Renal neoplasm, Renal cell carcinoma)

GroupHPOFreeText: Mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]). Moderate renal disease (less than five solid lesions requiring surgical treatment, either unilateral or bilateral).

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.

Variant: p.E52K (c.154G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 161402, https://www.ncbi.nlm.nih.gov/clinvar/variation/161402/

CAID: N/A

gnomAD: 0.00008525, https://gnomad.broadinstitute.org/variant/3-10183685-G-A?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: E52K (c.154G>A)

MultipleGeneVariants: N/A

Molecular and clinical analysis of 126 French VHL families tested for renal involvement revealed 92 different mutations. 90 of these families had renal involvement. The p.H191Tfs*11 (c.571del) germline variant of the VHL gene was detected in a family (ID 51). Members 2127, 1184 and 1182 had unknown renal involvement. Member 1183 presented with severe renal disease (RCC). The paper states that this family is previously reported in PMID 12202531 and/or 9829912.

A cohort of 141 patients with hemangioblastomas of the central nervous system was analyzed. 81 patients had germline mutations in the VHL gene, analyzed through peripheral blood by Southern blotting and SSCP analysis. This missense mutation (c.499C>T) was recorded in the paper as c.712C>T due to a difference in transcript sequence. It was found in 5 patients with hemangioblastomas of the central nervous system, one of which had primary asymptomatic tumors. Any family information or relations is unknown. No other phenotypes described.

A cohort of 141 patients with hemangioblastomas of the central nervous system was analyzed. 81 patients had germline mutations in the VHL gene, analyzed through peripheral blood by Southern blotting and SSCP analysis. This missense mutation (c.331A>C) was recorded in the paper as c.544A>C due to a difference in transcript sequence. It was found in 1 patient with a hemangioblastoma of the central nervous system. Any family information is unknown. No other phenotypes described.

GroupID: 13

DiseaseAssertion: hemangioblastoma

GroupSize: 6

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 6 out of the 81 patients listed in this hemangioblastoma cohort were found with this c.266T>C mutation. Any relation is unknown.

GroupPresentingHPOs: HP:0010797 (hemangioblastoma)

GroupHPOFreeText: all patients had hemangioblastoma of the CNS; other phenotypes are unknown. 2 patents were said to be found with primary asymptomatic tumors.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L89P (c.266T>C)

LegacyVariant: p.L89P (c.479T>C)

CaseProblemVariantFreeText: N/A

ClinVarID: 182979 https://www.ncbi.nlm.nih.gov/clinvar/variation/182979/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: L89P (c.266T>C)

MultipleGeneVariants: N/A

GroupID/ KindredID: F31

Case: Sex unknown, 19Y0M, Spanish

DiseaseAssertion: assumed VHL

FamilyInfo: familial antecedents found; unknown of any additional features to index case relatives

CasePresentingHPOs: HP:0009711; HP:0009713; HP:0006880; HP:0000107; HP:0001737 (retinal capillary hemangioma, spinal hemangioblastoma, cerebellar hemangioblastoma, renal cysts, pancreatic cysts)

CaseHPOFreeText: Age of onset is 19Y0M.

CaseNotHPOs: HP:0006770;HP:0002666 (clear cell renal cell carcinoma, pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D126Efs*6 (c.377_378insG)

LegacyVariant: g.5429_5430insG

CaseProblemVariantFreeText: Patient was reported with the g. (genomic) coding positions. The g.5429_5430insG variant worked out to correspond with c.377_378insG.

ClinVarID: N/A

CAID: CA2499307020 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2499307020

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_1_frameshift_variant

CivicName: D126fs* (c.377_378insG)

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 19

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history not mentioned. Patient’s variant reported as germline.

CasePresentingHPOs: N/A

CaseHPOFreeText: Patient had VHL disease type 1 (see table 1).

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9829911

SupplementalData:  N/A

Variant: p.F76del (c.227_229del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA357012, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.227_229delTCT

gnomAD: N/A

VariantEvidence: Variant reported as c.226_228del and was mapped to c.227_229del.

MutationType: inframe_deletion

CivicName: F76del (c.227_229del)

MultipleGeneVariants: N/A

PMID: 32179488

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

A 13-year-old boy was screened for a VHL mutation at 7-years-old upon identification of a missense V170G(c.509T>G) variant in the patient's father. Genetic screening of the patient also revealed that he was a carrier of same mutation as his father, but without expression of the disease at diagnosis. The father had been operated on for a bilateral pheochromocytoma at 12 years old. Upon diagnosis, annual follow ups were performed on the patient and appeared normal. At 13-years-old the patient was rushed to the hospital due to polyuria, headache, flushes, and abnormal perspiration. Abdominal ultrasonography revealed an adrenal gland tumor. His vitals were monitored and high blood pressure was treated with antihypertensive bitherapy combining an α- and β-blocker (labetalol) with a calcium antagonist (nicardipine). An MRI confirmed that the adrenal gland tumour was compatible with a pheochromocytoma. Adrenalectomy was performed, followed by slowly weaning the patient of the medications. At the last follow up 2 years after surgery, there has been no recurrence.

PatientID: III-6

KindredID: 1

Case: M, Age Unknown, Chinese

DiseaseAssertion: CNS Hemangioblastoma

FamilyInfo: The transversion mutation was found and confirmed in 4 patients (II-2, III-2, III-6, III-10, III-11) and 3 carriers (III-3, III-9, III-14). At least 5 additional members had VHL phenotypes, but had all passed away before genetic testing. Could be assumed and deduced their genetics due to pedigree showing future linear relations of this mutation all in generation III.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S168T (c.503G>C)

LegacyVariant: p.S168T (c.716G>C)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756183 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.503G%3EC

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S168T (c.503G>C)

MultipleGeneVariants: N/A

PatientID: 30

KindredID: 30

Case: Age, sex, ethnicity unknown

DiseaseAssertion: hemangioblastoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S65L (c.194C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182975 https://www.ncbi.nlm.nih.gov/clinvar/variation/182975/

CAID: N/A

gnomAD: https://gnomad.broadinstitute.org/variant/3-10183725-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: S65L (c.194C>T) AND L89P (c.266T>A)

MultipleGeneVariants: Somatic, VHL, c.266T>A (p.Leu89Pro)

PMID: 24877602

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

PatientID: None

KindredID: 9

Case: F, 22Y0M, Ethnicity unknown

DiseaseAssertion: assumed VHL

FamilyInfo: No familial/syndromic (FS) association

CasePresentingHPOs: HP:0002666; HP:0002668 (pheochromocytoma, paraganglioma)

CaseHPOFreeText: Sympathetic PGL with an onset of 11Y0M and a benign bilateral pheochromocytoma at 22Y0M

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: SDHB,SDHC, SDHD, and exons 10, 11, 13, 14, 15 and 16 of RET proto-oncogene

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 8

Case: M, 15Y0M, Ethnicity unknown

DiseaseAssertion: assumed VHL

FamilyInfo: Familial/syndromic (FS) association

CasePresentingHPOs: HP:0002666; HP:0002668; HP:0009711 (Pheochromocytoma; paraganglioma; retinal capillary hemangioma)

CaseHPOFreeText: Benign sympathetic Paraganglioma at age 12Y0M and unilateral pheochromocytoma at age 15Y0M; as well as retinal angioma (age unclear)

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: SDHB,SDHC, SDHD, and exons 10, 11, 13, 14, 15 and 16 of RET proto-oncogene

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98S (c.293A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 219160 https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PMID: 28646318

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3

GenotypingMethod: N/A - used medical records from Mayo Clinic Rochester, MN, to obtain mutational outputs.

SamplingMethod: N/A

PatientID: None

KindredID: 3

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Her father had this VHL mutation and presented with renal cell carcinoma.

CasePresentingHPOs: N/A

CaseHPOFreeText: She is described as affected but her phenotypes are not outlined.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Previously published in 24301059.

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 3

Case: M, 48Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: He had a daughter who has heterozygous for the mutation.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Previously published in 24301059.

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had a mosaic mutation with a mutated allele frequency of 1.7%. The right renal cell carcinoma was analyzed and found to have a mutated allele frequency of 11.1%. Copy number events of the mutated and wild type allele are available in table S4 of the supplemental.

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: III-46

KindredID: 1

Case: F, Age unknown, Ethnicity Unknown

DiseaseAssertion: asymptomatic

FamilyInfo: Large multigenerational family with a history of both VHL and spinocerebellar ataxia type 2 (SCA2). Screening for clinical and genetic diagnostics were gathered as well as thorough information on non-living members. Her sister, dad and grandmother appeared to have the VHL mutation. See family pedigree (Fig. 1).

CasePresentingHPOs: None

CaseHPOFreeText: VHL found by genetic testing not clinical findings.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.E160Sfs*10 (c.477delA)

LegacyVariant: c.688delA

CaseProblemVariantFreeText: c.477del, p.Glu160Serfs10 should be used. Details: 477del same as 475delA bc that codon is AAA so doesn't matter which A gets deleted: there is an A at 475 476 477 so for HGVS we say that 477 (the latter) is deleted since that follows HGVS nomenclature. Thus use c.477del: p.Glu160Serfs10

ClinVarID: 182959 https://www.ncbi.nlm.nih.gov/clinvar/variation/182959/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: E160fs (c.477del)

MultipleGeneVariants: N/A

PatientID: III-24

KindredID: 1

Case: F, Age unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: Large multigenerational family with a history of both VHL and spinocerebellar ataxia type 2 (SCA2). Screening for clinical and genetic diagnostics were gathered as well as thorough information on non-living members. 1/2 of her sons also appeared to have the VHL mutation. See family pedigree (Fig. 1).

CasePresentingHPOs: HP:0002011; HP:0009711; HP:0000077 (Morphological central nervous system abnormality, retinal capillary hemangioma; Abnormality of the kidney)

CaseHPOFreeText: Patient mentioned to have CNS (including retinal angiomas) and renal involvement.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.E160Sfs*10 (c.477delA)

LegacyVariant: c.688delA

CaseProblemVariantFreeText: c.477del, p.Glu160Serfs10 should be used. Details: 477del same as 475delA bc that codon is AAA so doesn't matter which A gets deleted: there is an A at 475 476 477 so for HGVS we say that 477 (the latter) is deleted since that follows HGVS nomenclature. Thus use c.477del: p.Glu160Serfs10

ClinVarID: 182959 https://www.ncbi.nlm.nih.gov/clinvar/variation/182959/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: E160fs (c.477del)

MultipleGeneVariants: N/A

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amino acid or that disrupt the structural integrity of the VHL gene product (pVHL). Age-related risks of retinal hemangoblastomas and renal cell carcinoma were higher in patients with nonsense or frameshift mutations. Southern blot and/or MLPA analysis by whole blood detected this mutation (c.606dupA) was found in a patient with hemangioblastomas of the cerebellum at 25Y old. No family info was provided.

GroupID: 21

Case: Age unknown, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: asymptomatic

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: Unknown

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0009711; HP:0005584; HP:0002666; HP:0006880 (retinal capillary hemangioma; renal cell carcinoma; pheochromocytoma; cerebellar hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.T124Mfs*33 (c.371_377delCACACGA)

LegacyVariant: p.T124Mfs*33 (c.369_375delGACACAC)

CaseProblemVariantFreeText: written in paper as:c.369_375del, automaps to NM_000551.3:c.371_377del - most up to date transcript

ClinVarID: N/A

CAID: CA913189240 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.371_377delCACACGA

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: G123fs (c.369_375delGACACAC)

MultipleGeneVariants: N/A

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface amino acid (p<=0.004) than for patients with missense mutations that disrupt the structural integrity of the VHL gene product (pVHL) or other loss of function mutations (either germline deletions or truncating mutations). This missense mutation (c.256C>T), affecting residue within the pVHL protein core, was found in a VHL patient with cerebellar hemangioblastomas diagnosed at 35Y. ACMG codes as follows: Supporting evidence of pathogenicity because missense variant in a gene that has a low rate of benign missense variation and where missense variants are a common mechanism of disease (PP2).

GroupID: 20

Case: 19Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: retinal capillary hemangioma

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: patient had retinal angiomas diagnosed at 19Y

CaseNotHPOs: HP:0005584; HP:0002666; HP:0006880 (renal cell carcinoma; pheochromocytoma; cerebellar hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.T124Hfs*35 (c.369delG)

LegacyVariant: p.Thr124Hisfs*35 (c.367delG)

CaseProblemVariantFreeText: c.367delG automaps to c.369delG - most up to date transcript

ClinVarID: N/A

CAID: CA432421810 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.369delG

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: T124fs (c.369del)

MultipleGeneVariants: N/A

PatientID: 422

KindredID: 422

Case: Sex Unknown, 49Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: CNS hemangioblastoma.

CaseNotHPOs: HP:0009711; HP:0006770; HP:0002666; HP:0001732; HP:0000107 (Retinal capillary hemangioma, Clear cell renal cell carcinoma, Pheochromocytoma, Abnormality of the pancreas, Renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 17024664

SupplementalData: Table S1, S2 and S3

Variant: p.L135Yfs*24 (c.404del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432421852, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.404del

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion; minus_1_frameshift_variant

CivicName: L135fs (c.404del)

MultipleGeneVariants: N/A

PatientID: 221

KindredID: 221

Case: Sex Unknown, 16Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0010797; HP:0006770; HP:0002666; HP:0000107; HP:0001732 (Hemangioblastoma, Clear cell renal cell carcinoma, Pheochromocytoma, Renal cyst, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 17006605

SupplementalData: Table S1, S2 and S3

Variant: c.-61_-51dup

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 517152, https://www.ncbi.nlm.nih.gov/clinvar/variation/517152/

CAID: N/A

gnomAD: 0.00009581, https://gnomad.broadinstitute.org/variant/3-10183466-C-CTCCGCCCCGCG?dataset=gnomad_r2_1

VariantEvidence: Variant was reported as c.-65_-55dup11 which was mapped to c.-61_-51dup.

MutationType: splice_site_variant; duplication; plus_2_frameshift_variant; 5_prime_UTR_variant

CivicName: c.-61_-51dup11

MultipleGeneVariants: N/A

PMID: 12053037

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

GroupID: 7

DiseaseAssertion: Neuroendocrine neoplasm (pheochromocytoma or paraganglioma)

GroupSize: 7

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Ethnicity unknown

GroupAgeRange: N/A

GroupInfo: This mutation (p.Y156C (c.467A>G)) was found in 7 patients, 3 with a family history and/or a syndromic presentation and 4 with apparently sporadic presentation. 1 of the apparently sporadic patients was previously reported.

GroupPresentingHPOs: HP:0100634 (Neuroendocrine neoplasm)

GroupHPOFreeText: Patients with a pheochromocytoma or a functional paraganglioma were recruited from several different French clinical centers participating in several clinical research networks (Cortico et Medullosurrènale: les Tumeurs Endocrines, Paragan-Glioma Network, Groupe des Tumeurs Endocrines)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: 1 of the apparently sporadic patients was previously reported.

SupplementalData: N/A

Variant: p.Y156C (c.467A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 43600 https://www.ncbi.nlm.nih.gov/clinvar/variation/43600/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: Y156C (c.467A>G)

MultipleGeneVariants: N/A

PatientID: N/A (case)

KindredID: 1

Case: M, 9Y0M, Ethnicity Unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: The parents and siblings were negative for the gene mutation thus indicating that our patient has a De novo mutation.

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: previously healthy male presented with hypertension, increasing BMI despite decreased height and weight, last three years. His ultrasound was abdominal showing bilateral suprarenal masses. An abdominal MRI confirmed the finding of bilateral adrenal masses measuring 3 x 2.7 x 2.5 cm in the right and 3.6 x 3.5 x 2.7 cm in the left. He underwent a bilateral adrenalectomy and pathology resulted as bilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V166F (c.496G>T)

LegacyVariant: p.V166F

CaseProblemVariantFreeText: N/A

ClinVarID: 2224 https://www.ncbi.nlm.nih.gov/clinvar/variation/2224/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: N/A

MultipleGeneVariants: N/A

216 patients with clinically expected VHL disease due to family history or presence of VHL typical tumours were routinely examined in an eye centre in Germany between January 2019 and January 2020, majority of which were of European descent (~95%). Since data on the genotype–phenotype correlation of the onset of Retinal Hemangioblastoma (RH) is scarce in relation to VHL disease, this study wanted to inversitage the relationship between VHL gene variants (truncating vs single amino acid substitutions) and the ocular phenotype of the disease. 42 different rare VHL gene variants in 148 patients were detected - some of whom had RH and some who did not. Although date of onset of RH, as well as data on central nervous system haemangioblastomas (CNSH), pheochromocytoma/paraganglioma (PPGL), clear cell renal cell carcinoma (ccRCC) and pancreatic neuroendocrine neoplasm (PNEN) were collected, it was not reported on a per patient basis and therefore could not be discussed per variant. There were 2 patients reported with the p.V155L (c.463G>C) mutation. Both members presented with retinal hemangiomas, while no other clinical manifestations were discussed. Additionally, no family information was provided.

GroupID: 23

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: This individual patient was the only one discussed with this mutation. They had retinal hemangiomas; Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: p.P86A (c.256C>G)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: 93327 https://www.ncbi.nlm.nih.gov/clinvar/variation/93327/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: P86A (c.256C>G)

MultipleGeneVariants: N/A

Peripheral blood from unrelated patients with pheochromocytoma was tested for mutations of proto-oncogene RET, tumor suppressor gene VHL, succinate dehydrogenase subunit D (SDHD) gene, and the succinate dehydrogenase subunit B (SDHB) gene. Of 271 patients with nonsydromic pheochromocytoma and no family history of the disease, 30 mutations were found in VHL. Multiple pheochromocytomas were statistically more frequent among patients with mutations than among patients without mutations (21 of 66 vs. 5 of 205, P<0.001). The mutation F119L (c.357C>G) was detected in the patient, referred to in the paper by c.570C>G due to a difference in transcript sequence. This missense mutation was found in the VHL gene and one patient with pheochromocytoma.

GroupID: 25B

DiseaseAssertion: Unknown. Patient was pulled from either the VHL-Registry or NET-Registry and recorded with the given mutation. Symptoms or manifestations are not clear.

GroupSize: 5

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 5 patients with the given mutation were grouped as group 25(B) in this study. These patients were asymptomatic or unclear of symptoms.

GroupPresentingHPOs: N/A

GroupHPOFreeText: N/A

GroupNotHPOs: HP:0030405 (pancreatic endocrine tumor)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

GroupID: 23A

Case: Sex, Age, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: None. The patient with the given mutation in this study was a VHL patient with pancreatic ICTs.

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

CaseHPOFreeText: Patient has islet cell tumors (ICTs), or listed as pancreatic endocrine tumor.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L163H (c.488T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756137 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.488T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L163H (c.488T>A)

MultipleGeneVariants: N/A

53 patients with a molecularly confirmed VHL mutation (by PCR through EDTA-anticoagulated blood) and a pancreatic neuroendocrine tumor (ICT) were collected from the German NET-Registry and the German VHL-registry. An additional 296 patients were stated in this paper with a VHL associated germline mutation, but without pancreatic neuroendocrine tumors. 160 patients were found to have the above mutation (c.292T>C). 2 were VHL patients with ICTs (pancreatic neuroendocrine tumors) taken from the VHL-registry. The other 158 patients were stated to be in this study with the given mutation, however no ICT. Other clinical manifestations outside of a pancreatic neuroendocrine tumor are possible, but were not discussed. ACMG evidence codes: 'PP2' because they observe a missense variant in a gene where missense variants are a common mechanism of disease.

GroupID: 24B

DiseaseAssertion: Unknown. Patients were pulled from either the VHL-Registry or NET-Registry and recorded with the given mutation. Symptoms or manifestations are not clear.

GroupSize: 15

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 15 patients with the given mutation were grouped as group 24(B) in this study. These patients were asymptomatic or unclear of symptoms.

GroupPresentingHPOs: N/A

GroupHPOFreeText: N/A

GroupNotHPOs: HP:0030405 (pancreatic endocrine tumor)

GroupNotHPOFreeText: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954 https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 28B

DiseaseAssertion: Unknown. Patient was pulled from either the VHL-Registry or NET-Registry and recorded with the given mutation. Symptoms or manifestations are not clear.

GroupSize: 3

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 3 patients with the given mutation were grouped as group 28(B) in this study. These patients were asymptomatic or unclear of symptoms.

GroupPresentingHPOs: N/A

GroupHPOFreeText: N/A

GroupNotHPOs: HP:0030405 (pancreatic endocrine tumor)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q195* (c.583C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 428794 https://www.ncbi.nlm.nih.gov/clinvar/variation/428794/

CAID: CA70052558 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.583C%3ET

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q195* (c.583C>T)

MultipleGeneVariants: N/A

PatientID: 87

KindredID: 27

Case: F, Age Unknown, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 81) had 3 family members confirmed with the mutation: his aunt 2 (patient 85) had pancreatic cysts and/or tumors at age 50, his cousin/ the son of Aunt 2 was asymptomatic at the time of assessment, and the granddaughter of aunt 2 was also asymptomatic at the time of assessment. The proband also had 3 family members who passed away before diagnosis/ before confirming the mutation: his mother (patient 82) had a CNS hemangioblastoma at 33, his Aunt 1 (patient 83) had a CNS hemangioblastoma at 32, and his cousin/ the son of Aunt 1 (patient 84) had a CNS hemangioblastoma at 30.

CasePresentingHPOs: N/A

CaseHPOFreeText: The granddaughter of the proband's aunt 2 was asymptomatic at the time of assessment.

CaseNotHPOs: HP:0009711; HP:0010797; HP:0002666; HP:0005584; HP:0001737; HP:0001732 (Retinal capillary hemangioma, Hemangioblastoma, Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.N90I (c.269A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223172; https://www.ncbi.nlm.nih.gov/clinvar/variation/223172/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: N90I (c.269A>T)

MultipleGeneVariants: N/A

PatientID: 50

KindredID: 17

Case: F, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0005584 (Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with multiple pancreatic cysts/tumors and renal cell carcinoma at 30.

CaseNotHPOs: HP:0002666; HP:0009711; HP:0010797 (Pheochromocytoma, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.L85P (c.254T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 376222; https://www.ncbi.nlm.nih.gov/clinvar/variation/376222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: L85P (c.254T>C)

MultipleGeneVariants: N/A

PatientID: 131

KindredID: 49

Case: F, Age 31Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband presented with a pheochromocytoma at 18, retinal angioma at 29, and renal cell carcinoma and multiple pancreatic cysts/tumors at 31.

CaseNotHPOs: HP:0010797 (Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.F136C (c.407T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 496065; https://www.ncbi.nlm.nih.gov/clinvar/variation/496065/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: F136C (c.407T>G)

MultipleGeneVariants: N/A

PatientID: 54

KindredID: 19

Case: F, 33Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 54) has a daughter who was genetically confirmed with the same mutation. The daughter was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0005584 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with a retinal angioma at 12, renal cell carcinoma and multiple pancreatic cysts/tumors at 33.

CaseNotHPOs: HP:0010797; HP:0002666 (Hemangioblastoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.P86S (c.256C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 178692; https://www.ncbi.nlm.nih.gov/clinvar/variation/178692/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P86S (c.256C>T)

MultipleGeneVariants: N/A

PatientID: 231

KindredID: 86

Case: M, 54Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 229) had a sister (patient 230) who was genetically confirmed with the mutation, and presented with a CNS hemangioblastoma at age 40. The proband's brother 1 (patient 231) was also confirmed with the mutation and had a retinal angioma at 25, and renal cell carcinoma at 54. The proband's brother 2 passed away before they could be diagnosed/ confirmed with the mutation, but they had a CNS hemangioblastoma at 35. Finally, the proband's nephew (son of brother 2) was genetically confirmed with the mutation and presented with renal cell carcinoma at age 30.

CasePresentingHPOs: HP:0009711; HP:0005584 (Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband's brother (patient 231) had a retinal angioma at 25 and renal cell carcinoma at 54.

CaseNotHPOs: HP:0010797; HP:0002666; HP:0001737; HP:0001732 (Hemangioblastoma, Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3

GenotypingMethod: Direct-sequence; SSCP (detection conditions: Primers: Forward, CCGAGGAGGAGATGGAGGCC; Reverse, GCTATCGTCCCTGCTGGGTC).

SamplingMethod: N/A - not specified

PMID: 24735130

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

PatientID: 1 (tumour samples 1a, 1b, 1c)

KindredID: 1

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 42 CNS haemangioblastoma samples were obtained from 31 patients, who were consecutively treated between 1993 and 1997 at the Department of Neurosurgery of the Freiburg University Medical Centre.

CasePresentingHPOs: HP:0006880 (cerebellar hemangioblastoma)

CaseHPOFreeText: Patient presented with 3 VHL-related tumors in the cerebellum (a,b,c). All three presented with LOH positive somatic information but negative methylation.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S (c.233A>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.N78S (c.446A>G)

ClinVarID: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: N78S (c.233A>G)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: M, 46Y0M, Spanish

DiseaseAssertion: VHL

FamilyInfo: No familial antecedents and no known familial tumors.

CohortInfo: Probands belonging to 18 unrelated Spanish VHL families carrying germline VHL deletions.

CasePresentingHPOs: HP:0000107; HP:0006880; HP:0006770; HP:0010797 (Renal cyst, Cerebellar hemangioblastoma, Clear cell renal cell carcinoma, Hemangioblastoma)

CaseHPOFreeText: Medullar hemangioblastoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Germline HSPC300 retention. Study provides evidence to show that loss of HSPC300 highly correlates with the absence of ccRCC in VHL patients.

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: His brother and grandfather had the same VHL mutation. His mother also had this mutation and presented with pancreatic cysts, pheochromocytoma, endolymphatic sac tumor, and spinal hemangioblastoma.

CohortInfo:Three patients with endolymphatic sac tumors were studied.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.464-1G>A

LegacyVariant: N/A

CaseProblemVariantFreeText: The paper describes the mutation as "C-to-A transversion at position −1 on the exon 3 splice acceptor sequence in the VHL gene"

ClinVar: 43603 https://www.ncbi.nlm.nih.gov/clinvar/variation/43603/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>A)

MultipleGeneVariants: N/A

A study investigated paraganglioma/pheochromocytoma tumors in a retrospective cohort and a prospective cohort. Some of these tumors were found with germline VHL mutations. Tumour ID 84 was PCC and a germline c.320G>A mutation in the VHL gene. Other phenotypic and demographic information was not available.

A study investigated paraganglioma/pheochromocytoma tumors in a retrospective cohort and a prospective cohort. Some of these tumors were found with germline VHL mutations. Tumor ID 11 (paraganglioma) and 12 (pheochromocytoma) belonged to one 26Y old patient with a germline p.Pro154Ser VHL mutation. Patient data is extracted from two rows assumed to be referring to the same patient (i.e. tumor samples 11 and 12 in Supplementary Table 1a). Other phenotypic and demographic information was not available.

PatientID: None

KindredID: 1

Case: M, 33Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: First cousin (male, 29Y, proband) presented with renal cell carcinoma, vitritis, retinal capillary hemangioma and retinal detachment. The proband also had the germline mutation found in his cousin.

CasePresentingHPOs: HP:0005584; HP:0010797; HP:0009711; HP:0000648; HP:0000572 (Renal cell carcinoma, Hemangioblastoma, Retinal capillary hemangioma, Optic atrophy, Visual loss)

CaseHPOFreeText: He was operated on because of a CNS hemangioblastoma 3 years earlier. The patient stated that he had vision loss in his left eye after the CNS operation. About 2 weeks earlier, a partial right nephrectomy operation was performed due to RCC. The fundus examination revealed optic nerve atrophy and two RH (determined to be the cause of vision loss) at the equator in the left eye, and was normal in the right eye.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S68P (c.202T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA16621912, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA16621912

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: S68P (c.202T>C)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 76

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0030405; HP:0005584 (pheochromocytoma, pancreatic endocrine tumour, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: NONE (unspecified large rearrangement)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: rearrangement_region

CivicName: rearrangement

MultipleGeneVariants: N/A

PatientID: 11

KindredID: 1

Case: Sex Unknown, 55Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Significant family history. Pedigree follows 8 generations (see Figure 3). Family immigrated to Iowa, US, from Baden-Baden, Germany, in 1832; Likely sharing a common ancestor to the traced lineage of the Black Forest region of Germany.

CasePresentingHPOs: HP:0002666; HP:0009711 (pheochromocytoma; retinal capillary hemangioma)

CaseHPOFreeText: 45Y at first pheochromocytoma and ocular angioma (retinal capillary hemangioma).

CaseNotHPOs: HP:0010797; HP:0005584 (hemangioblastoma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: p.Y98H (c.505T>C)

CaseProblemVariantFreeText: N/A

ClinVar: 2223 https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343 https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PMID: 29146893

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

PMID: 19270817

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

PatientID: 14

KindredID: 9

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0010797; HP:0030405 (pheochromocytoma, hemangioblastoma, pancreatic endocrine tumor)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: MEN1/ RET

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 21

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Familial VHL. One other family member mentioned (PatientID: 1)

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q195* (c.583C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.Q195* (c.796C>T)

ClinVarID: 428794 https://www.ncbi.nlm.nih.gov/clinvar/variation/428794/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: p.Q195* (c.583C>T)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 48

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0005584 (renal cell carcinoma)

CaseHPOFreeText: one RCC tumor was detected in this patient

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F76del (c.227delTCT)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.F76del (c.440delTCT)

ClinVarID: N/A

CAID: CA357012 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.226_228delTTC

gnomAD: N/A

VariantEvidence: LOH detected.

MutationType: deletion

CivicName: F76del (c.227delTCT)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 54

Case: Sex, Age, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: another member (54/2) of the family was detected with an HB and the same mutation

CasePresentingHPOs: HP:0006880 (hemangioblastoma)

CaseHPOFreeText: one RCC tumor was detected in this patient

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R177Dfs*25 (c.528delG)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.176 FS (c.741delG)

ClinVarID: N/A

CAID: CA432423454 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.528delG

gnomAD: N/A

VariantEvidence: LOH detected.

MutationType: minus_1_frameshift_variant

CivicName: R177fs (c.528delG)

MultipleGeneVariants: N/A

PatientID: 5

KindredID: 5

Case: F, 83Y0M, Taiwanese (East-Asian)

DiseaseAssertion: renal cell carcinoma

FamilyInfo: N/A

CohortInfo: 8 of 19 patients presenting with clear cell renal cell carcinoma were found to be heterozygous for the germline variant rs1642742 in VHL (c.*294G>A). All but one of these patients (7/8) also presented with the germline variant rs779805 (c.-195G>A) in VHL.

CasePresentingHPOs: HP:0006770 (clear cell renal cell carcinoma)

CaseHPOFreeText: She had stage I clear cell renal cell carcinoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 21982469

SupplementalData: Yes - Additional file 1: Figure S1

Variant: c.*294G>A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 342407 https://www.ncbi.nlm.nih.gov/clinvar/variation/342407/

CAID: N/A

gnomAD: 0.5911 https://gnomad.broadinstitute.org/variant/3-10191943-G-A

VariantEvidence: Heterozygous for both, she also presented with the germline variant c.-195G>A in VHL. LOH (G) of this mutation was found in the tumor tissue as well

MutationType: 3_prime_UTR_variant

CivicName: c.-195G>A AND c.*294G>A

MultipleGeneVariants: Germline, VHL, c.-195G>A

A cohort of VHL patients from the Greater Toronto Area in Canada were retrospectively reviewed. Patient ID 66 was found with this germline mutation (c.408delT) and no manifestations. Authors were contacted and other patients with this mutation (Patients 46, 50, 71, and 72) were reported previously in Aronoff et al, 2018 (PMID: 29437867) as family 5. Patients' age and sex were not reported. ACMG PP4

PatientID: 52

KindredID: 2

Case: Sex Unknown, 23Y0M, Norwegian

DiseaseAssertion: pheochromocytoma

FamilyInfo: Yes, a family history of neuroendocrine tumor (NET). They have another family member with the same mutation and pheochromocytoma.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: Preoperatively presented with hypertension; surgery at 23Y.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: NF1, RET, SDHB, SDHC, SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F119S (c.356T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753715 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.356T%3EC

gnomAD: N/A

VariantEvidence: This mutation was found in DNA from the adjacent normal tissue, and this finding was found to be reproducible. The same VHL variant was later on observed in a family member with PHEO.

MutationType: missense_variant;transition

CivicName: F119S (c.356T>C)

MultipleGeneVariants: N/A

PatientID: 53

KindredID: 53

Case: M, 36Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: Family history positive for VHL. No further details provided.

CohortInfo: 26 Korean patients with more than one HAB in the CNS or eye, a single HAB in the CNS or retina plus a visceral manifestation (multiple renal, pancreatic or hepatic cysts, pheochromocytoma and RCC) and positive family history plus any one of the above manifestations.

CasePresentingHPOs: HP:0010797; HP:0005584 (Hemangioblastoma, Renal cell carcinoma)

CaseHPOFreeText: CNS hemangioblastoma. Other phenotypes presented but not specified (one or more of: pancreatic cyst or tumor, renal or hepatic cyst). Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 19270817

SupplementalData: N/A

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 44

KindredID: 44

Case: M, 30Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: Family history positive for VHL. No further details provided.

CohortInfo: 26 Korean patients with more than one HAB in the CNS or eye, a single HAB in the CNS or retina plus a visceral manifestation (multiple renal, pancreatic or hepatic cysts, pheochromocytoma and RCC) and positive family history plus any one of the above manifestations.

CasePresentingHPOs: HP:0002666; HP:0010797 (Pheochromocytoma, Hemangioblastoma)

CaseHPOFreeText: Multiple or bilateral pheochromocytoma. CNS hemangioblastoma. Diagnosed with VHL Type 2A.

CaseNotHPOs: HP:0005584; HP:0009711 (Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 16142346; “Kim, J. W., Choi, S. J., Kim, Y. K., Ahn, S. M., Song, K. E., Jung, S. H. et al. A case report of von Hippel–Lindau disease manifested in a monozygous twin. J. Korean Soc. Endocrinol. 20, 395–400 (2005)” (Reference 15 in current publication).

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 33

DiseaseAssertion: VHL

GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A

GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.

GroupPresentingHPOs: HP:0005584; HP:0000107; HP:0009711; HP:0010797; HP:0009713; HP:0030424 (Renal cell carcinoma, Renal cyst, Retinal capillary hemangioma, Hemangioblastoma, Spinal hemangioblastoma, Epididymal cyst)

GroupHPOFreeText: # of affected individuals: Renal cell carcinoma (1), Renal cyst (3), Retinal capillary hemangioma (3), Hemangioblastoma/brain/cerebellum (4), Spinal hemangioblastoma (1), Epididymal cyst (1)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplemental Table 2, Table 1, Table 3

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

GroupID: 17

DiseaseAssertion: VHL

GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A

GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.

GroupPresentingHPOs: HP:0005584; HP:0009711; HP:0009713; HP:0030393; HP:0001737 (Renal cell carcinoma, Retinal capillary hemangioma, Spinal hemangioblastoma, Endolymphatic sac tumor, Pancreatic cysts)

GroupHPOFreeText: # of affected individuals: Renal cell carcinoma (1), Retinal capillary hemangioma (1), Spinal hemangioblastoma (1), Endolymphatic sac tumor (1), Pancreatic cysts (1)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplemental Table 2, Table 1, Table 3

Variant: Exon 2 Deletion (c.341-?-463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2 Deletion

MultipleGeneVariants: N/A

GroupID: 21

DiseaseAssertion: VHL

GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A

GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.

GroupPresentingHPOs: HP:0005584; HP:0002666; HP:0009711; HP:0010797; HP:0009713; HP:0001737; HP:0030424 (Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma, Hemangioblastoma, Spinal hemangioblastoma, Pancreatic cysts, Epididymal cyst)

GroupHPOFreeText: # of affected individuals: Renal cell carcinoma (1), Pheochromocytoma (1), Retinal capillary hemangioma (1), Hemangioblastoma/brain/cerebellum (1), Spinal hemangioblastoma (1), Pancreatic cysts (1), Epididymal cyst (1)

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplemental Table 2, Table 1, Table 3

Variant: Exon 2-3 Deletion (c.341-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: VHL_6 (tumor ID)

KindredID: 6

Case: F, 31Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (Adrenal pheochromocytoma)

CaseHPOFreeText: The patient had a benign adrenal pheochromocytoma at 31Y.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q164R (c.491A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2238, https://www.ncbi.nlm.nih.gov/clinvar/variation/2238/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Q164R (c.491A>G)

MultipleGeneVariants: N/A

PatientID: VHL_11 (tumour ID)

KindredID: 11

Case: F, 47Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal Pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (Adrenal pheochromocytoma)

CaseHPOFreeText: The patient had a benign adrenal pheochromocytoma at age 47.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500 G >A)

MultipleGeneVariants: N/A

Two groups were analyzed for germline VHL mutation where Group 1 (84 individuals) presented with only one hemangioblastoma and no other clinical VHL features and those in Group 2 (4 individuals) presented with multiple hemangioblastomas and no other VHL clinical features. Peripheral blood analysis was conducted of all exons and flanking regions (90 nucleotides upstream and 45 downstream) of the VHL gene (numbered using Genbank accession number L15409). Southern blot, PCR and SSCP were performed. The c.241C>T (P81S) mutation - referred to in the paper by c.454C>T due to a difference in transcript sequence - was found in 1 patient (D24) from Group 1. She was 47 years of age and had four clinically unaffected first and second degree relatives (father (77Y0M), son (17Y0M), step-sister (43Y0M) and paternal aunt (64Y0M)) carrying this mutation. She presented with a solitary cerebellar hemangioblastoma. All other members were asymptomatic.

A cohort of 64 pheochromocytoma and paragangliomas were screened for a BRAF mutation using direct Sanger sequencing and QRT-PCR. Genomic DNA was extracted from fresh or frozen peripheral blood. Germline mutations of VHL, SDHB, SDHD, and RET genes were also observed. The VHL mutation c.602T>C (p.L201P) was reported in patient #3, a 12Y female with bilateral pheochromocytoma. No family history was reported here.

ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3

GenotypingMethod: Sanger sequencing

SamplingMethod: genomic DNA extracted from fresh or frozen peripheral blood