Figure 3
NonPatientCell UBERON:0005424, "ARPE19 cells"
GOterm GO:0042802
GeneAlteration HD-Ad-F3iT494M was constructed by introducing the HA-tagged PRPF3 coding sequence carrying T493M mutation, under control of the Ubiquitin C promoter and followed by the bovine growth hormone poly(A) signal, into HD-Ad-F3i.
FunctionalEvidence T494M phosphorylates less readily than WT
FAVariants NM_004698.3(PRPF3):c.1481C>T (p.Thr494Met), 3352
Fig. 1
Case# Wang II:3, male, Chinese
CasePresentingHPOs HP:0007675, HP:0001123, HP:0000543, HP:0000572, HP:0007737, HP:0031609, HP:0008043
CaseMethod1 PCR
CaseGenotypingMethod genes related to opthalmological diseases
Variant NM_000087.3(CNGA1):c.265delC (p.Leu89Phefs) and novel "p.Y82X"
ClinVar (1st) 225315 link
CAID (2nd) CA356834547 link
gnomAD 0.001378 link
7
Case7: Male, 13 yrs report
CasePresentingHPOs: HP:0001288, HP:0003701, HP:0009053, HP:0000765, HP:0002650, HP:0001250, HP:0006466, HP:0003798, HP:0003803 (Abnormal gait, Proximal limb weakness, Distal lower limb muscle weakness, Abnormality of the chest, Scoliosis, Epilepsy, Ankle contracture, Nemaline bodies, Type 1 muscle fiber predominance)
HPOsFreeText: Jaw contracture
CaseNotHPOs: HP:0001627 (Cardiac abnormality)
NotHPOsFreeText: N/A
CaseAddInfo: Parental testing not performed
CasePreviousTesting: ACTA1 was sequenced and returned negative.
CaseGenotypingMethod: The TPM2 gene was sequenced and variants identified. No other information is provided.
Variant: NM_003289.3:c.14_16delAGA (p.Lys7del)
ClinVar: 140486 https://www.ncbi.nlm.nih.gov/clinvar/variation/140486/
gnomAD: Not in gnomAD
The second family is of Kenyan and Tanzanian origin and has two affected siblings
FamilyName: Family 2
FamilyPresentingHPOS: HP:0002497, HP:0003429
FamilyNotHPOs:
CountryOrigin: Kenya and Tanzania
Ethnicity: n/a
Race: n/a
FamilyPreviousTesting: MRI showed brain hypomyelination
FamilyGenotypingMethod: combination of homozygosity mapping and WES, haplotype analysis
Affected: 2
Unaffected:
Segregations:
PublishedLOD:
eLOD:
AddSegregationInfo:
ProbandLabel: III-2 (individual 4), Female, 44yo, dx at 1yo
Variant: NM_177400.2(NKX6-2):c.121A>T (p.Lys41Ter)
ClinVar: 430622, https://www.ncbi.nlm.nih.gov/clinvar/variation/430622/
gnomAD: n/a
CasePresentingHPOs: HP:0000639, HP:0002066, HP:0002061, HP:0001272, HP:0007366, HP:0002540, HP:0000473, HP:0002451, HP:0002599, HP:0000571, HP:0000666, HP:0000496, HP:0002078, HP:0002070, HP:0008969, HP:0001348
CasePresentingHPOTerm: nystagmus, gait ataxia, lower limb spasticity, cerebellar atrophy, brainstem atrophy, inability to walk, cervical dystonia, lower limb dystonia, head titubation, hypometric saccades, horizontal nystagmus, limited eye movements, truncal ataxia, limb ataxia, lower limb stiffness
CaseNotHPOs: HP:0011730
AddCaseInfo: Cousin with identical phenotype died due to tuberculosis in childhood. (Individual 5)
VariantEvidence:
On the basis of sequence similarity and in-silico modeling, the p.Leu163Val mutation is predicted to lie within the first helix and to be protein destabilizing (DUET7 ΔΔG score: 1.418Kcal/mol). On the basis of amino acid conservation between homeodomains, the leucine residue is predicted to be highly conserved.
Family 3
Variant, (NM_177400.2; c.487C>G; p.Leu163Val), replaces conserved leucine within the first helix of the homeodomain, therefore destabilizing the protein.
only
Case3: Male, 8 yrs onset, Australia
CasePresentingHPOs: HP:0009046, HP:0003701, HP:0003722, HP:0001488, HP:0002938, HP:0010628, HP:0030877, HP:0003803, HP:0003755 (Difficulty running, Proximal muscle weakness, Neck flexor weakness, Bilateral ptosis, Lumbar hyperlordosis, Facial palsy, Obstructive deficit on pulmonary function testing, Type 1 muscle fiber predominance, Type 1 fibers relatively smaller than type 2 fibers)
HPOsFreeText: Type 2B fibers absent
CaseNotHPOs: HP:0003798, HP:0030177, HP:0003391 (Nemaline bodies, Abnormal nerve conduction study, Gowers sign)
NotHPOsFreeText: N/A
CaseAddInfo: Variant is likely de novo, but there is no parental testing to confirm
CasePreviousTesting: Patients were diagnosed with CFTD via clinical notes and muscle biopsies at pathology centers throughout Australia and several international centers.
CaseGenotypingMethod: Two methods were used for genotyping. In 16 patients, the 10 exons spliced onto the muscle-specific isoform of TPM3 were bidirectionally sequenced from genomic DNA. For the other 7 patients, complementary DNA was generated from patient muscle and isoform-specific primers were used to sequence the transcript. Paternity was confirmed in isolated patients using microsatellite markers.
Variant: NM_152263.4(TPM3):c.502C>G (p.Arg168Gly)
ClinVar: 12453 https://www.ncbi.nlm.nih.gov/clinvar/variation/12453/
gnomAD: Not in gnomAD
II:6
Case# Xin II:6, Female, 42, Chinese
CasePresentingHPOs HP:0007663, HP:0007675, HP:0001133
CaseMethod1 Sanger Sequencing
CaseGenotypingMethod NGS
Variant NM_000087.3(CNGA1):c.265delC (p.Leu89Phefs), NM_000087.3(CNGA1)c.1537G>A(p.G513R)
ClinVar 225315(1st)
CAID CA2911062(2nd)
VariantEvidence p. G513R protein localized to cytoplasm instead of plasma membrane like wildtype (fig. 3)
one surviving affected sibling (II-4)
Case# Li-AP:II-4, F, 19 report
CasePresentingHPOs HP:0002066, HP:0000639, HP:0001903, HP:0005528, HP:0001251, HP:0001260,
HPO free text: "A bone marrow biopsy at age 14 showed hypocellularity with normal karyotype. A marrow sample obtained at age 17 failed to yield mitotic cells for cytogenetic analyses, both on direct preparation and after culture for up to 48 hr. At age 54 years, she has developed moderately severe ataxia and requires a walker to ambulate. Her mental status is normal and she has mild horizontal and vertical nystagmus, dysarthria, dysmetria, bilateral Babinski responses, and mild decreased appreciation of vibration in her toes. Brain MRI at the age of 52 years showed severe diffuse cerebellar atrophy as well as diffuse bilateral white matter signals throughout the cerebrum."
CasePreviousTesting Clinical genetic testing ruled out abnormalities in an extensive panel of dominant cerebellar ataxia genes.
CaseMethod1 Sanger
CaseGenotypingMethod Targeted Sanger sequencing of the single large coding exon of SAMD9L
Variant NM_152703.4(SAMD9L):c.3587G>C (p.Cys1196Ser)
ClinVar 242373
CasePMIDs 6947857(1981)
DNA from individual II-4 and DNA from cultured fibroblasts from her father (I-1), mother (I-2), and one affected brother (II-5). A heterozygous missense mutation (c.3587G>C, p.Cys1196Ser) was identified in all three affected individuals but not in the unaffected mother
Family#PresentingHPOs HP:0001251, HP:0001272
FamilyNotHPOs HP:0001903, HP:0004808, HP:0001876, HP:0005528
Family#PreviousTesting Studied blastogenic responses to pokeweed mitogen, phytohemagglutinin, and concanav~lin A and rate of unscheduled DNA synthesis in fibroblasts which were normal. II-5 karyotyping showed he had C-monosomy 7.
Family#Method1 Sanger Sequencing
Family#GenotypingMethod Targeted Sanger sequencing of the single large coding exon of SAMD9L
Affected 3
Unaffected 1
Segregations 2*
AddSegregationInfo
ProbandLabel Li-AP:II-4, F, 19 report
Variant NM_152703.4(SAMD9L):c.3587G>C (p.Cys1196Ser)
ClinVar 242373
FamilyAddInfo Italian Mother(asymptomatic), Polish Father and 3 brothers had cerebellar ataxia/atrophy. 2 brothers died with acute mylogenous leukemia, other died with pancytopenia and hypoplastic bone marrow
FamilyPMIDs 6947857
Case#: Consequence 27 Table 1 in Data Supplement (1 cases)
DiseaseAssertion: HCM
FamilyInfo: N/A
CasePresentingHPOs: N/A
CaseHPOFreeText: Cardiac magnetic resonance imaging, BSA, NYHA functional class, obstructive HCM, atrial fibrillation, coronary artery disease, NSVT, Syncope, SCD family hitory, wall thickness
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: Additional oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing for MYBPC3, TMP1, TNNC1, TNNI2, TNNI3, TNNT2, ACTC1, MYL3
CaseGenotypingMethod: oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing
Variant: NM_000257.4(MYH7):c.2609G>A (p.Arg870His)
ClinVar: 14120 https://www.ncbi.nlm.nih.gov/clinvar/variation/14120/
CAID: n/a
gnomAD: 0.00001549 European (non-Finnish) https://gnomad.broadinstitute.org/variant/14-23894048-C-T
Case#: Consequence 19 Table 1 in Data Supplement (2 cases)
DiseaseAssertion: HCM
FamilyInfo: N/A
CasePresentingHPOs: N/A
CaseHPOFreeText: Cardiac magnetic resonance imaging, BSA, NYHA functional class, obstructive HCM, atrial fibrillation, coronary artery disease, NSVT, Syncope, SCD family hitory, wall thickness
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: Additional oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing for MYBPC3, TMP1, TNNC1, TNNI2, TNNI3, TNNT2, ACTC1, MYL3
CaseGenotypingMethod: oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing
Variant: NM_000257.4(MYH7):c.1491G>T (p.Glu497Asp)
ClinVar: 14124 https://www.ncbi.nlm.nih.gov/clinvar/variation/14124/
CAID: n/a
gnomAD: 0.0001984 Ashkenazi Jewish https://gnomad.broadinstitute.org/variant/14-23897796-C-A
Case#: Consequence 15 Table 1 in Data Supplement (1 cases)
DiseaseAssertion: HCM
FamilyInfo: N/A
CasePresentingHPOs: N/A
CaseHPOFreeText: Cardiac magnetic resonance imaging, BSA, NYHA functional class, obstructive HCM, atrial fibrillation, coronary artery disease, NSVT, Syncope, SCD family hitory, wall thickness
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: Additional oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing for MYBPC3, TMP1, TNNC1, TNNI2, TNNI3, TNNT2, ACTC1, MYL3
CaseGenotypingMethod: oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing
Variant: NM_000257.4(MYH7):c.2167C>T (p.Arg723Cys)
ClinVar: 14095 https://www.ncbi.nlm.nih.gov/clinvar/variation/14095/
CAID: n/a
gnomAD: 0.00003266 South Asian https://gnomad.broadinstitute.org/variant/14-23895023-G-A
Case#: Consequence 10 Table 1 in Data Supplement (2 cases)
DiseaseAssertion: HCM
FamilyInfo: N/A
CasePresentingHPOs: N/A
CaseHPOFreeText: Cardiac magnetic resonance imaging, BSA, NYHA functional class, obstructive HCM, atrial fibrillation, coronary artery disease, NSVT, Syncope, SCD family hitory, wall thickness
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: Additional oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing for MYBPC3, TMP1, TNNC1, TNNI2, TNNI3, TNNT2, ACTC1, MYL3
CaseGenotypingMethod: oligonucleotide hybridization–based DNA sequencing and dideoxy-based DNA sequencing
Variant: NM_000257.4(MYH7):c.1816G>A (p.Val606Met)
ClinVar: 14091 https://www.ncbi.nlm.nih.gov/clinvar/variation/14091/
CAID: n/a
gnomAD: 0.00001548 European (non-Finnish) https://gnomad.broadinstitute.org/variant/14-23896866-C-T
CaseMYH7-8: N/A
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.
Variant: NM_000257.3:c.427C>T (p.Arg143Trp)
ClinVar: 164401 https://www.ncbi.nlm.nih.gov/clinvar/variation/164401/
gnomAD: East Asian 1.087e-4, Overall 2.784e-5 https://gnomad.broadinstitute.org/variant/14-23901923-G-A
CaseMYH7-16: N/A
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.
Variant: NM_000257.3:c.2681A>G (p.Glu894Gly)
ClinVar: 42922 https://www.ncbi.nlm.nih.gov/clinvar/variation/42922/
gnomAD: Not in gnomAD
CaseMYH7-22: N/A
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.
Variant: NM_000257.3:c.2788G>A (p.Glu930Lys)
ClinVar: 42933 https://www.ncbi.nlm.nih.gov/clinvar/variation/42933/
gnomAD: Not in gnomAD
CaseMYH7-26: N/A
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.
Variant: NM_000257.3:c.2609G>A (p.Arg870His)
ClinVar: 14120 https://www.ncbi.nlm.nih.gov/clinvar/variation/14120/
gnomAD: European (Non-Finnish) 1.549e-5, Overall 7.072e-6 https://gnomad.broadinstitute.org/variant/14-23894048-C-T
CaseMYH7-1: N/A
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.
Variant: NM_000257.3:c.1987C>T (p.Arg663Cys)
ClinVar: 42874 https://www.ncbi.nlm.nih.gov/clinvar/variation/42874/
gnomAD: Not in gnomAD
CaseMYH7-13: N/A
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CaseGenotypingMethod: Testing for all 8 sarcomeric genes, plus GLA, LAMP2, and PRKAG2 was initiated in all probands. After the direct sequencing, the variants were filtered for pathogenicity and classified.
Variant: NM_000257.3:c.1208G>A (p.Arg403Gln)
ClinVar: 14087 https://www.ncbi.nlm.nih.gov/clinvar/variation/14087/
gnomAD: Not in gnomAD
an Italian patient
Case: Bolino Proband 1 (proband 1945), male, reported at 4yo, symptom onset at 42mo
CasePresentingHPOs: HP:0001349, HP:0003701, HP:0001284, HP:0001288, HP:0003474, HP:0003693, HP:0003722, HP:0003391, HP:0001761, HP:0003383, HP:0012447 (bilateral facial weakness, proximal muscle weakness, areflexia, abnormal gait, sensory impairment, distal limb muscle atrophy, neck flexor weakness, Gower's sign, pes cavus, onion bulb formation, abnormal myelination)
HPOsFreeText: walked at 14mo, eyes reported to be normal, gait - bilateral steppage, pes equinovarus deformity of both feet, frequent falling, had normal early motor milestones, bilateral pes cavus with retraction of Achille's tendon, intellectually normal. Laboratory testing normal: full blood count, fasting blood glucose, serum electrolytes, creatine kinase, lactic acid, urinary organic acids, serum and urine carnitine, EEG, ECG, and liver echography, segmental demyelination in 92% of fibers, redundant loops of myelin sheath irregularly arrayed near axon, muscle biopsy of rectus femoris showed atrophic and angulated fibers in clusters and large type grouping, lipid accumulation
Median nerve conduction studies: compound motor action potential = 4.6uV, distal motor latency = 7.8msec, sensory action potential = 3.3uV, motor nerve conduction velocity = 17msec, sensory nerve conduction velocity = 18msec
Peroneal nerve conduction studies: compound motor action potential = 0.21uV, distal motor latency = 7.8msec, motor nerve conduction velocity = 14
Sural nerve conduction studies: sensory action potential = no response, sensory nerve conduction velocity = no response
CountryOrigin: Italy
FamilyInfo: consanguineous family, parents reported to be normal at clinical and electrophysiological exams
PreviouslyPublished: PMID:10673338, PMID:8817346, PMID: 8628474, PMID: 8017168
GenotypingMethod: RT-PCR of RNA from patient lymphoblastoid cell line, available family members analyzed and segregation of variant with disease confirmed in pedigree - PMID:8817346 - homozygosity mapping and haplotype sharing through microsatellite and linkage analysis
Variant: NM_016156.5(MTMR2):c.1276C>T (p.Gln426Ter) homozygous
ClinVar: 6231, https://www.ncbi.nlm.nih.gov/clinvar/variation/6231/
gnomAD: 0.000007085, https://gnomad.broadinstitute.org/variant/11-95578227-G-A
Case 10
Case10 Male, Finland
CasePresentingHPOs HP:0000347, HP:0001829, HP:0010066, HP:0002101, HP:0000238, HP:0001341, HP:0007370, HP:0010664, HP:0002126, HP:0007260, HP:0030449
(Micrognathia, Foot polydactyly, Duplicated hallux, Defective lung lobation, Hydrocephalus, Olfactory lobe agenesis, Callosal agenesis, Fused thalami, Polymicrogyria,Type II lissencephaly, Therapeutic abortion)
HPOsFreeText Crown-heel body length 25cm, body weight 250g, Brain weight 35g, abnormal larynx/trachea, hydrocephalus/open-book, occipitotemporal hypoplasia, infratentorial hypoplasia, occipitoschisis/keyhole, leptomeningeal heterotopia, neuroepithelia rosettes, absent developed and identifiable mamillary bodies, absent anterior commissure, difficult to identify nucleus dentatus
CaseNotHPOs HP:0000202, HP:0001161, HP:0001627, HP:0000157, HP:0002444, HP:0007165
(Oral cleft, Hand polydactyly, Congenital heart defect, Tongue abnormality, Hypothalamic hamartoma, Periventricular neuronal heterotopia)
NotHPOsFreeText Uterus duplex, hydranencephaly/anencephaly, hypothalamic hamartoma/bulging, true alobar or semilobar holoprosencephaly, widely separated hemispheres without midline structures; only meningeal remnants cross the midline showing classical open-book appearance of HLS
CasePreviousTesting n/a
Variant NM_145014.2(HYLS1):c.632A>G (p.Asp211Gly), homozygous
ClinVar 1143
gnomAD MAF= 0.009594(European(Finnish)), no homozygotes
CaseAddInfo induced abortion at 19+5wk gestational age
CasePMIDs n/a
Subjects
Case1 female, Finland
CasePresentingHPOs HP:0000202, HP:0000347, HP:0001341, HP:0000238, HP:0002126, HP:0007165, HP:0030449
(Oral Cleft, Micrognathia, Olfactory lobe agenesis, Hydrocephalus, Polymicrogyria, Periventricular neuronal heterotopia, Therapeutic abortion)
HPOsFreeText crown-heel length: 8cm, weight: 9g, hydrocephalus/open-book, occipitotemporal hypoplasia, infratentorial hypoplasia, occipitoschisis/keyhole, neuroepithelial rosettes, absent developed and identifiable mamillary bodies, absent anterior commissure, difficult to identify nucleus dentatus
CaseNotHPOs HP:0001161, HP:0001829, HP:0001627, HP:0000157, HP:0002101, HP:0007370, HP:0010664, HP:0002444, HP:0007260
(Hand polydactyly, Foot polydactyly, Congenital heart defect, Tongue abnormality, Defective lung lobation, Callosal agenesis, Fused thalami, Hypothalamic hamartoma, Type II lissencephaly)
NotHPOsFreeText abnormal larynx/trachea, uterus duplex, hydranencephaly/anencephaly, hypothalamic bulging, leptomeningeal heterotopia, true alobar or semilobar holoprosencephaly
CasePreviousTesting n/a
Variant NM_145014.2(HYLS1):c.632A>G (p.Asp211Gly), homozygous
ClinVar 1143
gnomAD MAF= 0.009594(European(Finnish)), no homozygotes
CaseAddInfo induced abortion at 12+1wk gestational age
CasePMIDs n/a
2 Clinical presentationThe patient was a 4 yr-old boy referred to Myelin Disorders Clinic at Children's Medical Center, Tehran, Iran in 2017 due to macrocephaly and abnormal facies. He was the second child born to a consanguineous marriage. He was born after a full-term, uneventful pregnancy with a birth weight, length and head circumference (HC) of 4200 g, 47 cm and 39 cm, respectively. Within the first months of life, macrocephaly and puffy eyelids were noted, but motor, cognitive and speech developmental milestones were compatible with chronological age at age one yr-old. HC at age of 1 year was 49 cm (>+2 Z-score). By the age of 2 yr, he developed umbilical hernia, which later underwent surgical operation, but it was not completely disappeared, so that it was visible at the time of our examination at 4 yr old in spite of previous corrective surgery. From age of 3 yr-old up to now, half a tablet per day of levothyroxine has been prescribed for him due to clinical suspicion of hypothyroidism, but review of his medical documents did not reveal abnormal thyroid function tests. By the age of 4 yr, when he referred to Myelin Disorders Clinic, his head circumference and height were 54.5 cm (>+3 Z-score) and 106 cm (>-2 Z-score), respectively ( Fig. 1 .A). Developmental milestones regarding Denver Developmental Screening Test (DDST) were normal. Neurologic examinations were normal but systemic exams showed abnormal facial characteristics including sparse eyebrows, high forehead, broad nasal bridge, epicanthic folds, downward slanted palpebral fissures, long philtrum, retro-micrognathia, full lips, coarsening appearance, gingival hyperplasia and premature teeth. Clinical examination also showed flat feet, hyperextensible skin, joints hyperlaxity and easy bruising. No symptom of ichthyosis or scoliosis were noticed. A large hypopigmented skin lesion under anterior abdominal region around umbilicus was observed ( Fig. 1 .B-E). His parents claimed that the skin lesion was the remaining of an old burn. Open full size image Fig. 1 Diagram of head circumference of index case over time is shown by black dots. Standard deviation (SD) lines with the corresponding Z-score are presented (A). Clinical features of the proband: coarse facies with downward slanted palpebral fissures, high forehead, broad nasal bridge, epicanthic folds, retro-micrognathia, Puffy droopy eyelids, full everted lips and sparse eyebrows (B), gum hypertrophy, irregular dentition long philtrum (C), flat feet (D) and umbilical hernia (E). First brain MRI of patient at age 4 years. Axial and coronal planes at the level of basal ganglia and centrum semiovale, in T2 weighted spin echo and FLAIR sequences images reveals diffuse abnormal white matter signal more pronounced at superficial subcortical and deep peritrigonal regions (F, G, H). Bilateral anterior temporal small subcortical cysts formation (I, J-black arrows) and increased perivascular spaces in posterior deep white matter are noticed clearly visible in FlAIR sequence images (K-black arrow). Sequence chromatogram showing homozygote and heterozygote state of NM_001242581.1: c.2251dup mutation in the parents and affected boy (L).For more detailed evaluations brain MRI and complementary metabolic studies using gas chromatography–mass spectrometry (GC-MS) were performed. Eventually whole exome sequencing (WES) was performed to look for a probable genetic factor involved in leukoencephalopathy and abnormal facies.
Case: Kameli Proband, male, 4yo at dx, Iran
CasePresentingHPOs: HP:0000256, HP:0000271, HP:0100540, HP:0001537, HP:0045075, HP:0000348, HP:0012811, HP:0000286, HP:0000494, HP:0000343, HP:0000308, HP:0012471, HP:0000280, HP:0000212, HP:0006288, HP:0001763, HP:0000974, HP:0005692, HP:0000978, HP:0001053, HP:0002500
CasePresentingHPOsFreeText: hypopigmented skin lesion under anterior abdominal region around umbilicus. Brain MRI revealed diffuse abnormal white matter signals high in long TR sequence more pronounced at superficial subcortical and deep peritrigonal regions at the level of basal ganglia and centrum semiovale in T2 weighted spin echo and FLAIR sequence images. In addition, bilateral anterior temporal small subcortical cysts formation and increased perivascular spaces on posterior deep white matter were noticed clearly in T2 weighted and FlAIR sequence images.
CaseNOTHPOs: HP:0001270, HP:0000750, HP:0000707, HP:0008064, HP:0002650
CaseNOTHPOSFreeText:
CasePreviousTesting:
CaseGenotypingMethod: WES, Sanger
Variant: NM_001242581.1: c.2251dup; p.(Leu751Profs*9); homozygous
ClinVarID: or CAID: 590794
gnomAD: This proband has a frameshift variant, p.Leu702fs, in exon 11/13 that is absent from gnomAD v2.1.1.
AddCaseInfo: second child born to a consanguineous marriage; parents were heterozygous carriers
PreviouslyPublished: n/a
VariantEvidence: n/a
Figure 1
FamilyLabel PcTas72
Family#PresentingHPOs HP:0012125 (Prostate cancer)
FamilyNotHPOs n/a
CountryOrigin Tasmania
Ethnicity n/a
Race n/a
Family#PreviousTesting n/a
ProbandLabel 154, male, 63yo diagnosis
Variant NM_006361.5(HOXB13):c.251G>A (p.Gly84Glu)
ClinVar 128031
gnomAD MAF=0.007574(European(Finnish)), 2 homozygotes
FamilyAddInfo Variant did not segregate with disease on 3rd branch of family. Three genotype negative males on the 3rd branch presented with prostate cancer.
FamilyPMIDs n/a
1049
Case1049: 5 yrs onset, United States, Black
CasePresentingHPOs: HP:0006785, HP:0003236 (Limb-girdle muscular dystrophy, Elevated serum creatine kinase)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: Affected brother, sister, and half-brother, Genotype confirmed in proband and affected brother only
CasePreviousTesting: Serum CK levels 8,000 - 18,000 UI/l; Genetic testing also included DMD, FKRP, DM1, DM2;
CaseGenotypingMethod: DNA was collected from peripheral blood or saliva samples. WES was performed and processed though a pipeline before aligning the reads and analyzing the candidate gene list for any variants using the various inheritance patterns. Screening was performed based on in silico predictors with a liberal threshold to filter variants before PCR amplification and Sanger sequencing confirmed the pathogenic mutations.
Variant1: NM_000231.2(SGCG):c.195+4_195+7del
ClinVar: 208611 https://www.ncbi.nlm.nih.gov/clinvar/variation/208611/
gnomAD: 0.00004009, https://gnomad.broadinstitute.org/variant/13-23778027-CAGTA-C
Variant2: NM_000231.2(SGCG):c.195+1G>C
ClinVar: 283707 https://www.ncbi.nlm.nih.gov/clinvar/variation/283707/
gnomAD: 0.0002004, https://gnomad.broadinstitute.org/variant/13-23778029-G-C
From supplemental tables S2 and S3 (authors used hg19 alignment).
MONDO: MONDO:0005144 for FALS
Case#5: Smith 2014 FALS R320H, F, 41 y.o. onset, Italy
CasePresentingHPOs: HP:0007354
CaseHPOFreeText: spinal-onset ALS with upper and lower motor neuron signs
CasePreviousTesting: All FALS were screened for known causative mutations/repeat expansions in SOD1, C9orf72, TARDBP, FUS, PFN1, UBQLN2, OPTN, VCP and ANG and removed from cohort if positive for variant.
CaseMethod1: This case identified through case-control study
CaseGenotypingMethod: Exome sequencing, confirmed with Sanger sequencing.
Variant: NM_006000.3(TUBA4A):c.959G>A (p.Arg320His)
ClinVar: 180183
gnomAD: 2-220115462-C-T; Total overall AF (non-neuro) = 0.000 ; TUBA4A_p.Arg320His_gnomAD
CaseAddInfo: This variant found in 0/13023 control samples.
From supplemental tables S2 and S3 (authors used hg19 alignment).
MONDO: MONDO:0005144 for FALS
Case#2: Smith 2014 FALS, T145P, M, 69 y.o. onset, Italy
CasePresentingHPOs: HP:0007354
CaseHPOFreeText: spinal-onset ALS with upper and lower motor neuron signs
CasePreviousTesting: All FALS were screened for known causative mutations/repeat expansions in SOD1, C9orf72, TARDBP, FUS, PFN1, UBQLN2, OPTN, VCP and ANG and removed from cohort if positive for variant.
CaseMethod1: This case identified through case-control study
CaseGenotypingMethod: Exome sequencing, confirmed with Sanger sequencing.
Variant: NM_006000.3(TUBA4A):c.433A>C (p.Thr145Pro)
ClinVar: 180187
CaseAddInfo: This variant found in 0/13023 control samples.
Patient characteristics for the 6 TIEG1-positive patients are summarized in Table
Case 3: HP:0001639, underwent myectomy and ICD, two sons with neg echos, family history - mother died at 84, NM_005655.3:c.409G>A (p. Glu137Lys), gnomAD= 8.152e-6, Euro(Nf)=1.801e-5)
KMP 18
Case#: KMP 18, female, 71 yrs, East Slovakia
DiseaseAssertion: HCM
FamilyInfo: n/a
CasePresentingHPOs: n/a
CaseHPOFreeText: symptomatic; LVEF 60%; NYHA I.-II.; ECG; echocardiography;
CaseNotHPOs: n/a
CaseNotHPOFreeText: no LVOTO; no ICD
CasePreviousTesting: Additional Sanger sequencing of exons 12, 24, 25 of MYBPC3, exon 12 NEBL, exons 12, 20, 21 of SCN5A, exon 7 of TNNI3, and exon 9 of TNNT2 gene
CaseGenotypingMethod: Sanger sequencing;
Variant: NM_000257.4(MYH7):c.2845G>A (p.Glu949Lys)
ClinVar: 14093 https://www.ncbi.nlm.nih.gov/clinvar/variation/14093/
CAID: n/a
gnomAD: absent
KMP 4
Case KMP 4: Eastern Slovakia, Female, 69yo
DiseaseAssertion: hypertrophic cardiomyopathy
FamilyInfo: no family history
CaseHPOFreeText: left ventricular ejection fraction = 60%, New York Heart Association Classification II-III
CaseNotHPOFreeText: left ventricular outflow tract obstruction
CasePreviousTesting: 12-lead ECG, echocardiography, partial testing (MYBPC3, MYH7, NEBL, SCN5A, TNNI3, TNNT2)
CaseGenotypingMethod: genomic DNA collected from peripheral blood leukocytes, Sanger sequencing
Variant: NM_000257.3(MYH7):c.2845G>A (p.Glu949Lys)
ClinVar: 14093, https://www.ncbi.nlm.nih.gov/clinvar/variation/14093/
gnomAD: n/a
KMP 16
Case KMP 16: Eastern Slovakia, Female, 60yo
DiseaseAssertion: hypertrophic cardiomyopathy
FamilyInfo: no family history
CaseHPOFreeText: left ventricular outflow tract obstruction, left ventricular ejection fraction = 39-40%, New York Heart Association Classification = I, implantable cardioverter defibrillator
CasePreviousTesting: 12-lead ECG, echocardiography, partial testing (MYBPC3, MYH7, NEBL, SCN5A, TNNI3, TNNT2)
CaseGenotypingMethod: genomic DNA collected from peripheral blood leukocytes, Sanger sequencing
Variant: NM_000257.3(MYH7):c.2845G>A (p.Glu949Lys)
ClinVar: 14093, https://www.ncbi.nlm.nih.gov/clinvar/variation/14093/
gnomAD: n/a
KMP 8
Case KMP 8: Eastern Slovakia, Female, 60yo
DiseaseAssertion: hypertrophic cardiomyopathy
FamilyInfo: no family history
CaseHPOFreeText: left ventricular outflow tract obstruction , left ventricular ejection fraction = 55-60%,
CasePreviousTesting: 12-lead ECG, echocardiography, partial testing (MYBPC3, MYH7, NEBL, SCN5A, TNNI3, TNNT2)
CaseGenotypingMethod: genomic DNA collected from peripheral blood leukocytes, Sanger sequencing
Variant: NM_000257.3(MYH7):c.2845G>A (p.Glu949Lys)
ClinVar: 14093, https://www.ncbi.nlm.nih.gov/clinvar/variation/14093/
gnomAD: n/a
MultipleGeneVariants:
(1) SCN5A Variant:
Variant: NM_198056.2(SCN5A):c.3784G>A (p.Gly1262Ser)
ClinVar: 9399, https://www.ncbi.nlm.nih.gov/clinvar/variation/9399/
gnomAD: 0.00002828, https://gnomad.broadinstitute.org/variant/3-38607956-C-T
KMP 11
Case KMP 11: Eastern Slovakia, Female, 57yo
DiseaseAssertion: hypertrophic cardiomyopathy
FamilyInfo: positive family history
CaseHPOFreeText: left ventricular ejection fraction = 60%, New York Heart Association Classification I
CaseNotHPOFreeText: left ventricular outflow tract obstruction
CasePreviousTesting: 12-lead ECG, echocardiography, partial testing (MYBPC3, MYH7, NEBL, SCN5A, TNNI3, TNNT2)
CaseGenotypingMethod: genomic DNA collected from peripheral blood leukocytes, Sanger sequencing
Variant: NM_000257.3(MYH7):c.2845G>A (p.Glu949Lys)
ClinVar: 14093, https://www.ncbi.nlm.nih.gov/clinvar/variation/14093/
gnomAD: n/a
Figure 4
RescuePatientCell CL:0000057
GeneAlteration NM_017819.3(TRMT10C):c.814A>G (p.Thr272Ala) and/or NM_017819.3(TRMT10C):c.542G>T (p.Arg181Leu)
RescuePhenotype defective oxidative phosphorylation and tRNA 5' processing affecting high energy demand tissues: HP:0001508 (Failure to thrive)
RescueMethod Fibroblasts transfected with lentiviral vector containing single copy of WT TRMT10C.
RescueEvidence Transfected patient cells had increased MRPP1 expression, restored mitochondrial translation, normalized levels of respiratory chain complexes and mt-tRNA precursors which rescues the reduced cellular oxidative phosphorylation and slowed growth. 21857155 demonstrates both the restriction of translation and reduction of the rate of oxidative phosphorylation during MRPP1 knockdown in HeLa cells (Fig 5). Those result corroborate the gap between reduced MRPP1 expression and reduction in translation of oxidative phosphorylation machinery.
RescueVariants n/a
The proband (III:4)
Case: Male, 15 yrs onset
CasePresentingHPOs: HP:0002875, HP:0001639, HP:0009073, HP:0003551, HP:0001962, HP:0004749, HP:0003758, HP:0003306, HP:0003712, HP:0003691, HP:0003184, HP:0002515, HP:0001265, HP:0003236, HP:0003458, HP:0012548, HP:0031295, HP:0006699, HP:0002375, HP:0012664, HP:0001685, HP:0032341, HP:0003557 (Exertional dyspnea, Hypertrophic cardiomyopathy, Progressive proximal muscle weakness, Difficulty climbing stairs, Palpitations, Atrial flutter, Reduced subcutaneous adipose tissue, Spinal rigidity, Skeletal muscle hypertrophy, Scapular winging, Decreased hip abduction, Waddling gait, Hyporeflexia, Elevated serum creatine kinase, EMG: myopathic abnormalities, Fatty replacement of skeletal muscle, Left atrial enlargement, Premature atrial contractions, Hypokinesia, Reduced ejection fraction, Myocardial fibrosis, Reduced forced vital capacity, Increased variability in muscle fiber diameter)
HPOsFreeText: Difficulty lifting heavy objects, Unable to get up from the floor or stand up from a chair without support
CaseNotHPOs: HP:0000822, HP:0030319, HP:0007715 (Hypertension, Weakness of facial musculature, Weak extraocular muscles)
NotHPOsFreeText: N/A
CaseAddInfo: RT-PCR analysis indicated complete absence of TRIM63 transcripts in the proband indicating NMD, with TRIM54 expression found in muscle tissue and cultured cells
CasePreviousTesting: Treated with diltiazem 200 mg daily because he did not tolerate betablockers owing to asthenia; There were single or multiple well-circumscribed non-membrane-bound subsarcolemmal deposits in the majority of type I fibres, with partial colocalization to MyHC and MuRF3; Tested for mutations in MYH7 and gene panel involved in familial HCM (genes not provided)
CaseGenotypingMethod: Sanger sequencing was performed for the proband due to similarities found in MuRF1/MuRF3 null mice, with a homozygous nonsense variant in TRIM63 and heterozygous missense variant in TRIM54 being found. To exclude any other potential disease-causing variants, WES was performed and filtered down to nine genes with only these variants encoding muscle-specific proteins.
Variant: NM_032588.3(TRIM63):c.739C>T (p.Gln247Ter)
ClinVar: 222849, https://www.ncbi.nlm.nih.gov/clinvar/variation/222849/
gnomAD: 0.008100, https://gnomad.broadinstitute.org/variant/1-26384973-G-A?dataset=gnomad_r2_1
family F08
Family#PresentingHPOs HP:0007994, HP:0007675
CountryOrigin Pakistan
Ethnicity NonHispanic/Latino
Race White
Family#PreviousTesting
Family#Method1 WES
Family#Method2 Sanger
Family#GenotypingMethod Sanger of IRD associated genes, SNP array analysis
Affected 3
Unaffected 3
Segregations 3
eLOD 1.50
ProbandLabel Maleeha 2:1, Female, White
Variant NM_000087.3(CNGA1):c.1298G>A(p.G433D)
CAID CA2911103
gnomAD 0.000008974 link
11704930 connects these cases to CASQ2
Variant NM_001232.3(CASQ2):c.919G>C (p.Asp307His)
ClinVar 17610
gnomAD 0.00003249 link
CP
Case: CP, 37 years, female
CasePresentingHPOs: HP:0003563 (reduced LDL-cholesterol level)
CasePresentingHPOsFreeText:* Plasma cholesterol and triglyceride levels for CP were below the 5th percentile; total cholesterol 2.61 (normal range 4-6.5 mmol/l), triglyceride 0.36 (normal range 0.3-1.8 mmol/l), apoB 9 (normal range 60-140 mg/dl, on Vitamin E supplement.
PresentingNotHPOs: HP:0001927 (acanthocytosis)
CaseGenotypingMethod: Genomic DNA was digested with a panel of restriction enzymes and Southern blotted. CP was heterozygous for a loss of a TaqI restriction site change which was localized to exon 25 by the hybridization pattern on Southern blot. ChP, her son, was also heterozygous. Genomic DNA in that region was amplified by the polymerase chain reaction (PCR), cloned, and sequenced.
Variant: NM_000384.3(APOB):c.3997C>T (p.Arg1333Ter), heterozygous
ClinVar: 17883
gnomAD: Not in gnomAD
CaseAddInfo: Patient is the mother of ChP who is under investigation for fat malabsorption. ChP is heterozygous for the variant c.3997C>T (p.Arg1333Ter). No abnormal i.e. truncated apoB was detected on Western blot of protein from VLDL/chylomicron, LDL, HDL or infranate fractions for CP.
IVS1+1G>A Splice Germline mutation
PatientID: 37
KindredID: 37
Case: Age, sex, ethnicity unknown
DiseaseAssertion: hemangioblastoma
FamilyInfo: N/A
CasePresentingHPOs: HP:0010797 (hemangioblastoma)
CaseHPOFreeText: N/A
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: c.340+1G>A
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: 223190 https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: splice_site_variant
CivicName: Splice Site (c.340+1G>A)
MultipleGeneVariants: N/A
in seven of the asymptomatic family members.
PatientID: II-7
KindredID: 1
Case: M, Age Unknown, Turkish
DiseaseAssertion: asymptomatic
FamilyInfo: 17 family members from three generations were examined with the c.445G>T mutation and diagnosed with VHL type 2B. 11 individuals had clinical manifestations and 6 were asymptomatic carriers. One additional member (II-9) had passed before testing however were likely a carrier of the mutation. This patient’s 3 siblings had the mutation, one of her children, and more. See Fig. 1 for full family pedigree.
CasePresentingHPOs: N/A
CaseHPOFreeText: None - described as a carrier of the p.A149S mutation, with no clinical manifestations. Their asymptomatic work up could have been due to the individual's young age
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.A149S (c.445G>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 127829 https://www.ncbi.nlm.nih.gov/clinvar/variation/127829/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transversion
CivicName: A149S (c.445G>T)
MultipleGeneVariants: N/A
8M–IVS2c.464-1G > T138–––38, M384
PatientID: None
KindredID: 8
Case: M, 38Y0M, Korean
DiseaseAssertion: VHL
FamilyInfo: N/A
CohortInfo: Thirteen unrelated patients with germline VHL mutations who were diagnosed with VHL disease were evaluated.
CasePresentingHPOs: HP:0006880; HP:0001737; HP:0000107; HP:0002172; HP:0001288 (Cerebellar hemangioblastoma, Pancreatic cysts, Renal cyst, Postural instability, Gait disturbance)
CaseHPOFreeText: At 38Y, this patient showed mild imbalance with gait difficulty. MRI of the brain revealed a cystic mass in the cerebellum, which was pathologically found to be hemangioblastoma. When this patient underwent CT, which included the pancreas and kidney, multiple pancreatic cysts and renal cysts were found. Diagnosed with VHL Type 1.
CaseNotHPOs: HP:0002666; HP:0009711; HP:0005584 (Pheochromocytoma, Retinal capillary hemangioma, Renal cell carcinoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: c.464-1G>T
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 223221, https://www.ncbi.nlm.nih.gov/clinvar/variation/223221/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: splice_site_variant; missense_variant;transversion
CivicName: Splice Site (c.464-1G>T)
MultipleGeneVariants: N/A
ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3
GenotypingMethod: N/A
SamplingMethod: N/A
mother were heterozygote carriers of a deletion of exon 1-3
PatientID: N/A (Mother)
KindredID: 1
Case: Sex Unknown, Age Unknown, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Patient’s three children carried the same deletion.
CasePresentingHPOs: N/A
CaseHPOFreeText: No phenotypic information was provided.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: Exon 1-3 Deletion
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: deletion
CivicName: Exon 1-3 Deletion
MultipleGeneVariants: N/A
We describe five families for which direct sequencing of the coding region of the VHL gene had failed to identify the family-specific mutation. Further molecular analysis revealed deletions involving the VHL gene in each of these families.
ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3
GenotypingMethod: Exons 1, 2, and 3 of the VHL gene and their immediately flanking sequences were amplified by PCR, by using oligonucleotides. The flanking sequences included 90 nucleotides upstream of the second start codon in exon 1 and 45 nucleotides downstream of the stop codon in exon 3. Amplification products were purified and subjected to automated sequence analysis on an ABI 377. The amplification primers were used as primers in the sequencing reactions. Screening for structural rearrangements, including gross deletions, was performed by Southern blot analysis. FISH analysis demonstrated the deletion of the entire VHL gene.
SamplingMethod: peripheral blood
2 (100)
GroupID: 13
DiseaseAssertion: VHL
GroupSize: 2
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: N/A
GroupAgeRange: N/A
GroupInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.
GroupPresentingHPOs: HP:0009711 (retinal capillary hemangioma)
GroupHPOFreeText: These 2 patients with a R161* (c.481C>T) mutation had retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R161* (c.481C>T)
LegacyVariant: N/A
GroupProblemVariantFreeText: N/A
ClinVarID: 2217, https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: stop_gained
CivicName: R161* (c.481C>T)
MultipleGeneVariants: N/A
VHL (n = 10)
PatientID: N/A
KindredID: 10
Case: M, 23Y0M, Ethnicity Unknown
DiseaseAssertion: pheochromocytoma and paraganglioma
FamilyInfo: No family information provided.
CasePresentingHPOs: HP:0002666; HP:0002668 (pheochromocytoma; paraganglioma)
CaseHPOFreeText: Patient is a white 23Y0M male diagnosed with either pheochromocytoma and paraganglioma.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: See table s3 for patient-related information.
Variant: p.Y98H (c.292T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/
CAID: N/A
gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: Y98H (c.292T>C)
MultipleGeneVariants: N/A
PatientID: 128 (Second cousin)
KindredID: 18
Case: M, 52Y0M, Ethnicity Unknown
DiseaseAssertion: Assumed VHL
FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.
CasePresentingHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)
CaseHPOFreeText: This patient presented with pheochromocytoma (11Y). Age of diagnosis for retinal angioma is unknown.
CaseNotHPOs: HP:0005584; HP:0000077; HP:0001732; HP:0010797 (Renal cell carcinoma, Abnormality of the kidney, Abnormality of the pancreas, Hemangioblastoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)
SupplementalData: Supplementary Table 1.
Variant: N/A
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: Authors state that the c.712C>T germline familial variant of the VHL gene in this patient is “inferred from the family”. No genetic testing was done on this patient to confirm this. Being that this familial variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).
MutationType: N/A
CivicName: N/A
MultipleGeneVariants: N/A
PatientID: 193
KindredID: 193
Case: Sex Unknown, 27Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Positive family history but no details provided.
CasePresentingHPOs: HP:0010797; HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)
CaseHPOFreeText: CNS and retinal hemangioblastoma.
CaseNotHPOs: HP:0002666; HP:0006770; HP:0000107; HP:0001732 (Pheochromocytoma, Clear cell renal cell carcinoma, Renal cyst, Abnormality of the pancreas)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished:N/A
SupplementalData: Table S1, S2 and S3
Variant: Partial Deletion (7.5kb)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: deletion
CivicName: Partial deletion of 7.5kb
MultipleGeneVariants: N/A
PatientID: 207
KindredID: 207
Case: Sex Unknown, 30Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Family history noted but details not specified.
CasePresentingHPOs: HP:0010797 (Hemangioblastoma)
CaseHPOFreeText: CNS hemangioblastoma.
CaseNotHPOs: HP:0001732; HP:0002666; HP:0009711; HP:0006770; HP:0000107 (Abnormality of the pancreas, Pheochromocytoma, Retinal capillary hemangioma, Clear cell renal cell carcinoma, Renal cyst)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Table S1, S2 and S3
Variant: p.F136S (c.407T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 496064, https://www.ncbi.nlm.nih.gov/clinvar/variation/496064/
CAID: N/A
gnomAD: 0.000003976, https://gnomad.broadinstitute.org/variant/3-10188264-T-C?dataset=gnomad_r2_1
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: F136S (c.407T>C)
MultipleGeneVariants: N/A
24Exon 3 deletion (8.5 kb abnormal band on QSA)*
GroupID/ KindredID: 24
DiseaseAssertion: VHL
GroupSize: 2
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: Polish
GroupAgeRange: N/A
GroupInfo: Familial VHL stated; 2 family members recorded with this deletion.
GroupPresentingHPOs: HP:0010797; HP:0009711; HP:0005584 (hemangioblastoma; retinal capillary hemangioma; renal cell carcinoma)
GroupHPOFreeText: Both (2) patients had hemangioblastomas, and RCC, and 1 had retinal capillary hemangioma
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: Exon 3 deletion
CaseProblemVariantFreeText: Patients were both found with an Exon 3 deletion (and 8.5 kb abnormal band on QSA)
LegacyVariant: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 3 Deletion
MultipleGeneVariants: N/A
Exon 1deletion
GroupID/ KindredID: 19 / S 1
DiseaseAssertion: VHL
GroupSize: 2
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: Polish
GroupAgeRange: N/A
GroupInfo: Familial VHL stated; 2 family members recorded with this deletion.
GroupPresentingHPOs: HP:0010797; HP:0009711; HP:0005584 (hemangioblastoma; retinal capillary hemangioma; renal cell carcinoma)
GroupHPOFreeText: Both (2) patients had RCC, 1 had hemangioblastomas and 1 had retinal capillary hemangioma. These phenotypes couldn’t be paired as it was not clear.
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: Exon 1 deletion
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 1 Deletion
MultipleGeneVariants: N/A
II3(Cb01)−++−+
PatientID: II3(Cb01)
KindredID: C
Case: F, 34Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Patient’s father (I-2) presented with hemangioblastoma and possessed the same exon 2 deletion. The patient’s two siblings also possessed the deletion. The sister (II-1) had hemangioblastoma, while the other sibling (II-5) had hemangioblastoma, pancreatic cyst, and clear cell renal carcinoma. The patient and her two siblings each had a child and all possessed the same deletion, but did not exhibit phenotypes (Please see Figure 1. Family C matches with Pedigree B).
CasePresentingHPOs: HP:0009919; HP:0002666; HP:0001737 (Retinoblastoma; Pheochromocytoma; Pancreatic cysts)
CaseHPOFreeText: Patient presented with Retinoblastoma, pheochromocytoma, and pancreatic cystic disease.
CaseNotHPOs: HP:0006770; HP:0010797 (Clear cell renal cell carcinoma; hemangioblastoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: Exon 2 Deletion
LegacyVariant: N/A
CaseProblemVariantFreeText: large fragment deletion in exon 2
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: Variant reported as GRCh37 chr3:10188300ATATCACACTGCCA>T in paper
MutationType: minus_2_frameshift_variant; deletion
CivicName: Exon 2 (deletion)
MultipleGeneVariants: N/A
Genomic DNA was extracted using standard procedures. All VHL coding regions were analyzed by Sanger sequencing. PCR products were sequenced in an automated ABI Prism 3700 sequencer (Thermo Fisher Scientific, Waltham, MA). The following oligonucleotides were used: exons 1, forward 5′-CTAGCCTCGCCTCCGTTAC-3′ and reverse 5′-GTCACCCTGGATGTGTCCTG-3′; exon 2, forward 5′-TTAGCCAGGACGGTCTTGAT-3′ and reverse 5′- CGTACAAATACATCACTTCCATT -3′; and exon 3, forward 5′-TACTACAGAGGCATGAACACC-3′ and reverse 5′- CCCCTAAACATCACAATGC -3′.In the patients with clinical VHL diagnosis but without pathogenic coding variants detected by Sanger, multiplex ligation-dependent probe amplification (MLPA) was performed to investigate large deletions. MLPA was performed as previously described using the SALSA® MLPA® P016 VHL probe mix (MRC-Holland, Amsterdam, Netherlands) [14]. This probe mix contains 29 probes with amplification products between 166 and 427 nucleotides: nine probes for the VHL gene (two or more probes for each exon); six probes for genes located close to VHL (FANCD2, BRK1/C3orf10/HSPC300, IRAK2, and GHRL); and 12 reference probes detecting sequences on other chromosomes. PCR product underwent capillary electrophoresis on an ABI Prism 310 Genetic Analyzer (Thermo Fisher Scientific). Data analysis was performed with Genescan 3.7 (Thermo Fisher Scientific). Dosage quotient areas outside the range of 0.70 to 1.3 were considered abnormal.
ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3
GenotypingMethod: Sanger sequencing and PCR
SamplingMethod: N/A
detected point germline vhl mutations in 14 patients
PatientID: 23
KindredID: 23
Case: 23Y0M, sex unknown, ethnicity unknown
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: HP:0010797; HP:0030393; HP:0005584; HP:0009711 (hemangioblastoma; endolymphatic sac tumor; renal cell carcinoma; retinal capillary hemangioma)
CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.N78I (c.233A>T)
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: 223169 https://www.ncbi.nlm.nih.gov/clinvar/variation/223169/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant; transversion
CivicName: N78I (c.233A>T)
MultipleGeneVariants: N/A
complete vhl gene deletion in 2 patients
PatientID: 24
KindredID: 24
Case: 17Y0M, sex unknown, ethnicity unknown
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)
CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: Null (Complete deletion)
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: Stated in paper as “del VHL”; complete vhl gene deletion
MutationType: deletion (exon_loss_variant)
CivicName: DELETION
MultipleGeneVariants: N/A
Genetic Tests and Systemic Screening All patients had genetic test for VHL gene mutations performed by sequencing long polymerase chain reaction and multiplex ligation-dependent probe amplification technique as described by the authors previously.9 Standard surveillance program for other systemic lesions was also applied in the group according to the recommendations of Polish VHL Registry that included full blood count, metanephrines for paraganglioma and pheochromocytoma detection, neurologic examination, and imaging studies: CNS magnetic resonance imaging, abdominal ultrasonography, and computed tomography.1
ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3
GenotypingMethod: PCR and multiplex ligation-dependent probe amplification (MLPA)
SamplingMethod: assumed: peripheral blood leucocytes (from PMID: 12114495 described in paper)
Case 2 was a 7-yr-old boy, diagnosed with a malignant sympathetic paraganglioma in the retroperitoneum with regional lymph node metastases, who presented with a parasympathetic paraganglioma of the left carotid body 8 yr later. Genetic testing revealed the VHL p.Tyr98His mutation, which has also been described previously (15). In addition hemangioblastomas and pheochromocytomas were found in family members.
PatientID: 2
KindredID: 2
Case: M, 15Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Family history revealed hemangioblastomas and pheochromocytomas.
CohortInfo: Two patients with parasympathetic paraganglioma, previously published in 19336503 were studied.
CasePresentingHPOs: HP:0002668 (paraganglioma)
CaseHPOFreeText: At age 7, the patient had a malignant sympathetic paraganglioma in the retroperitoneum with regional lymph node metastases. Eight years later, the patient presented with a parasympathetic paraganglioma of the left carotid body.
CaseNotHPOs: N/A
CaseNotHPOFreeText: No other tumours were found.
CasePreviousTesting: SDHB/SDHC/SDHD
PreviouslyPublished: 19336503
SupplementalData: N/A
Variant: p.Y98H (c.292T>C)
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: 2223 https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/
CAID: N/A
gnomAD: 0.00001343 https://gnomad.broadinstitute.org/variant/3-10183823-T-C
VariantEvidence: Case 2 showed LOH for markers D3S1597 and D3S1263 and was homozygous (not informative) for marker D3S1435.
MutationType: missense_variant; transition
CivicName: Y98H (c.292T>C)
MultipleGeneVariants: N/A
c.496_506del11 (p.Val166Serfs*4) in seven individuals, belonging to two pedigrees.
PatientID: 65
KindredID: 65
Case: Sex Unknown, Age Unknown, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: HP:0010797 (hemangioblastoma)
CaseHPOFreeText: N/A
CaseNotHPOs: HP:0006770; HP:0100634; HP:0030405; HP:0009711; HP:0030421 (clear cell renal cell carcinoma; Neuroendocrine neoplasm, pancreatic neuroendocrine neoplasm, retinal capillary hemangioma, Epididymal neoplasm)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 29437867 (likely family 17 - see here for more info)
SupplementalData: Yes; see table S1 for VHL subject genetic and manifestation information.
Variant: p.V166Sfs*4 (c.496_506del11)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 223229 https://www.ncbi.nlm.nih.gov/clinvar/variation/223229/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: minus_2_frameshift_variant
CivicName: V166Sfs*4 (c.496_506del)
MultipleGeneVariants: N/A
PatientsThe Chinese family study included five-generations comprising of 38 living family members, of whom nine were affected [Figure 1]. All living members were examined clinically. The clinical and radiographic images were published with the consent of the patient. The study was approved by the research Ethics Committees of Xi’an Jiaotong University School of Medicine. Written informed consents were obtained from all participants.Open in a separate windowFigure 1Haplotypes of the Chinese family affected by Von Hippel-Lindau (VHL). The open and filled blackened symbols indicated unaffected and affected individuals, respectively. The squares and circles symbolized the males and females, respectively. The proband, IV-3, was indicated by an arrow. The haplotyping was conducted using three polymorphic microsatellite markers. The marker order was determined from the Marshfield map and the UCSC Human Genome database (February 2009). The dark boxes symbolized haplotypes that cosegregated with the affected individuals and suggested linkage of VHL to disease in this family. The boxes with slash symbolized the dead family members.
PatientID: II:4
KindredID: 1
Case: F, Age Unknown (deceased), Chinese
DiseaseAssertion: VHL
FamilyInfo: A 5-generation family with VHL in 15 members. Both second generation children (presumed), 5 third generation, and 8 further generation individuals were affected and haplotyping was conducted using three polymorphic microsatellite markers. All of the 5th generation children (9 total at time of publication) had been sequenced and haplotyped as unaffected.
CasePresentingHPOs: N/A
CaseHPOFreeText: unknown phenotype, however they were said to be affected
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R167W (c.499C>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/
CAID: N/A
gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1
VariantEvidence: Death before genetic diagnostic, however presumed by authors due to extensive family history (See pedigree).
MutationType: missense_variant;transition
CivicName: R167W (c.499C>T)
MultipleGeneVariants: N/A
1 Partial deletion Deletion of exon 1 and 2 1 0
GroupID: 1
DiseaseAssertion: VHL
Group size: 1
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: N/A
GroupAgeRange: N/A
Group Info: Retrospective analysis of a longitudinal cohort of 21 VHL germline mutation carriers and retinal haemangioblastomas. All patients were categorized in two genotypic categories: missense mutations and truncating mutations.
GroupPresentingHPOs: HP:0009711 (retinal capillary hemangioma)
GroupHPOFreeText: The patient presented with retinal capillary hemangioma.
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Table S1
Variant: Exon 1-2 deletion
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: Chr3(GRCh37): g.10182301_10188764del; c.-1231_463+444del6464
MutationType: exon_loss_deletion
CivicName: Exon 1-2 deletion
MultipleGeneVariants: N/A
VHL_2Frozenc.250G>Tp.Val84LeuM25AdrenalPCCB
PatientID: VHL_2 (tumor ID)
KindredID: 2
Case: M, 25Y0M, Ethnicity Unknown
DiseaseAssertion: Adrenal pheochromocytoma
FamilyInfo: N/A
CasePresentingHPOs: HP:0006748 (Adrenal pheochromocytoma)
CaseHPOFreeText: The patient had a benign adrenal pheochromocytoma at 25Y.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.V84L (c.250G>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2236, https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transversion
CivicName: V84L (c.250G>T)
MultipleGeneVariants: N/A
PatientID: N/A
KindredID: 198
Case: Age unknown, Sex unknown, Ethnicity unknown
DiseaseAssertion: assumed VHL
FamilyInfo: Paper states: Germline, de novo
CasePresentingHPOs: HP:0010797 (hemangioblastoma)
CaseHPOFreeText: N/A
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Yes (Specifically Supp. Table S2)
Variant: p.W117Cfs*42 (c.351del)
LegacyVariant: N/A
CaseProblemVariantFreeText: paper states c.350delG which automaps to NM_000551.3:c.351delG
ClinVarID: 223197 https://www.ncbi.nlm.nih.gov/clinvar/variation/223197/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: minus_1_frameshift_variant
CivicName: W117fs (c.351del)
MultipleGeneVariants: N/A
The patient was known to have a constitutional deletion of exon 1 of VHL confirmed by germline DNA analysis in 2004. DNA extracted from the sinonasal tumour resected in 2012 underwent molecular analysis in 2015 for loss of heterozygosity (LOH) at the VHL locus.
ArticleReferenceSequence: NM_000551.3 (Standard)
GenotypingMethod: germline DNA analysis and PCR.
SamplingMethod: tumor tissue
Of 65 VHL families from central Europe, 53 were identified with germline mutations using SSCP analysis of PCR products by peripheral blood. This mutation was found in 2 Croatian, VHL type 1 family members (family VHL 26). Both have hemangioblastomas of the central nervous system, one has renal cysts, and one with pancreatic cysts.
The authors report this as an AF010238.1:c.443insTCT mutation at codon 77 (insertion Ser). This does not match the associating c. and p. - NM_000551.3:c.230_231insTCT matches Cys77_Asn78insLeu., while c.231_232insTCT (p.Cys77_Asn78insSer) would give the ins Ser the authors write, however this doesn’t match the p.. Without confirmation from authors no assumption could be made.
8 M c.446A>C (N78T) Bilateral Positive (CNS) Positive
PatientID: 8
KindredID: 8
Case: M, Age Unknown, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: HP:0000107; HP:0005584; HP:0010797; HP:0001737 (Renal cyst, Renal cell carcinoma, Hemangioblastoma, Pancreatic cysts)
CaseHPOFreeText: Bilateral RCC and renal cysts, CNS hemangioblastoma, positive for pancreatic cysts.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Table 1
Variant: p.N78T (c.233A>C)
LegacyVariant: c.446A>C (N78T)
CaseProblemVariantFreeText: N/A
ClinVarID: 223168, https://www.ncbi.nlm.nih.gov/clinvar/variation/223168/
CAID: N/A
gnomAD: N/A
VariantEvidence: Variant is declared as “c.446A>C (N78T)” by the authors, this was treated as a legacy variant and mapped to c.233A>C, N78T. This study found coexpression of Epo and EpoR in 11 RCCs and in 10 benign renal cysts in a spectrum of VHL renal disease suggesting that Epo/EpoR coexpression is present in both benign and malignant stages of renal neoplasia. Six benign cysts stained for Epo but not EpoR. The researchers detected loss of heterozygosity of a wild-type VHL allele in different RCCs with microsatellite markers, D3S1110 and D3S2452, flanking the VHL gene
MutationType: missense_variant;transition
CivicName: N78T (c.233A>C)
MultipleGeneVariants: N/A
PatientID: 6
KindredID: 6
Case: M, 45Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: It is stated that the eight VHL patients were selected from the group of familial VHL patients. Assuming there is family history but no further details were provided. CohortInfo: Eight patients with VHL disease with pheochromocytoma, eight patients with MEN2 and pheochromocytoma, and 10 sporadic patients.
CasePresentingHPOs: HP:0009711; HP:0006748 (Retinal capillary hemangioma, Adrenal pheochromocytoma)
CaseHPOFreeText: Diagnosed with VHL type 2A. Right adrenal pheochromocytoma (41Y) and retinal angioma. No metastasis. Last follow-up 4 years after diagnosis.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: Suspected to be, but not mentioned in paper. Paper says, the eight VHL patients were selected from the group of familial VHL patients withknown VHL germline mutations followed on a clinical protocol at the Urologic Oncology Branch, National Cancer Institute, National Institutes of Health (NIH).
SupplementalData: N/A
Variant: p.Y112H (c.334T>C)
LegacyVariant: c.547T>C
CaseProblemVariantFreeText: N/A
ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/
CAID: N/A
gnomAD: N/A
VariantEvidence: Authors report variant as “547, T to C”. Assumed to be reported in legacy nomenclature (AF010238.1 (Latif et al.)) and mapped to c.334T>C (NM_000551.3).
MutationType: missense_variant;transition
CivicName: Y112H (c.334T>C)
MultipleGeneVariants: N/A
Patient 2 The second patient had a familial history of VHL disease but had never been screened for central nervous system manifestations when she experienced a sudden left hearing loss at 18 years old. The MRI revealed a left mass of the temporal bone invading the otic capsule but without extension in the cerebellopontine angle (Fig. 1) and also a cystic hemangioblastoma of the brainstem with significant mass burden but no associated symptoms. It was decided to operate on the hemangioblastoma first due to its size and location and the endolymphatic sac tumor remained under surveillance. The MTD of the endolymphatic sac tumor at diagnosis was 1.9 cm. Apart from central nervous systems hemangioblastomas, the patient developed pancreatic cysts in the course of her VHL disease. The germline mutation of the VHL gene was also identified (c.345C>G, p.His115Gln). During 18 years of surveillance, the tumor increased in size following a two-phase growth pattern alternating phases of quiescence and phases of continuous growth (Fig. 2). Apart from her left cophosis, she did not suffer from any vestibular symptoms and the rest of her neurological exam remained normal. As tumor did not develop in the cerebellopontine angle and did not threaten the brainstem, it was decided to postpone surgery and the patient remains under surveillance.
PatientID: 2
KindredID: 2
Case: F, 36Y0M, Ethnicity Unknown
DiseaseAssertion: assumed VHL
FamilyInfo: familial history of VHL disease
CasePresentingHPOs: HP:0030393; HP:0010797; HP:0001737 (endolymphatic sac tumor, hemangioblastoma, pancreatic cysts)
CaseHPOFreeText: at 18Y experienced a sudden left hearing loss (MRI revealed hemangioblastomas of the temporal bone invading the otic capsule; operated on; the MTD of the endolymphatic sac tumor at diagnosis was 1.9 cm). The patient also developed pancreatic cysts.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.H115Q (c.345C>G)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 496058 https://www.ncbi.nlm.nih.gov/clinvar/variation/496058/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant; transversion
CivicName: H115Q (c.345C>G)
MultipleGeneVariants: N/A
22a4Fc.499C>T3Missensep.Arg167Trp8P, muAsynchronous
PatientID: 22
KindredID: 4
Case: F, 8Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Four members of this family, IDs #22 (8Y, F), #23 (25Y, M), #24 (14Y, M), #25 (12Y, M), were found to have the same variant and pheochromocytoma.
CohortInfo: Thirty-one subjects were included in this study consisting of 16 SDHB mutation carriers and 15 subjects with VHL disease followed-up between 1975 and 2008. Subjects were included in the study if they had complete imaging from the base of the skull to the pelvis and measurements of urinary or plasma catecholamines. The case-notes and hospital databases were examined for the required data, which included: age at first symptom/diagnosis, family history, disease penetrance, site and size of tumor, symptoms, secretion of catecholamines, multifocal disease, metastatic disease, treatment and disease outcome.
CasePresentingHPOs: HP:0002666 (Pheochromocytoma)
CaseHPOFreeText: Asynchronous multifocal pheochromocytoma. 8Y at VHL diagnosis.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R167W (c.499C>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/
CAID: N/A
gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: R167W (c.499C>T)
MultipleGeneVariants: N/A
PatientID: 60
KindredID: 23
Case: M, 30Y0M, Chinese
DiseaseAssertion: VHL
FamilyInfo: The proband (patient 23) had three family members genetically confirmed with the mutation: his son/ patient 61 (asymptomatic at time of assessment), his daughter/ patient 62 (asymptomatic at time of assessment), and his cousin/ the son of his Aunt 3/ patient 68 (CNS hemangioblastoma at 26). The proband also had 5 family members who passed away before they could be confirmed with the mutation: his father/patient 63 (CNS hemangioblastoma at 35, retinal angioma at 35); his sister/ patient 64 (CNS hemangioblastoma at 24 and multiple pancreatic cysts/tumors at 31); his aunt 1/ patient 65 had a CNS hemangioblastoma at 35; his aunt 2/ patient 66 had a CNS hemangioblastoma at 20; and his aunt 3/ patient 67 had a CNS hemangioblastoma at 44.
CasePresentingHPOs: HP:0001732; HP:0001737 HP:0010797; HP:0009711; HP:0005584 (Abnormality of the pancreas, Pancreatic cysts, Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)
CaseHPOFreeText: The proband presented with CNS hemangioblastoma and retinal angioma at 25, renal cell carcinoma and multiple pancreatic cysts/tumors at 30.
CaseNotHPOs: HP:0002666 (Pheochromocytoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).
SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.
Variant: p.W88S (c.263G>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2220; https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/?new_evidence=true
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transversion
CivicName: W88S (c.263G>C)
MultipleGeneVariants: N/A
c.463 + 8C > T (intron 2)
PatientID: None
KindredID: 6
Case: Sex, Age, Ethnicity unknown
DiseaseAssertion: dilatation of the cerebral artery
FamilyInfo: None
CasePresentingHPOs: HP:0004944 (dilatation of the cerebral artery)
CaseHPOFreeText: Patient had an intracranial aneurysm
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: c.463+8C>T
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: 127830 https://www.ncbi.nlm.nih.gov/clinvar/variation/127830/
CAID: N/A
gnomAD: 0.0005055 https://gnomad.broadinstitute.org/variant/3-10188328-C-T
VariantEvidence: N/A
MutationType: splice_site_variant
CivicName: Splice Region (c.463+8C>T)
MultipleGeneVariants: N/A
MM 20 35 M ? ? - - ? - - Exon 3 del – a, distal b
PatientID: 20
KindredID: MM
Case: M, 35Y0M, Indian
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: HP:0001737; HP:0005584 (Pancreatic cysts, Renal cell carcinoma)
CaseHPOFreeText: RCC and multi-cystic pancreatic lesions.
CaseNotHPOs: HP:0010797; HP:0030393; HP:0009711; HP:0002666 (Hemangioblastoma, Endolymphatic sac tumor, Retinal capillary hemangioma, Pheochromocytoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: Exon 3 Deletion (c.464-?_642+?del)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 3 Deletion
MultipleGeneVariants: N/A
S3135F?? ?-- - -c.214 T[Cp.S72P
PatientID:1
KindredID: S3
Case: F, 35Y0M, Indian
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: HP:0001737, HP:0010797 (Pancreatic cysts, Hemangioblastoma)
CaseHPOFreeText: multi-cystic pancreatic lesions and CNS hemangioblastoma
CaseNotHPOs: HP:0009711, HP:0005584, HP:0002666, HP:0030393 (Retinal capillary hemangioma, renal cell carcinoma, pheochromocytoma, endolymphatic sac tumor)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.S72P (c.214T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 223163 https://www.ncbi.nlm.nih.gov/clinvar/variation/223163/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_transition
CivicName: S72P(c.214T>C)
MultipleGeneVariants: N/A
Medical files and histopathology reports of patients who had been operated on before were also reviewed.
PatientID: IV-17
KindredID: 1
Case: M, 16Y0M, Iranian
DiseaseAssertion: assumed VHL
FamilyInfo: Familial history was positive. See Fig 1. A total of 43 members of the kindred, 24 males and 19 females, aged 2-77 years were reached for evaluation. It is stated in the paper that all affected subjects (13) were positive for the same mutation (c.500G>A). Additionally, gene sequencing revealed that 4 asymptomatic members of the kindred also harbored the pathogenic mutation. Phenotypes include pheochromocytoma, hemangioblastoma, and retinal HB.
CasePresentingHPOs: HP:0002666 (Pheochromocytoma)
CaseHPOFreeText: Patient had a unilateral PCC at 14Y which was surgically removed at the time. Histopathology was benign, and there was no case of relapse or metastatic dissemination.
CaseNotHPOs: HP:0000077 (abnormality of the kidney)
CaseNotHPOFreeText: There was no case of kidney tumors among the kindred.
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R167Q (c.500G>A)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2216, https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/
CAID: N/A
gnomAD: 0.000003977, https://gnomad.broadinstitute.org/variant/3-10191507-G-A
VariantEvidence: N/A
MutationType: missense_variant; transition
CivicName: R167Q (c.500G>A)
MultipleGeneVariants: N/A
770FemaleIV# YesAAAGAGLOH (G)
PatientID: 7
KindredID: 7
Case: F, 70Y0M, Taiwanese (East-Asian)
DiseaseAssertion: renal cell carcinoma
FamilyInfo: N/A
CohortInfo: 8 of 19 patients presenting with clear cell renal cell carcinoma were found to be heterozygous for the germline variant rs1642742 in VHL (c.*294G>A). All but one of these patients (7/8) also presented with the germline variant rs779805 (c.-195G>A) in VHL.
CasePresentingHPOs: HP:0006770 (clear cell renal cell carcinoma)
CaseHPOFreeText: She had stage IV clear cell renal cell carcinoma with metastasis
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 21982469
SupplementalData: Yes - Additional file 1: Figure S1
Variant: c.*294G>A
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 342407 https://www.ncbi.nlm.nih.gov/clinvar/variation/342407/
CAID: N/A
gnomAD: 0.5911 https://gnomad.broadinstitute.org/variant/3-10191943-G-A
VariantEvidence: LOH (G) of this mutation was found in the tumor tissue as well
MutationType: 3_prime_UTR_variant
CivicName: c.-195G>A AND c.*294G>A
MultipleGeneVariants: Somatic, VHL, c.-195G>A
481C→T Ts Exon 3 161 CGA R R161X
GroupID: 43
DiseaseAssertion: VHL
GroupSize: 8
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: French
GroupAgeRange: N/A
GroupInfo: 8 patients are listed with this mutation; any relation is unknown.
GroupPresentingHPOs: HP:0009711 (retinal capillary hemangioma)
GroupHPOFreeText: 3 members are stated to have retinal HBs. Other manifestations are possible but not clear.
GroupNotHPOs: N/A
GroupNotHPOFreeText: the other 5 patients are said to not have retinal HBs
GroupPreviousTesting: N/A
PreviouslyPublished: Possibly published in PMID:15300849
SupplementalData: N/A
Variant: p.R161* (c.481C>T)
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: stop_gained
CivicName: R161* (c.481C>T)
MultipleGeneVariants: N/A
395A→C Tv Exon 2 132 CAA Q Q132P
GroupID: 31
Case: Age unknown, Sex unknown, French
DiseaseAssertion: VHL
FamilyInfo: None - one member documented here
CasePresentingHPOs: N/A
CaseHPOFreeText: other manifestations are not clearly stated.
CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: Possibly published in PMID:15300849
SupplementalData: N/A
Variant: p.Q132P (c.395A>C)
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: 496063 https://www.ncbi.nlm.nih.gov/clinvar/variation/496063/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant; transversion
CivicName: Q132P (c.395A>C)
MultipleGeneVariants: N/A
PatientID: 37
KindredID: 37
Case: M, 35Y0M, Ethnicity Unknown
DiseaseAssertion: Adrenal pheochromocytoma
FamilyInfo: N/A
CasePresentingHPOs: HP:0006748 (Adrenal pheochromocytoma)
CaseHPOFreeText: Unilateral benign adrenal pheochromocytoma that was operated on at age 26.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 32179488
SupplementalData: N/A
Variant: p.L63P (c.188T>C)
LegacyVariant: L63P (c.401T>C)
CaseProblemVariantFreeText: N/A
ClinVarID: 2227, https://www.ncbi.nlm.nih.gov/clinvar/variation/2227/
CAID: N/A
gnomAD: N/A
VariantEvidence: Variant reported as L63P (c.401T>C), legacy nomenclature (AF010238.1), and was mapped to p.Leu63Pro (c.188T>C) in accordance with reference sequence NM_000551.3.
MutationType: missense_variant;transition
CivicName: L63P (c.188T>C)
MultipleGeneVariants: N/A
2 Germany c.463+2T>C splice
GroupID: 20
DiseaseAssertion: VHL
GroupSize: 2
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: German
GroupAgeRange: N/A
GroupInfo: 2 registrants from Germany were grouped in this study via the mutation of c.463+2T>C
GroupPresentingHPOs: HP:0030393 (Endolymphatic sac tumor)
GroupHPOFreeText: N/A
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: c.463+2T>C
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVarID: 569414 https://www.ncbi.nlm.nih.gov/clinvar/variation/569414/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: splice_site_variant
CivicName: Splice Site (c.463+2T>C)
MultipleGeneVariants: N/A
GroupID: 333
DiseaseAssertion: VHL
GroupSize: 2
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: French
GroupAgeRange: N/A
GroupInfo: 2 members of this family presented with the c.500G>A germline variant of the VHL gene. Member 9428 presented with mild renal disease. Member 13001 presented with moderate renal disease (RCC). Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.
GroupPresentingHPOs: HP:0009726; HP:0005584 (Renal neoplasm, Renal cell carcinoma)
GroupHPOFreeText: Mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]). Moderate renal disease (less than five solid lesions requiring surgical treatment, either unilateral or bilateral).
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: Paper states that this family is previously reported in PMID 12202531 and/or 9829912, where 10 individuals and 3 families respectively with this mutation are reported. It is unclear if one or both of these previously reported groups are the same as the current family. These previously reported individuals/families could alternatively correspond to family 262, 36 or 509.
SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.
Variant: p.R167Q (c.500G>A)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2216, https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/
CAID: N/A
gnomAD: 0.000003977, https://gnomad.broadinstitute.org/variant/3-10191507-G-A?dataset=gnomad_r2_1
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: R167Q (c.500G>A)
MultipleGeneVariants: N/A
ArticleReferenceSequence: AF010238.1 (Legacy Variants- Latif et al.) and NM_000551.3
GenotypingMethod: PCR, SSCP and when abnormal mobility shift was observed, direct sequencing was performed. If no shift was detected or no mutation was found by sequencing, authors proceeded to Southern blotting for detection of large rearrangements.
SamplingMethod: peripheral blood
GroupID: 185
DiseaseAssertion: VHL
GroupSize: 4
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: French
GroupAgeRange: N/A
GroupInfo: 4 members of this family are reported as carrying the c.193T>C germline variant of the VHL gene. Member 9359 has unknown renal involvement. Member 9357 presented with mild renal disease. Member 1052 had no renal involvement. Member 3979 has moderate renal disease (RCC). Families were recruited from the French VHL Registry. Enrolment in the study required identification of the germline VHL mutation (currently 85% of the families included in the French VHL Registry) and available data regarding renal phenotype. A total of 126 families fulfilled these criteria.
GroupPresentingHPOs: HP:0009726; HP:0005584 (Renal neoplasm, Renal cell carcinoma)
GroupHPOFreeText: Mild renal disease (simple renal cyst, multicystic kidney[s], small lesion [less than 10 mm in size] of unknown significance, or small solid tumor without indication for surgical removal [less than 30 mm in size]). Moderate renal disease (less than five solid lesions requiring surgical treatment, either unilateral or bilateral).
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: Paper states that this family is previously reported in PMID 12202531, where 2 patients with this mutation are reported but relation between patients is unknown.
SupplementalData: Phenotype and genotype information can be found in Supplementary Table S1.
Variant: p.S65P (c.193T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 547829, https://www.ncbi.nlm.nih.gov/clinvar/variation/547829/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: S65P (c.193T>C)
MultipleGeneVariants: N/A
515MEx1–2-3del complete VHL--1 peripheral-No changes-
PatientID: 5
KindredID: 5
Case: M, 15Y0M, Spanish
DiseaseAssertion: VHL
FamilyInfo: N/A
CohortInfo: 7 VHL patients, from different regions of Spain, affected from juxtapapillary or peripheral haemangioblastomas were administered 120 mg propranolol daily.
CasePresentingHPOs: HP:0009711 (Retinal capillary hemangioma)
CaseHPOFreeText: The patient presented with a peripheral tumor in his right eye at the age of 13. He exited the trial in 2016 with no changes to the tumor size after the administration of propranolol over a one year trial.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Information obtained from Table 2.
Variant: Exon 1-3 Deletion (c.1-?_642+?del)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 1-3 Deletion
MultipleGeneVariants: N/A
c.548 C>Aap.S183X
GroupID: 27A
Case: Sex, Age, Ethnicity unknown
DiseaseAssertion: VHL
FamilyInfo: None. The patient with the given mutation in this study was a VHL patient with pancreatic ICTs.
CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)
CaseHPOFreeText: Patient has islet cell tumors (ICTs), or listed as pancreatic endocrine tumor.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.S183* (c.548C>A)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2215 https://www.ncbi.nlm.nih.gov/clinvar/variation/2215/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: stop_gained
CivicName: S183* (c.548C>A)
MultipleGeneVariants: N/A
12 I 5 21 5 retinal hb (5 + 13 + 14 years) 6 CNS hb (15 + 17 years) 3 PC (15 years) T c.l-?_463 + ?del
PatientID: I
KindredID: 12
Case: Sex Unknown, 21Y0M, Danish
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: HP:0009711; HP:0010797; HP:0001737 (Retinal capillary hemangioma, Hemangioblastoma, Pancreatic cysts)
CaseHPOFreeText: Diagnosed with VHL at age 5Y. Presented with 5 retinal hemangioblastoma (5Y, 13Y, 14Y) 6 CNS hemangioblastoma (15Y, 17Y) 3 pancreatic cysts (15Y). Age at the end of study: 21Y.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: Exon 1-2 Deletion (c.1-?_463+?del)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 1-2 Deletion
MultipleGeneVariants: N/A
1M14PCC + PNETProgressive, inoperableNAS525325.7 (II)+−VHL (Exon:3)/p.(Arg167Trp
PatientID: 1
KindredID: 1
Case: M, 14Y0M, Ethnicity Unknown
DiseaseAssertion: Assumed VHL
FamilyInfo: No family information reported.
CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma; pancreatic endocrine tumor)
CaseHPOFreeText: Patient was diagnosed with pheochromocytoma and pancreatic endocrine tumor.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R167W (c.499C>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/
CAID: N/A
gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T
VariantEvidence: N/A
MutationType: missense variant, transition
CivicName: R167W (c.499C>T)
MultipleGeneVariants: N/A
Endocrine Reviews, Volume 32, Issue Supplement, 1 June 2011, Pages 1–3095, https://doi.org/10.1093/edrv/32.supp.1
PatientID: 1 (case)
KindredID: 1
Case: F, 37Y0M, Ethnicity Unknown
DiseaseAssertion: adrenal pheochromocytoma
FamilyInfo: Her one sister had died just after delivery, following a severe hypertensive crisis. Her 26-year-old niece presented with a 3 cm left adrenal tumor, an 8 cm pancreatic tumor and disseminated hepatic metastasis, evolving to death within a few months. Her liver biopsy was compatible with a moderately differentiated neuroendocrine carcinoma of uncertain origin. Molecular diagnosis was not performed in the affected sister and niece. Her asymptomatic 5Y old daughter tested positive for the mutation: Q164R (c.491A<G).
CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)
CaseHPOFreeText: She first presented with paroxisms of severe hypertension associated with headaches, diaphoresis and, ocasionally, fainting, started one year before. She had had acute pulmonary edema and a cardiorespiratory arrest during her first caesarean section. A CT scan revealed a right adrenal tumor (6.0 cm), showing increased 123I-MIBG uptake. After conventional adrenalectomy, a PHEO was immunohistochemically confirmed. Close follow-up has shown no signs of recurrence or evidence of new tumors.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.Q164R (c.491A>G)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2238 https://www.ncbi.nlm.nih.gov/clinvar/variation/2238/
CAID: N/A
gnomAD: N/A
VariantEvidence: To date, this germline VHL mutation was said to have been described in only 3 cases, with variable phenotypes, and in 2 cases PHEO occurred at a very young age.
MutationType: missense_variant;transition
CivicName: N/A
MultipleGeneVariants: N/A
PatientID: 37
KindredID: 37
Case: F, 26Y0M, Korean
DiseaseAssertion: VHL
FamilyInfo: Family positive for VHL. Father presented with CNS hemangioblastoma, pheochromocytoma and further unspecified phenotypes; was diagnosed with VHL Type 2A. Younger sister presented with pheochromocytoma; was diagnosed with VHL Type 2C. Genetic information was not provided for father and sister.
CohortInfo: 26 Korean patients with more than one HAB in the CNS or eye, a single HAB in the CNS or retina plus a visceral manifestation (multiple renal, pancreatic or hepatic cysts, pheochromocytoma and RCC) and positive family history plus any one of the above manifestations.
CasePresentingHPOs: HP:0009711; HP:0002666 (Retinal capillary hemangioma, Pheochromocytoma)
CaseHPOFreeText: Other phenotypes presented but not specified (one or more of: pancreatic cyst or tumor, renal or hepatic cyst). Diagnosed with VHL Type 2A.
CaseNotHPOs: HP:0005584; HP:0010797 (Renal cell carcinoma, Hemangioblastoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.T157I (c.470C>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 223223, https://www.ncbi.nlm.nih.gov/clinvar/variation/223223/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transversion
CivicName: T157I (c.470C>T)
MultipleGeneVariants: N/A
GroupID: 4477
DiseaseAssertion: VHL
GroupSize: 2
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: N/A
GroupAgeRange: N/A
GroupInfo: Each group represents a family.
GroupPresentingHPOs: HP:0009711; HP:0010797; HP:0002666; HP:0030405 (Retinal capillary hemangioma, Hemangioblastoma, Pheochromocytoma, Pancreatic endocrine tumor)
GroupHPOFreeText: 1/2 members with pheochromocytoma, 2/2 members with CNS hemangioblastoma, 2/2 members with retinal angioma, 1/2 members with cysts. Diagnosed as a VHL Type 2B family. Localized pancreatic neuroendocrine tumor is also associated with this family but the number of family members affected is not specified.
GroupNotHPOs: HP:0005584 (Renal cell carcinoma)
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R167W (c.499C>T)
LegacyVariant: c.712C>T
CaseProblemVariantFreeText: N/A
ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/
CAID: N/A
gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1
VariantEvidence: Variant reported as 712, C to T (Arg to Trp), assumed to be reported in legacy nomenclature (AF010238.1) and mapped to c.499C>T, p.Arg167Trp (NM_000551.3).
MutationType: missense_variant;transition
CivicName: R167W (c.499C>T)
MultipleGeneVariants: N/A
GroupID: 4783
DiseaseAssertion: VHL
GroupSize: 3
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: N/A
GroupAgeRange: N/A
GroupInfo: Each group represents a family.
GroupPresentingHPOs: HP:0002666; HP:0009711; HP:0030405 (Pheochromocytoma, Retinal capillary hemangioma, Pancreatic endocrine tumor)
GroupHPOFreeText: 3/3 members with pheochromocytoma, 1/3 members with retinal angioma, Diagnosed as a VHL Type 2B family. Localized pancreatic neuroendocrine tumor is also associated with this family but the number of family members affected is not specified.
GroupNotHPOs: HP:0010797; HP:0005584 (Hemangioblastoma, Renal cell carcinoma)
GroupNotHPOFreeText: No CNS hemangioblastoma, RCC or cyst presentations.
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.L128F (c.382C>T)
LegacyVariant: c.595C>T
CaseProblemVariantFreeText: N/A
ClinVarID: 496060, https://www.ncbi.nlm.nih.gov/clinvar/variation/496060/
CAID: N/A
gnomAD: N/A
VariantEvidence: Variant reported as 595, C to T (Leu to Phe), assumed to be reported in legacy nomenclature (AF010238.1) and mapped to c.382C>T, p.Leu128Phe (NM_000551.3).
MutationType: missense_variant;transition
CivicName: L128F (c.382C>T)
MultipleGeneVariants: N/A
deletions involved exon 2 and 3
PatientID: 8
KindredID: 8
Case: M, 36Y0M, Korean
DiseaseAssertion: VHL
FamilyInfo: Family history present.
CasePresentingHPOs: HP:0010797; HP:0005584 (hemangioblastoma, renal cell carcinoma)
CaseHPOFreeText: 'Other' phenotypes found in patient. These are noted in the paper to include: pancreatic neuroendocrine tumors (PNETs), renal and pancreatic cysts and central nervous system tumors, although it is not clearly stated that patient has all. (See Table 1).
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: Previously reported, HGMD (Human Gene Mutation Database) [Refer to table 2].
SupplementalData: N/A
Variant: Exon 2-3 deletion (c.341-?_642+?del)
CaseProblemVariantFreeText: N/A
LegacyVariant: N/A
ClinVar: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 2-3 deletion
MultipleGeneVariants: N/A
PatientID: none (daughter)
KindredID: 2
Case: F, 6Y0M, African/African American
DiseaseAssertion: asymptomatic
FamilyInfo: Her mother had the same mutation and bilateral adrenal pheochromocytoma and spinal hemangioblastoma. Her older brother was negative for the mutation.
CasePresentingHPOs: N/A
CaseHPOFreeText: N/A
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R167W (c.499C>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/
CAID: N/A
gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: R167W (c.499C>T)
MultipleGeneVariants: N/A
PatientID: 32
KindredID: F01
Case: M, Age Unknown, Unknown Ethnicity
DiseaseAssertion: Asymptomatic
FamilyInfo: A total of 12 members of this family (F01) had a complete deletion of the VHL gene. Five of these patients (16, 18, 21, 33, 43) presented with clinical features of VHL. This family was previously published except for patients 43 and 48 which were newly diagnosed with VHL disease in the current study.
CasePresentingHPOs: N/A
CaseHPOFreeText: N/A
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 17537157
SupplementalData: Figure 2.
Variant: Complete Deletion
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: Deletion of ~250.9kb resulted in deletion of the VHL gene.
MutationType: deletion
CivicName: Deletion
MultipleGeneVariants: N/A
GroupID: 11
DiseaseAssertion: VHL
GroupSize: 14
GroupNumberMales: N/A
GroupNumberFemales: N/A
GroupEthnicity: N/A
GroupAgeRange: N/A
GroupInfo: Family of 14 VHL Type 1 affected individuals.
GroupPresentingHPOs: HP:0002894; HP:0009711; HP:0010797; HP:0005584 (Neoplasm of the pancreas, Retinal capillary hemangioma, Hemangioblastoma, Renal cell carcinoma)
GroupHPOFreeText: CNS hemangioblastoma (7/14 affected members), renal carcinoma (1/14 affected members) and retinal angioma (2/14 affected members) and pancreatic cystadenoma (number of affected individuals not specified).
GroupNotHPOs: HP:0002666 (Pheochromocytoma)
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.V130F (c.388G>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 496061, https://www.ncbi.nlm.nih.gov/clinvar/variation/496061/
CAID: N/A
gnomAD: N/A
VariantEvidence: This variant was not found in 120 alleles from normal subjects in the Brazilian population.
MutationType: missense_variant;transversion
CivicName: V130F (c.388G>T)
MultipleGeneVariants: N/A
VHL p.Tyr156Cys
Twelve patients with hereditary non-SDHx head and neck paragangliomas were analyzed. Eleven of the 12 patients were found to carry germline mutations in the VHL gene. Blood was used for molecular genetic analyses and the NM_000551.2 reference sequence was used. The 39 year old female proband was found to harbour the p.Y156C (c.467A>G) mutation of the VHL gene. She presented with recent onset of hypertension and was diagnosed with a right pheochromocytoma. At age 36, a suspected left pheochromocytoma was noted by CT and increased urinary metanephrines was confirmed at age 39 by MIBG scintigraphy. This imaging showed in addition an uptake located in the neck. MRI confirmed a left adrenal tumor and a left 2cm vagal paraganglioma that was removed and confirmed histopathologically. No other tumor of the VHL spectrum was discovered. Three of her four sons were found to carry the mutation and all underwent clinical screening. One of these sons presented with a 2.4cm abdominal paraganglioma.
Case 11In 1978, an 8-yr-old girl without familial history of VHL was operated for a right pheochromocytoma and at age 13 for a contralateral pheochromocytoma. At age 15, a 4-cm mass at the neck was diagnosed by selective arteriography as a carotid paraganglioma that was removed and histologically confirmed. The patient was then operated twice for cerebellar hemangioblastoma at age 22, leading to the diagnosis of VHL disease. At age 27, the patient was operated again for a retrocaval pheochromocytoma and for islet cell tumors. The patient was also repeatedly treated for bilateral retinal hemangioblastomas leading to blindness at age 32. At age 36, again a pheochromocytoma was removed. Molecular genetic analysis identified the p.Thr157Ile VHL germline mutation. So far, there are no affected relatives.
PatientID: 11
KindredID: 11
Case: F, 36Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: There was said to be, at the time, no affected relatives
CohortInfo: An international consortium registered patients with head and neck paragangliomas with VHL or RET gene mutations.
CasePresentingHPOs: HP:0006748; HP:0002668; HP:0006476; HP:0006880; HP:0009711; HP:0000618; HP:0010797 (adrenal pheochorocytoma, paraganglioma, abnormality of the pancreatic islet cells, cerebellar hemangioblastoma, retinal capillary hemangioblastoma, blindness, hemangioblastoma)
CaseHPOFreeText: At 8Y, (in 1978), she was operated for a right pheochromocytoma; at age 13 for a contralateral pheochromocytoma; at age 15, for a 4-cm mass at the neck was diagnosed by selective arteriography as a carotid paraganglioma. The patient was then operated twice for cerebellar hemangioblastoma at age 22, leading to the diagnosis of VHL disease. At age 27, the patient was operated again for a retrocaval pheochromocytoma and for islet cell tumors. The patient was also repeatedly treated for bilateral retinal hemangioblastomas leading to blindness at age 32. At age 36, again a pheochromocytoma was removed
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: RET
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.T157I (c.470C>T)
LegacyVariant: p.T157I
CaseProblemVariantFreeText: The publication only provides the p., the mutation was able to be deduced to p.T157I (c.470C>T)
ClinVarID: 223223 https://www.ncbi.nlm.nih.gov/clinvar/variation/223223/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant; transition
CivicName: T157I (c.470C>T)
MultipleGeneVariants: N/A
PatientID: V-29
KindredID: 2
Case: F, Age Unknown, German
DiseaseAssertion: VHL
FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.
CasePresentingHPOs: HP:0002666 (Pheochromocytoma)
CaseHPOFreeText: N/A
CaseNotHPOs: HP:0005584 (Renal cell carcinoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 7759077
SupplementalData: N/A
Variant: p.Y98H (c.292T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/
CAID: N/A
gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: Y98H (c.292T>C)
MultipleGeneVariants: N/A
PatientID: VI-2
KindredID: 2
Case: F, Age Unknown, German
DiseaseAssertion: VHL (Asymptomatic)
FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.
CasePresentingHPOs: N/A
CaseHPOFreeText: N/A
CaseNotHPOs: HP:0005584; HP:0002666 (Renal cell carcinoma, Pheochromocytoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 7759077
SupplementalData: N/A
Variant: p.Y98H (c.292T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/
CAID: N/A
gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: Y98H (c.292T>C)
MultipleGeneVariants: N/A
PatientID: V-35
KindredID: 2
Case: F, Age Unknown, German
DiseaseAssertion: VHL
FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.
CasePresentingHPOs: HP:0002666 (Pheochromocytoma)
CaseHPOFreeText: N/A
CaseNotHPOs: HP:0005584 (Renal cell carcinoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 7759077
SupplementalData: N/A
Variant: p.Y98H (c.292T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/
CAID: N/A
gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: Y98H (c.292T>C)
MultipleGeneVariants: N/A
We observed 38-year-old hemodialyzed male patient diagnosed with von Hippel-Lindau disease in 2008 who was admitted to the Department of Nephrology, Endocrinology and Metabolic Diseases, Medical University of Silesia in Katowice with significant anemia, increased number of leukocytes, pneumonia and with suspected endocarditis.In June 2007 the patient underwent right nephrectomy for renal cell carcinoma and then in October 2007 he had surgery to remove a tumor from his brainstem (medulla oblongata) at the level of the posterior portion of the foramen magnum. Histological examination found hemangioblastoma which might have occurred as a feature of VHL disease.In 2008 the Department of Genetics and Pathology, Pomeranian Medical University in Szczecin detected a constitutional mutation 407 C/T (F136S) within the VHL gene. Study of the patient’s family history showed that his father, uncle and grandmother were diagnosed with renal cell cancer. The patient underwent annual screening program in order to identify cancer manifestations early.In October 2010, he was diagnosed with a solitary kidney tumor and qualified for surgical treatment. Histological examinations showed the tumor to be renal cell carcinoma. Postoperative course was complicated by massive hematuria leading to urgent nephrectomy resulting in chronic hemodialysis.In March 2011, he was diagnosed with dilated cardiomyopathy and complex valves defect. In May 2011, severe central sleep apnea was determined.In July 2011, patient was admitted to the hospital again. Blood tests showed anemia (HGB = 5, 6 g/dl), leukocytosis (WBC = 13×109/l) and moderate thrombocytopenia ( PLT = 72×109/l). There was no peripheral blood smear done.Gastroscopy revealed erosive gastritis. He required blood transfusion during the hospitalization. Following tests reported increasing number of white blood cells (up to 55×109/l) and reducing number of plates despite use of intravenous corticosteroids. A preliminary diagnosis was: infective endocarditis, pneumonia, erosive gastritis and duodenitis accompanied by anemia, leukocytosis and thrombocytopenia.The patient was then transferred to the Department of Hematology and Bone Marrow Transplantation, Medical University of Silesia in Katowice. Physical examination revealed a heart murmur and splenomegaly. Blood test showed persistent anemia, decreased plateled count and hyperleukocytosis. A peripheral blood smear determined the presence of blasts.Ultrasound imaging of the abdomen revealed enlarged spleen (14.6x9.9 cm). Bone marrow aspirate confirmed the findings of blood smear and showed the presence more than 50% of myelomonoblastic cells. The flow cytometric immunophenotyping report indicated the malignant cells were positive for HLA-DR, MPO, CD13, CD15, CD33, CD116 and cytogenetic analysis showed the inv (16) (p13;q22). Molecular analysis of bone marrow cells using RT-PCR identified a CBFB-MYH11 fusion protein.Low cytogenetic risk patient was treated with individualized induction therapy DA: daunorubicin (60 mg/m2 on days 1–3) and cytosine arabinoside (200 mg/m2 on days 1–5). Hemodiadialyzotherapy was continued. His chemiotherapy- induced bone marrow aplasia with granulocytopenia was complicated by pneumonia.The patient achieved a complete hematologic remission in peripheral blood, but not molecular remission after induction chemotherapy (positive RT-PCR assays for oncogene CBFB-MYH11). The Patient then received consolidation treatment with HAM (mitoxantrone 10 mg/m2 on days 1–2 and cytosine arabinoside 1500 mg/m2 on days 1–5). During the period of profound aplasia an additional hemodialysis due to hyperkalemia was required. Prolonged bone marrow aplasia resulted in severe interstitial pneumonia and septicemia. Despite intensive therapeutic measures the patient died from respiratory failure.The autopsy revealed a pulmonary edema, massive hyperemia of the left lower lobe with pneumonia confluens.
PatientID: 1
KindredID: 1
Case: M, 38Y0M, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: His father, uncle and grandmother were diagnosed with renal cell cancer but no genetic data is available.
CasePresentingHPOs: HP:0001903; HP:0002090; HP:0005584; HP:0010797; HP:0000790; HP:0001644; HP:0010535; HP:0001654; HP:0005263; HP:0001873; HP:0001974; HP:0006689; HP:0033117; HP:0030148; HP:0001744; HP:0006515; HP:0100806; HP:0100598; HP:0100598; HP:0004930; HP:0004808 (Anemia, Pneumonia, Renal cell carcinoma, Hemangioblastoma, Hematuria, Dilated cardiomyopathy, Sleep apnea, Abnormal heart valve morphology, Gastritis, Thrombocytopenia, Leukocytosis, Bacterial endocarditis, Duodenitis, Heart murmur, Splenomegaly, Interstitial pneumonitis, Sepsis, Pulmonary edema, Abnormality of the pulmonary vasculature, Acute myeloid leukemia)
CaseHPOFreeText: 38-year-old male patient diagnosed with von Hippel-Lindau disease in 2008 admitted with significant anemia, increased number of leukocytes, pneumonia and with suspected endocarditis. In June 2007 the patient underwent right nephrectomy for RCC and then in October 2007 he had surgery to remove a hemangioblastoma from his brainstem (medulla oblongata). In October 2010, he was diagnosed with a solitary kidney tumor (histologically confirmed RCC). Postoperative course was complicated by massive hematuria leading to urgent nephrectomy resulting in chronic hemodialysis. In March 2011, he was diagnosed with dilated cardiomyopathy and complex valves defect. In May 2011, severe central sleep apnea was determined. In July 2011, anemia, leukocytosis and moderate thrombocytopenia were determined. Gastroscopy revealed erosive gastritis. A preliminary diagnosis was made of infective endocarditis, pneumonia and duodenitis. Physical examination revealed a heart murmur and splenomegaly. Blood test showed persistent anemia, decreased platelet count and hyperleukocytosis. Ultrasound imaging of the abdomen revealed enlarged spleen. Prolonged bone marrow aplasia resulted in severe interstitial pneumonia and septicemia. The patient died from respiratory failure. The autopsy revealed a pulmonary edema, massive hyperemia of the left lower lobe with pneumonia confluens.
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.F136S (c.407T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: Authors declare variant as: “407 C/T (F136S)”.
ClinVarID: 496064, https://www.ncbi.nlm.nih.gov/clinvar/variation/496064/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: F136S (c.407T>C)
MultipleGeneVariants: N/A
PatientID: None (proband’s father)
KindredID: 2
Case: M, Age Unknown, Ethnicity unknown
DiseaseAssertion: VHL
FamilyInfo: His daughter (25Y0M; proband), son, and 8-year-old grandson have also been diagnosed with VHL. His other infant grandson also tested positive for the VHL mutation (c.499C>T).
CasePresentingHPOs: unknown
CaseHPOFreeText: N/A
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.R167W (c.499C>T)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/
CAID: N/A
gnomAD: 0.000007954 https://gnomad.broadinstitute.org/variant/3-10191506-C-T
VariantEvidence: N/A
MutationType: missense_variant; transition
CivicName: R167W (c.499C>T)
MultipleGeneVariants: N/A
PatientID: Carrier 6 (nephew to proband 3)
KindredID: 1
Case: M, Age Unknown, Chinese
DiseaseAssertion: Asymptomatic
FamilyInfo: The family with PCCs includes 56 members of 4 generations, and is from Gansu Province. Among them, 7 extended over 3 generations were diagnosed as PCCs. One died before admission and another died due to a cardiovascular incident. Five were initially evaluated; evaluation included medical history, physical examination, abdominal ultrasonography, CT or MRI and laboratory tests. All 5 probands of this family underwent surgical resection. The tumors were benign under pathological examinations. There were no recurrence and malignant transformation over the period of up to 23-year follow-up. Twenty members, including 5 live patients and 15 direct relatives, accepted genetic examination.
CasePresentingHPOs: N/A
CaseHPOFreeText: N/A
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.H125P (c.374A>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 223201, https://www.ncbi.nlm.nih.gov/clinvar/variation/223201/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transversion
CivicName: H125P (c.374A>C)
MultipleGeneVariants: N/A
PatientID: V266
KindredID: V266
Case: Sex Unknown, Age Unknown, French
DiseaseAssertion: VHL
FamilyInfo: N/A
CasePresentingHPOs: N/A
CaseHPOFreeText: Diagnosed with VHL Type 1.
CaseNotHPOs: HP:0002666 (Pheochromocytoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: N/A
Variant: p.W88S (c.263G>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2220, https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transversion
CivicName: W88S (c.263G>C)
MultipleGeneVariants: N/A
We identified deletions ranging from 0.5 kb to 250 kb affecting part of or the entire VHL and flanking genes in 54 families.
GroupID: 24
DiseaseAssertion: VHL
GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A
GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.
GroupPresentingHPOs: HP:0005584; HP:0000107; HP:0009711; HP:0010797 (Renal cell carcinoma, Renal cyst, Retinal capillary hemangioma, Hemangioblastoma)
GroupHPOFreeText: # of affected individuals: Renal cell carcinoma (1), Renal cyst (1), Retinal capillary hemangioma (1), Hemangioblastoma/brain/cerebellum (1)
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Supplemental Table 2, Table 1, Table 3
Variant: Exon 2-3 Deletion (c.341-?_642+?del)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 2-3 Deletion
MultipleGeneVariants: Germline, IRAK2, partial deletion
We identified deletions ranging from 0.5 kb to 250 kb affecting part of or the entire VHL and flanking genes in 54 families.
GroupID: 36
DiseaseAssertion: VHL
GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A
GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.
GroupPresentingHPOs: HP:0009711; HP:0010797 (Retinal capillary hemangioma, Hemangioblastoma)
GroupHPOFreeText: # of affected individuals: Retinal capillary hemangioma (1), Hemangioblastoma/brain/cerebellum (1)
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Supplemental Table 2, Table 1, Table 3
Variant: Exon 1-3 Deletion (c.1-?_642+?del)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 1-3 Deletion
MultipleGeneVariants: N/A
We identified deletions ranging from 0.5 kb to 250 kb affecting part of or the entire VHL and flanking genes in 54 families
GroupID: 2
DiseaseAssertion: VHL
GroupSize: N/A GroupNumberMales: N/A GroupNumberFemales: N/A GroupEthnicity: N/A GroupAgeRange: N/A
GroupInfo: 54 VHL deletion families from the Freiburg registry were selected in order to assist in the correlation of VHL deletions to clinical phenotypes.
GroupPresentingHPOs: HP:0009711; HP:0009713; HP:0030393; HP:0030424 (Retinal capillary hemangioma, Spinal hemangioblastoma, Endolymphatic sac tumor, Epididymal cyst)
GroupHPOFreeText: # of affected individuals: Retinal capillary hemangioma (1), Spinal hemangioblastoma (1), Endolymphatic sac tumor (1), Epididymal cyst (1)
GroupNotHPOs: N/A
GroupNotHPOFreeText: N/A
GroupPreviousTesting: N/A
PreviouslyPublished: N/A
SupplementalData: Supplemental Table 2, Table 1, Table 3
Variant: Exon 1 Deletion (c.1-?_340+?del)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: N/A
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: exon_loss_variant
CivicName: Exon 1 Deletion
MultipleGeneVariants: Germline, ENST197804, partial deletion
The patient’s blood sample was collected in vacutainers containing EDTA as anticoagulant. After DNA extraction (EZ1 Advanced Instruments; Qiagen, Hilden, Germany), mutation analysis of the VHL gene ({"type":"entrez-nucleotide","attrs":{"text":"NG_008212.3","term_id":"319803102","term_text":"NG_008212.3"}}NG_008212.3, {"type":"entrez-nucleotide","attrs":{"text":"NM_000551","term_id":"1779521775","term_text":"NM_000551"}}NM_000551) was performed using Sanger sequencing with the ABI PRISM™ 3130 Avant system (Applied Biosystems, Grand Island, NY, USA). The entire coding region and the exon/intron boundaries of the VHL gene (transcript ENST00000256474) were sequenced. The amplicon panel primers and conditions used were established in the laboratory.A heterozygous missense mutation c.202T>C, (p.Ser 68Pro) in exon 1 of the VHL gene was found in the pa-tient’s DNA sample (Figure 3). This mutation is reported in the HGMD-PUBLIC (CM073416) (http://www.hgmd.org).
ArticleReferenceSequence: NM_000551.3 (Standard)
GenotypingMethod: Sanger sequencing
SamplingMethod: peripheral blood
694C>T
27 index patients suspected of having VHL disease from unrelated Chinese families and their relatives were studied. The nucleotide were numbered according to the sequence numbering by Latif et al, 1993 and this was converted to NM_000551.3. The paper did not differentiate between a pancreatic cysts and tumor and presented these together as a 'pancreatic lesion'. The paper summarized the phenotypes of the families together. Family 17 was found with p.Arg161* mutation in the VHL gene: 2/2 members had CNS hemangioblastoma, 1/2 had retinal angioma, and 1/2 had RCC. ACMG PM1
. Materials and Methods2.1. Patients and the Genetic Testing of the RET, VHL, SDHB, SDHC, SDHD and TMEM127 Genes Using Sanger SequencingA retrospective medical and laboratory record review was performed on all patients diagnosed with hereditary endocrine tumor syndrome including suspicion of hereditary pheochromocytoma and paraganglioma during the period 1998–2020 under care at Semmelweis University, Budapest, Hungary. Our center is a national reference and part of European Reference Network (ERN) expertise center for hereditary endocrine tumors. After genetic counseling and having obtained informed consent, all patients with PPGL underwent genetic testing for the RET, VHL, SDHB, SDHC, SDHD, MAX and TMEM127 genes using conventional methods including PCR amplification followed by Sanger sequencing as previously reported [57]. Blood DNA was extracted using commercially available DNA extraction kits (DNA isolation from mammalian blood, Roche, or DNA isolation kit from blood, Qiagen LTD). Bidirectional DNA sequencing of all these genes and large deletion analysis of the VHL, SDHB, SDHC and SDHD and TMEM127 genes were performed using multiplex ligation probe amplification [58]. Of these samples 20 were used for determination of analytical sensitivity of whole exome sequencing (WES) performed between 2015–2019. In 2015, an in-house NGS based gene panel (ENDOGENE panel) was developed and introduced into clinical practice. Fifteen samples were used for the validation of ENDOGENE panel and additional 61 patients were tested prospectively. The study was approved by the Hungarian National Public Health Center (NPHC: 41189-7/2018/EÜIG, 13 December 2018) and the Scientific and Research Committee of the Medical Research Council of Ministry of Health, Hungary (ETT-TUKEB 4457/2012/EKU).2.2. Whole Exome SequencingSeven members of two families presenting PPGL and 13 unrelated patients affected with PPGL were selected from our database containing the clinical and laboratory data of 241 patients and relatives diagnosed and treated at the 2nd Department of Internal Medicine, Semmelweis University with clinical diagnosis of PPGL between 1998–2019. Twelve patients carried SDHB mutations, two SDHD mutations and one SDHC mutation (Table 1). Six patients had no mutation in SDHB, SDHC, SDHD, VHL, RET, TMEM127 and MAX genes. A total number of 29 missense/nonsense variants were identified with Sanger sequencing in this cohort. These variants were used as positive references, while wild type sequences were considered as negative references during evaluation of analytical performances of WES.
ArticleReferenceSequence: NM_000551.4
GenotypingMethod: Whole Exome Sequencing confirmed mutations with Sanger sequencing.
SamplingMethod: blood
PatientID: VI-13
KindredID: 1
Case: M, Age Unknown, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.
CasePresentingHPOs: HP:0002666; HP:0002668; HP:0009711 (Pheochromocytoma, Paraganglioma, Retinal capillary hemangioma)
CaseHPOFreeText: Phenotype noted as: Pheo/PGL (unclear which of the two or if both apply to this patient).
CaseNotHPOs: HP:0005584 (Renal cell carcinoma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)
SupplementalData: N/A
Variant: p.Y112H (c.334T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: Y112H (c.334T>C)
MultipleGeneVariants: N/A
PatientID: V-5
KindredID: 1
Case: M, Age Unknown, Ethnicity Unknown
DiseaseAssertion: VHL
FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.
CasePresentingHPOs: HP:0002666; HP:0002668 (Pheochromocytoma, Paraganglioma)
CaseHPOFreeText: Phenotype noted as: Pheo/PGL (unclear which of the two or if both apply to this patient).
CaseNotHPOs: HP:0005584; HP:0009711 (Renal cell carcinoma, Retinal capillary hemangioma)
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)
SupplementalData: N/A
Variant: p.Y112H (c.334T>C)
LegacyVariant: N/A
CaseProblemVariantFreeText: N/A
ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/
CAID: N/A
gnomAD: N/A
VariantEvidence: N/A
MutationType: missense_variant;transition
CivicName: Y112H (c.334T>C)
MultipleGeneVariants: N/A
Validation of variantsCandidate variants were validated by Sanger sequencing using BigDye Terminator v3.1 (ABI, ThermoFisher Scientific Corporation) and resulting chromatograms analysed using Mutation Surveyor (Softgenetics, PA, USA). Copy number variants detected through MLPA were validated by quantitative PCR. Cycle threshold (Ct) values were normalized to GAPDH endogenous control and fold-change in gene dosage was calculated using the ΔΔCt method by normalizing against two healthy controls. Somatic status of variants was similarly validated on tumour DNA.
ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3
GenotypingMethod: Peripheral blood was collected from the patients and genomic DNA from blood and tissue specimens were extracted usingQIAamp DNA mini kit. Whole exome sequencing was performed using the IlluminaHiseq4000 (Illumina, San Diego, CA, USA). Sequenced reads were aligned to the human reference genome (hs37d5) and variants were annotated using ANNOVAR. Candidate variants were validated by Sanger sequencing using BigDyeTerminator v3.1 and resulting chromatograms analysed using Mutation Surveyor. Copy number variants detected through MLPA were validated by quantitative PCR.
SamplingMethod: Peripheral blood and tumor tissue
Abstract
No case level data for NM_000133.4:c.83G>A (p.Cys28Tyr) in this paper.
mutation
No evidence of NM_000133.4:c.128G>A (p.Arg43Gln) in this paper.
49.
Case#: 49
DiseaseAssertion: Hemophilia B, severe
FamilyInfo: NA
ParentalTesting: NA
CasePresentingHPOs: HP:0011858
CaseHPOFreeText: FIX:C < 1%
CaseNotHPOs: NA
CaseNotHPOFreeText: NA
CasePreviousTesting: All relevant sequences of F9 were PCR amplified and analyzed by DNA sequencing
Gene: F9
Variant: NM_000133.3:c.862_863delGA
LegacyVariant:
ClinVar: No
CAID: No
gnomAD:
Click here for additional data file.
NM_000133.4:c.127C>T (p.Arg43Trp) is not mentioned in this paper.
NM_000133.4(F9):c.19A>T (p.Ile7Phe) is not reported in this paper.
Variant 1 of 11
Variant1: NM_000203.3: c.1045G>C p.(Asp349His)
Variant1ClinVarID:2585078
1
Case#: 1, female, 44yo
DiseaseAssertion: VWD1
FamilyInfo: N/A
ParentalGenotype: N/A
CasePresentingHPOs: HP:0007420, HP:0000132, HP:0004846, HP:0012147, HP:0030129, HP:0030130 (spontaneous hematomas, Menorrhagia, Reduced quantity of VWF, Impaired ristocetin cofactor assay activity, Impaired von Willebrand factor collagen binding activity)
CaseHPOFreeText: Type O blood, VWF:Ag (0·55–2 iu/ml) pre = 0·47, VWF:RCo (0·55–2 iu/ml) pre = 0·5, FVIII:C (0·55–2 iu/ml) pre = 0·16, FVIII:C/VWF:Ag ratio = 0·32, VWF:FVIII binding (>20%) = 7%, VWF:FVIII binding/VWF:Ag (>0·7) = 0·15, patient died after motor vehicle accident
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
ProteinExpression: N/A
CasePreviousTesting: RFLP; confirmatory sequencing
Gene: VWF
Variant 1: NM_000552.4(VWF):c.2561G>A (p.Arg854Gln)
ClinVar: 296; https://www.ncbi.nlm.nih.gov/clinvar/variation/296/
gnomAD: MAF = 0.005692 (European Non-Finnish); https://gnomad.broadinstitute.org/variant/12-6143978-C-T
Variant 2: N/A - stated to be a compound heterozygote for a 2N VWD and a presumed null mutation
3
Case#: 3, female, 19yo
DiseaseAssertion: VWD1
FamilyInfo: brother diagnosed with VWD
ParentalGenotype: N/A
CasePresentingHPOs: HP:0000978; HP:0000132, HP:0004846, HP:0012147, HP:0030129 (Bruising susceptibility, Menorrhagia, Reduced quantity of VWF, Impaired ristocetin cofactor assay activity)
CaseHPOFreeText: Type O blood, VWF:Ag (0·55–2 iu/ml) pre = 0·14, VWF:RCo (0·55–2 iu/ml) pre = 0·15, FVIII:C (0·55–2 iu/ml) pre = 0·1, FVIII:C/VWF:Ag ratio = 0·71, VWF:FVIII binding (>20%) = n/a, VWF:FVIII binding/VWF:Ag (>0·7) = n/a, spinal surgery with VWF concentrate and adequate haemostasis
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
ProteinExpression: N/A
CasePreviousTesting: RFLP; confirmatory sequencing
Gene: VWF
Variant 1: NM_000552.4(VWF):c.2561G>A (p.Arg854Gln)
ClinVar: 296; https://www.ncbi.nlm.nih.gov/clinvar/variation/296/
gnomAD: MAF = 0.005692 (European Non-Finnish); https://gnomad.broadinstitute.org/variant/12-6143978-C-T
Variant 2: N/A - stated to be a compound heterozygote for a 2N VWD and a presumed null mutation
4
Case#: 4, male, 23yo
DiseaseAssertion: VWD1
FamilyInfo: N/A
ParentalGenotype: N/A
CasePresentingHPOs: HP:0004846, HP:0012147, HP:0030129 (Reduced quantity of VWF, Impaired ristocetin cofactor assay activity)
CaseHPOFreeText: Haemarthrosis in teens, Delayed bleeding after tonsillectomy (DDAVP given prior to procedure), VWF:Ag (0·55–2 iu/ml) pre = 0·35, VWF:RCo (0·55–2 iu/ml) pre = 0·32, FVIII:C (0·55–2 iu/ml) pre = 0·12, FVIII:C/VWF:Ag ratio = 0·34, VWF:FVIII binding (>20%) = n/a, VWF:FVIII binding/VWF:Ag (>0·7) = n/a, Surgery to repair a syringomyelia defect with VWF concentrate and no bleeding complications
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
ProteinExpression: N/A
CasePreviousTesting: RFLP; confirmatory sequencing
Gene: VWF
Variant 1: NM_000552.4(VWF):c.2561G>A (p.Arg854Gln)
ClinVar: 296; https://www.ncbi.nlm.nih.gov/clinvar/variation/296/
gnomAD: MAF = 0.005692 (European Non-Finnish); https://gnomad.broadinstitute.org/variant/12-6143978-C-T
Variant 2: N/A - stated to be a compound heterozygote for a 2N VWD and a presumed null mutation
rs2676073266132007c.3437A > G26p.Y1146C1042A
Case: n.a.
DiseaseAssertion: VWD 2A
FamilyInfo: n.a.
ParentalGenotype(s):n.a.
CasePresentingHPOs:n.a.
CaseHPOFreeRext:n.a.
CaseNOTHPOs:n.a.
CaseNOTHPOFreeText:n.a.
CasePreviousTesting:n.a.
GenotypingMethod:n.a.
PreviouslyPublished: If applicable.n.a.
Gene:VWF
Variant:NM_000552.5(VWF):c.3437A>G (p.Tyr1146Cys)
HGVS:NM_000552.5:c.3437A>G
ClinVarID:31009
CAID:n.a.
gnomAD:n.a.
6-months-old
Case: 8 years old female, age of genetic diagnosis; 6-months-old, when first presented with bilateral in-toeing
DiseaseAssertion: related to neurological symptoms, difficult to say which type of VWD she has
FamilyInfo: great uncle with "clubfoot"
CasePresentingHPOs: HP:0007340, HP:0001347, HP:0001771,
CaseHPOFreeText: Talipes equinovarus bilaterally
Gene: VWA1
Variant: c.62_71dup (p.Gly25ArgfsTer74)
HGVS: NM_022834.5:c.62_71dup
ClinVar: 830327
gnomAD: allele frequency: 0.0003330, https://gnomad.broadinstitute.org/variant/1-1371178-T-TGGCGCGGAGC?dataset=gnomad_r2_1
CaseMYH7-8: Japan, Asian
CasePresentingHPOs: HP:0001639, HP:0006685 (Hypertrophic cardiomyopathy, Endomyocardial fibrosis)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo:
CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each proband. They each had 95 genes associated with DCM, HCM, and other inherited cardiovascular diseases sequenced with a panel, including both the exons and spicing regions. Variants were then filtered for rarity and pathogenicity.
Variant: NM_000257.3:c.1357C>T (p.Arg453Cys)
ClinVar: 14089 https://www.ncbi.nlm.nih.gov/clinvar/variation/14089/
gnomAD: Not in gnomAD
CaseMYH7-7: Japan, Asian
CasePresentingHPOs: HP:0001639, HP:0006685 (Hypertrophic cardiomyopathy, Endomyocardial fibrosis)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo:
CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each proband. They each had 95 genes associated with DCM, HCM, and other inherited cardiovascular diseases sequenced with a panel, including both the exons and spicing regions. Variants were then filtered for rarity and pathogenicity.
Variant: NM_000257.3:c.1358G>A (p.Arg453His)
ClinVar: 42838 https://www.ncbi.nlm.nih.gov/clinvar/variation/42838/
gnomAD: Not in gnomAD
CaseMYH7-9: Japan, Asian
CasePresentingHPOs: HP:0001639, HP:0006685 (Hypertrophic cardiomyopathy, Endomyocardial fibrosis)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo:
CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each proband. They each had 95 genes associated with DCM, HCM, and other inherited cardiovascular diseases sequenced with a panel, including both the exons and spicing regions. Variants were then filtered for rarity and pathogenicity.
Variant: NM_000257.3:c.1012G>A (p.Val338Met)
ClinVar: 164381 https://www.ncbi.nlm.nih.gov/clinvar/variation/164381/
gnomAD: Not in gnomAD
Supplementary Material 4
Case M-18: Japanese
DiseaseAssertion: idiopathic cardiomyopathy (HCM and DCM)
CasePreviousTesting: Clinical evaluation, chest radiography, electrocardiography, echocardiography, cardiac catheterization, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1)
CaseGenotypingMethod: 8 sarcomeric genes amplified from genomic DNA via PCR then screened using bidirectional direct sequencing
Variant: NM_000257.3(MYH7):c.2221G>T (p.Gly741Trp)
ClinVar: 177665, https://www.ncbi.nlm.nih.gov/clinvar/variation/177665/
gnomAD: n/a
Supplementary Material 4
Case M-2: Japanese
DiseaseAssertion: idiopathic cardiomyopathy (HCM and DCM)
CasePreviousTesting: Clinical evaluation, chest radiography, electrocardiography, echocardiography, cardiac catheterization, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1)
CaseGenotypingMethod: 8 sarcomeric genes amplified from genomic DNA via PCR then screened using bidirectional direct sequencing
Variant: NM_000257.3(MYH7):c.611G>A (p.Arg204His)
ClinVar: 43095, https://www.ncbi.nlm.nih.gov/clinvar/variation/43095/
gnomAD: 0.00001767, https://gnomad.broadinstitute.org/variant/14-23900998-C-T
Supplementary Material 4
Case M-8: Japanese
DiseaseAssertion: idiopathic cardiomyopathy (HCM and DCM)
CasePreviousTesting: Clinical evaluation, chest radiography, electrocardiography, echocardiography, cardiac catheterization, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1)
CaseGenotypingMethod: 8 sarcomeric genes amplified from genomic DNA via PCR then screened using bidirectional direct sequencing
Variant: NM_000257.3(MYH7):c.1816G>A (p.Val606Met)
ClinVar: 14091, https://www.ncbi.nlm.nih.gov/clinvar/variation/14091/
gnomAD: 0.000007070, https://gnomad.broadinstitute.org/variant/14-23896866-C-T
Supplementary Material 4
Case M-14: Japanese
DiseaseAssertion: idiopathic cardiomyopathy (HCM and DCM)
CasePreviousTesting: Clinical evaluation, chest radiography, electrocardiography, echocardiography, cardiac catheterization, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1)
CaseGenotypingMethod: 8 sarcomeric genes amplified from genomic DNA via PCR then screened using bidirectional direct sequencing
Variant: NM_000257.3(MYH7):c.2155C>T (p.Arg719Trp)
ClinVar: 14104, https://www.ncbi.nlm.nih.gov/clinvar/variation/14104/
gnomAD: 0.00003185, https://gnomad.broadinstitute.org/variant/14-23895180-G-A
Supplementary Material 4
Case M-22: Japanese
DiseaseAssertion: idiopathic cardiomyopathy (HCM and DCM)
CasePreviousTesting: Clinical evaluation, chest radiography, electrocardiography, echocardiography, cardiac catheterization, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1)
CaseGenotypingMethod: 8 sarcomeric genes amplified from genomic DNA via PCR then screened using bidirectional direct sequencing
Variant: NM_000257.3(MYH7):c.2333A>G (p.Asp778Gly)
ClinVar: 14100, https://www.ncbi.nlm.nih.gov/clinvar/variation/14100/
gnomAD: n/a
Supplementary Material 4
Case M-15: Japanese
DiseaseAssertion: idiopathic cardiomyopathy (HCM and DCM)
CasePreviousTesting: Clinical evaluation, chest radiography, electrocardiography, echocardiography, cardiac catheterization, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1)
CaseGenotypingMethod: 8 sarcomeric genes amplified from genomic DNA via PCR then screened using bidirectional direct sequencing
Variant: NM_000257.3(MYH7):c.2155C>T (p.Arg719Trp)
ClinVar: 14104, https://www.ncbi.nlm.nih.gov/clinvar/variation/14104/
gnomAD: 0.00003185, https://gnomad.broadinstitute.org/variant/14-23895180-G-A
Supplementary Data: Table S3
Case 140:
DiseaseAssertion: left ventricular noncompaction
CasePresentingHPOs: HP:0030682 (left ventricular noncompaction)
CaseHPOFreeText: >7yo, able to hold breath, non compacted segment = distinct 2-layered appearance of trabeculated and compacted myocardium, NC/C ratio > 2.3:1
CasePreviousTesting: Cardiac MRI using 17-segment model of LV segmentation, ECG, transthoracic echocardiography, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data tables S1 and S2.
CaseGenotypingMethod: WES, variant enrichment analysis
Variant: NM_000257.3(MYH7):c.3286G>T (p.Asp1096Tyr)
ClinVar: 42953, https://www.ncbi.nlm.nih.gov/clinvar/variation/42953/
gnomAD: 0.0001414, https://gnomad.broadinstitute.org/variant/14-23890217-C-A
MultipleGeneVariants:
(1) SDHA Variant:
Variant: NM_004168.3(SDHA):c.830C>T (p.Thr277Met)
ClinVar: 222817, https://www.ncbi.nlm.nih.gov/clinvar/variation/222817/
gnomAD: 0.00008359, https://gnomad.broadinstitute.org/variant/5-231050-C-T
(2) TTN Variant:
Variant: p.32991_32992del no ClinVar or CAID
Supplementary Data: Table S3
Case: 63
DiseaseAssertion: left ventricular noncompaction
CasePresentingHPOs: HP:0030682 (left ventricular noncompaction)
CaseHPOFreeText: suspected LVNC, >7yo, able to hold breath, non compacted segment = distinct 2-layered appearance of trabeculated and compacted myocardium, NC/C ratio < 2.3:1
CasePreviousTesting: Cardiac MRI using 17-segment model of LV segmentation, ECG, transthoracic echocardiography, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data tables S1 and S2.
CaseGenotypingMethod: WES, variant enrichment analysis
Variant: NM_000257.3(MYH7):c.3337-3dupC written in paper as g.23889445insG
ClinVar: 42956, https://www.ncbi.nlm.nih.gov/clinvar/variation/42956/
gnomAD: 0.02126, https://gnomad.broadinstitute.org/variant/14-23889445-T-TG
MultipleGeneVariants:
(1) TTN Variant:
Variant: NM_133378.4(TTN):c.29331A>G (p.Glu9777=) written in paper as p.Arg9778Ter, g.179547454
ClinVar: 46884, https://www.ncbi.nlm.nih.gov/clinvar/variation/46884/
gnomAD: 0.005805, https://gnomad.broadinstitute.org/variant/2-179547455-T-C
Supplementary Data: Table S3
Case 35:
DiseaseAssertion: left ventricular noncompaction
CasePresentingHPOs: HP:0030682 (left ventricular noncompaction)
CaseHPOFreeText: >7yo, able to hold breath, non compacted segment = distinct 2-layered appearance of trabeculated and compacted myocardium, NC/C ratio > 2.3:1
CasePreviousTesting: Cardiac MRI using 17-segment model of LV segmentation, ECG, transthoracic echocardiography, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data tables S1 and S2.
CaseGenotypingMethod: WES, variant enrichment analysis
Variant: NM_000257.3(MYH7):c.115G>A (p.Val39Met)
ClinVar: 42827, https://www.ncbi.nlm.nih.gov/clinvar/variation/42827/
gnomAD: 0.00004596, https://gnomad.broadinstitute.org/variant/14-23902827-C-T
MYH7 (3)
Case#: SF No. 28, GC Case No. 21, male, 83
DiseaseAssertion: hypertrophic cardiomyopathy, dilated cardiomyopathy
FamilyInfo: No
CasePresentingHPOs: N/A
CaseHPOFreeText: Gastric cancer,
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
CaseGenotypingMethod: WES, Sanger sequencing,
Variant: NM_000257.3(MYH7):c.4522_4524delGAG (p.Glu1508del)
ClinVar: 43023 https://www.ncbi.nlm.nih.gov/clinvar/variation/43023/
CAID: N/A
gnomAD: absent
MYH7 (3)
Case#: SF No. 30, GC Case No. 23, female, 31
DiseaseAssertion: hypertrophic cardiomyopathy, dilated cardiomyopathy
FamilyInfo: Yes, one affected
CasePresentingHPOs: N/A
CaseHPOFreeText: Gastric cancer,
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
CaseGenotypingMethod: WES, Sanger sequencing,
Variant: NM_000257.3(MYH7):c.4522_4524delGAG (p.Glu1508del)
ClinVar: 43023 https://www.ncbi.nlm.nih.gov/clinvar/variation/43023/
CAID: N/A
gnomAD: absent
Supplementary Data, Table 2
Case: Australian
DiseaseAssertion: HCM
CaseHPOFreeText: maximum left ventricular wall thickness of ≥15 mm
CasePreviousTesting: electrocardiography, echocardiography, Full testing (MYBPC3, MYH7, TNNT2, TNNI3, TPM1, MYL2, MYL3, ACTC1)
CaseGenotypingMethod: DNA isolated from peripheral blood or buccal swabs, PCR, Sanger sequencing, segregation analysis, haplotype analysis of MYBPC3 and MYH7
Variant: NM_000257.3(MYH7):c.2722C>G (p.Leu908Val)
ClinVar: 14097, https://www.ncbi.nlm.nih.gov/clinvar/variation/14097/
gnomAD: 0.00003185, https://gnomad.broadinstitute.org/variant/14-23893316-G-C
Supplementary Data, Table 2
Case: Australian
DiseaseAssertion: HCM
CaseHPOFreeText: maximum left ventricular wall thickness of ≥15 mm
CasePreviousTesting: electrocardiography, echocardiography, Full testing (MYBPC3, MYH7, TNNT2, TNNI3, TPM1, MYL2, MYL3, ACTC1)
CaseGenotypingMethod: DNA isolated from peripheral blood or buccal swabs, PCR, Sanger sequencing, segregation analysis, haplotype analysis of MYBPC3 and MYH7
Variant: NM_000257.3(MYH7):c.428G>A (p.Arg143Gln)
ClinVar: 43006, https://www.ncbi.nlm.nih.gov/clinvar/variation/43006/
gnomAD: 0.000003977, https://gnomad.broadinstitute.org/variant/14-23901922-C-T
Supplementary Data, Table 2
Case: Australian
DiseaseAssertion: HCM
CaseHPOFreeText: maximum left ventricular wall thickness of ≥15 mm
CasePreviousTesting: electrocardiography, echocardiography, Full testing (MYBPC3, MYH7, TNNT2, TNNI3, TPM1, MYL2, MYL3, ACTC1)
CaseGenotypingMethod: DNA isolated from peripheral blood or buccal swabs, PCR, Sanger sequencing, segregation analysis, haplotype analysis of MYBPC3 and MYH7
Variant: NM_000257.3(MYH7):c.611G>A (p.Arg204His)
ClinVar: 43095, https://www.ncbi.nlm.nih.gov/clinvar/variation/43095/
gnomAD: 0.00001767, https://gnomad.broadinstitute.org/variant/14-23900998-C-T
Supplementary Data, Table 2
Variant noted to be present in 3 individuals
Variant: NM_000257.3(MYH7):c.2221G>T (p.Gly741Trp)
ClinVar: 177665, https://www.ncbi.nlm.nih.gov/clinvar/variation/177665/
gnomAD: n/a
Supplementary Data, Table 2
Case: Australian
DiseaseAssertion: HCM
CaseHPOFreeText: maximum left ventricular wall thickness of ≥15 mm
CasePreviousTesting: electrocardiography, echocardiography, Full testing (MYBPC3, MYH7, TNNT2, TNNI3, TPM1, MYL2, MYL3, ACTC1)
CaseGenotypingMethod: DNA isolated from peripheral blood or buccal swabs, PCR, Sanger sequencing, segregation analysis, haplotype analysis of MYBPC3 and MYH7
Variant: NM_000257.3(MYH7):c.1727A>G (p.His576Arg)
ClinVar: 177625, https://www.ncbi.nlm.nih.gov/clinvar/variation/177625/
gnomAD: 0.00001768, https://gnomad.broadinstitute.org/variant/14-23896955-T-C
Supplementary Data, Table 2
Variant noted to be present in 3 individuals
Variant: NM_000257.3(MYH7):c.2389G>A (p.Ala797Thr)
ClinVar: 42901, https://www.ncbi.nlm.nih.gov/clinvar/variation/42901/
gnomAD: 0.00002386, https://gnomad.broadinstitute.org/variant/14-23894525-C-T
Supplementary Data, Table 2
Case: Australian
DiseaseAssertion: HCM
CaseHPOFreeText: maximum left ventricular wall thickness of ≥15 mm
CasePreviousTesting: electrocardiography, echocardiography, Full testing (MYBPC3, MYH7, TNNT2, TNNI3, TPM1, MYL2, MYL3, ACTC1)
CaseGenotypingMethod: DNA isolated from peripheral blood or buccal swabs, PCR, Sanger sequencing, segregation analysis, haplotype analysis of MYBPC3 and MYH7
Variant: NM_000257.3(MYH7):c.2155C>T (p.Arg719Trp)
ClinVar: 14104, https://www.ncbi.nlm.nih.gov/clinvar/variation/14104/
gnomAD: 0.00003185, https://gnomad.broadinstitute.org/variant/14-23895180-G-A
Supplementary Data, Table 2
Variant noted to be present in 7 individuals
Variant: NM_000257.3(MYH7):c.2093T>C (p.Val698Ala)
ClinVar: 42878, https://www.ncbi.nlm.nih.gov/clinvar/variation/42878/
gnomAD: n/a
CaseMYH7-21: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: 1 other proband shares this genotype
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.2389G>A (p.Ala797Thr)
ClinVar: 42901 https://www.ncbi.nlm.nih.gov/clinvar/variation/42901/
gnomAD: African 1.230e-4, Overall 2.386e-5 https://gnomad.broadinstitute.org/variant/14-23894525-C-T
CaseMYH7-34: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.1370T>C (p.Ile457Thr)
ClinVar: 42840 https://www.ncbi.nlm.nih.gov/clinvar/variation/42840/
gnomAD: European (Non-Finnish) 8.790e-6, Overall 3.976e-6 https://gnomad.broadinstitute.org/variant/14-23898201-A-G
CaseMYH7-25: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: 1 other proband shares this genotype
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.2207T>C (p.Ile736Thr)
ClinVar: 164342 https://www.ncbi.nlm.nih.gov/clinvar/variation/164342/
gnomAD: Not in gnomAD
CaseMYH7-28: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.2155C>T (p.Arg719Trp)
ClinVar: 14104 https://www.ncbi.nlm.nih.gov/clinvar/variation/14104/
gnomAD: European (Non-Finnish) 6.481e-5, Overall 3.185e-5 https://gnomad.broadinstitute.org/variant/14-23895180-G-A
CaseMYH7-36: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.1208G>A (p.Arg403Gln)
ClinVar: 14087 https://www.ncbi.nlm.nih.gov/clinvar/variation/14087/
gnomAD: Not in gnomAD
CaseMYH7-24: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.2221G>T (p.Gly741Trp)
ClinVar: 177665 https://www.ncbi.nlm.nih.gov/clinvar/variation/177665/
gnomAD: Not in gnomAD
CaseMYH7-6: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: 2 other probands have this genotype
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.4135G>A (p.Ala1379Thr)
ClinVar: 42993 https://www.ncbi.nlm.nih.gov/clinvar/variation/42993/
gnomAD: Latino 2.822e-5, Overall 3.535e-6 https://gnomad.broadinstitute.org/variant/14-23887453-C-T
CaseMYH7-37: Australia
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was isolated from peripheral blood. Most participants underwent testing from the Illumina Cardiomyopathy Sequencing Panel, which includes 46 cardiomyopathy related genes. For others, whole exome sequencing or Sanger squencing was used. After the results were returned, variants were filtered for pathogenicity and rarity.
Variant: NM_000257.3:c.1207C>T (p.Arg403Trp)
ClinVar: 14102 https://www.ncbi.nlm.nih.gov/clinvar/variation/14102/
gnomAD: Not in gnomAD
DiseaseAssertion: Hypertrophic Cardiomyopathy
VariantPreviousTesting: ACTC1, ACTN2, CSRP3, LAMP2, MYBPC3, MYH7, NEXN, PLN, TNNC1, TNNI3, TNNT2, TPM1, CAV3, GLA, MYL2, MYL3, MYOZ2, PRKAG2, and TTR were all tested via NGS.
VariantGenotypingMethod: Next-generation sequencing panels were used to sequence and read the genetic information of the 760 HCM probands for variants within exons and in +/- 10 nucleotides within the flanking introns of the genes provided above. These variants were then interpreted and filtered for pathogenicity.
VariantAddInfo: Seen in one HCM proband
Variant: NM_000257.4(MYH7):c.2332G>A (p.Asp778Asn)
ClinVarID: 181369 https://www.ncbi.nlm.nih.gov/clinvar/variation/181369/
gnomAD: Not in gnomAD
DiseaseAssertion: Hypertrophic Cardiomyopathy
VariantPreviousTesting: ACTC1, ACTN2, CSRP3, LAMP2, MYBPC3, MYH7, NEXN, PLN, TNNC1, TNNI3, TNNT2, TPM1, CAV3, GLA, MYL2, MYL3, MYOZ2, PRKAG2, and TTR were all tested via NGS.
VariantGenotypingMethod: Next-generation sequencing panels were used to sequence and read the genetic information of the 760 HCM probands for variants within exons and in +/- 10 nucleotides within the flanking introns of the genes provided above. These variants were then interpreted and filtered for pathogenicity.
VariantAddInfo: Seen in one proband
Variant: NM_000257.4(MYH7):c.1231G>A (p.Val411Ile)
ClinVarID: 181339 https://www.ncbi.nlm.nih.gov/clinvar/variation/181339/
gnomAD: 0.00005643, http://gnomad.broadinstitute.org/variant/14-23898464-C-T
DiseaseAssertion: None
VariantPreviousTesting: Some combination of ACTC1, ACTN2, CSRP3, LAMP2, MYBPC3, MYH7, NEXN, PLN, TNNC1, TNNI3, TNNT2, TPM1, ABCC9, CTF1, DES, EMD, LDB3, LMNA, MYH6, RBM20, SGCD, TAZ, TCAP, TTN, VCL, CAV3, GLA, MYL2, MYL3, MYOZ2, PRKAG2, TTR, DSC2, DSG2, DSP, JUP, PKP2, RYR2, TMEM43, CASQ2 and RYR2 were tested via NGS.
VariantGenotypingMethod: Next-generation sequencing panels were used to sequence and read the genetic information of probands for variants within exons and in +/- 10 nucleotides within the flanking introns of the genes provided above. These variants were then interpreted and filtered for pathogenicity.
Variant: NM_000257.4(MYH7):c.2360G>A (p.Arg787His)
ClinVar: 42900 https://www.ncbi.nlm.nih.gov/clinvar/variation/42900/
gnomAD: 0.001339, http://gnomad.broadinstitute.org/variant/14-23894554-C-T
DiseaseAssertion: Cardiomyopathy
VariantPreviousTesting: ACTC1, ACTN2, CSRP3, LAMP2, MYBPC3, MYH7, NEXN, PLN, TNNC1, TNNI3, TNNT2, TPM1, ABCC9, CTF1, DES, EMD, LDB3, LMNA, MYH6, RBM20, SGCD, TAZ, TCAP, TTN, VCL, CAV3, GLA, MYL2, MYL3, MYOZ2, PRKAG2, TTR, DSC2, DSG2, DSP, JUP, PKP2, RYR2, TMEM43, CASQ2 and RYR2 were all tested in the PanCM panel.
VariantGenotypingMethod: Next-generation sequencing panels were used to sequence and read the genetic information of the 305 PanCM probands for variants within exons and in +/- 10 nucleotides within the flanking introns of the genes provided above. These variants were then interpreted and filtered for pathogenicity.
VariantAddInfo: Seen in one PanCM proband
Variant: NM_000257.4(MYH7):c.2770G>A (p.Glu924Lys)
ClinVar: 14092 https://www.ncbi.nlm.nih.gov/clinvar/variation/14092/
gnomAD: Not in gnomAD
DiseaseAssertion: Hypertrophic Cardiomyopathy
VariantPreviousTesting: ACTC1, ACTN2, CSRP3, LAMP2, MYBPC3, MYH7, NEXN, PLN, TNNC1, TNNI3, TNNT2, TPM1, CAV3, GLA, MYL2, MYL3, MYOZ2, PRKAG2, and TTR were all tested via NGS.
VariantGenotypingMethod: Next-generation sequencing panels were used to sequence and read the genetic information of the 760 HCM probands for variants within exons and in +/- 10 nucleotides within the flanking introns of the genes provided above. These variants were then interpreted and filtered for pathogenicity.
VariantAddInfo: Seen in two HCM probands
Variant: NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln)
ClinVarID: 14107 https://www.ncbi.nlm.nih.gov/clinvar/variation/14107/
gnomAD: Not in gnomAD
DiseaseAssertion: Hypertrophic Cardiomyopathy
VariantPreviousTesting: ACTC1, ACTN2, CSRP3, LAMP2, MYBPC3, MYH7, NEXN, PLN, TNNC1, TNNI3, TNNT2, TPM1, CAV3, GLA, MYL2, MYL3, MYOZ2, PRKAG2, and TTR were all tested via NGS.
VariantGenotypingMethod: Next-generation sequencing panels were used to sequence and read the genetic information of the 760 HCM probands for variants within exons and in +/- 10 nucleotides within the flanking introns of the genes provided above. These variants were then interpreted and filtered for pathogenicity.
VariantAddInfo: Seen in two probands
Variant: NM_000257.4(MYH7):c.1207C>T (p.Arg403Trp)
ClinVarID: 14102 https://www.ncbi.nlm.nih.gov/clinvar/variation/14102/
gnomAD: Not in gnomAD
DiseaseAssertion: Hypertrophic Cardiomyopathy
VariantPreviousTesting: ACTC1, ACTN2, CSRP3, LAMP2, MYBPC3, MYH7, NEXN, PLN, TNNC1, TNNI3, TNNT2, TPM1, CAV3, GLA, MYL2, MYL3, MYOZ2, PRKAG2, and TTR were all tested via NGS.
VariantGenotypingMethod: Next-generation sequencing panels were used to sequence and read the genetic information of the 760 HCM probands for variants within exons and in +/- 10 nucleotides within the flanking introns of the genes provided above. These variants were then interpreted and filtered for pathogenicity.
VariantAddInfo: Seen in one HCM probands
Variant: NM_000257.4(MYH7):c.746G>A (p.Arg249Gln)
ClinVar: 14088 https://www.ncbi.nlm.nih.gov/clinvar/variation/14088/
gnomAD: Not in gnomAD
MYH7 R663H (n = 2)
Case: HCM mutation carrier
DiseaseAssertion: Hypertrophic cardiomyopathy
CasePresentingHPOs: n/a
CasePreviousTesting: n/a
CaseGenotypingMethod: n/a
Variant: NM_000257.4(MYH7):c.1988G>A (p.Arg663His), variant noted to be in 2 individuals utilized in this study
ClinVar: 42875, https://www.ncbi.nlm.nih.gov/clinvar/variation/42875/
gnomAD: 0.00001414, https://gnomad.broadinstitute.org/variant/14-23896042-C-T
Supplementary Data table 1
Case:
DiseaseAssertion: hypertrophic cardiomyopathy
CaseHPOFreeText: maximal wall thickness (MWT) ≥15 mm
CasePreviousTesting: Full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), Additional testing (TNNC1, CSRP3, TCAP, ABCC9, ACTN2, ANKRD1, BAG3, CALR3, CAV3, CRYAB, CTNNA3, DES, DSC2, DSG2, DSP, EMD, FHL1, GLA, JPH2, JUP, LAMA4, LAMP2, LDB3, LMNA, MIB1, MYH6, MYOZ2, MYPN, NEXN, PKP2, PLN, PRDM16, PRKAG2, RBM20, SCN5A, TAZ, TMEM43, TNNC1, TTN, TTR, VCL), electrocardiography
CaseGenotypingMethod: direct sequencing of all coding intron-exon boundaries of 12 genes (prior to 2012), next-generation sequencing (post 2012)
Variant: NM_000257.3(MYH7):c.1988G>A (p.Arg663His)
ClinVar: 42875, https://www.ncbi.nlm.nih.gov/clinvar/variation/42875/
gnomAD: 0.00001414, https://gnomad.broadinstitute.org/variant/14-23896042-C-T
Supplementary Data table 1
Variant noted to be present in 3 individuals
Variant: NM_000257.3(MYH7):c.976G>C (p.Ala326Pro)
ClinVar: 43117, https://www.ncbi.nlm.nih.gov/clinvar/variation/43117/
gnomAD: 0.00008846, https://gnomad.broadinstitute.org/variant/14-23899792-C-G
Supplementary Data table 1
Case:
DiseaseAssertion: hypertrophic cardiomyopathy
CaseHPOFreeText: maximal wall thickness (MWT) ≥15 mm
CasePreviousTesting: Full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), Additional testing (TNNC1, CSRP3, TCAP, ABCC9, ACTN2, ANKRD1, BAG3, CALR3, CAV3, CRYAB, CTNNA3, DES, DSC2, DSG2, DSP, EMD, FHL1, GLA, JPH2, JUP, LAMA4, LAMP2, LDB3, LMNA, MIB1, MYH6, MYOZ2, MYPN, NEXN, PKP2, PLN, PRDM16, PRKAG2, RBM20, SCN5A, TAZ, TMEM43, TNNC1, TTN, TTR, VCL), electrocardiography
CaseGenotypingMethod: direct sequencing of all coding intron-exon boundaries of 12 genes (prior to 2012), next-generation sequencing (post 2012)
Variant: NM_000257.3(MYH7):c.2945T>C (p.Met982Thr)
ClinVar: 42941, https://www.ncbi.nlm.nih.gov/clinvar/variation/42941/
gnomAD: 0.0008484, https://gnomad.broadinstitute.org/variant/14-23892910-A-G
Supplementary Data table 1
Variant noted to be present in 2 individuals
Variant: NM_000257.3(MYH7):c.1727A>G (p.His576Arg)
ClinVar: 177625, https://www.ncbi.nlm.nih.gov/clinvar/variation/177625/
gnomAD: 0.00001768, https://gnomad.broadinstitute.org/variant/14-23896955-T-C
Pedigree 2
Case: Pedigree 2 proband, male, 37yo at diagnosis, Iraqi‐Jewish
CasePresentingHPOs: HP:0001639, HP:0005110, HP:0001708, HP:0005180 (hypertrophic cardiomyopathy, atrial fibrillation, right heart failure, tricuspid regurgitation)
HPOsFreeText: clinical severity: moderate to asymptomatic
CaseNotHPOs:
NotHPOsFreeText: skeletal involvement
CasePreviousTesting: exact genes sequenced not specified
CaseGenotypingMethod: Fifty‐six genes known to cause HCM were sequenced in parallel
Variant: NM_000257.3(MYH7):c.427C>T (p.Arg143Trp)
ClinVar: 164401, https://www.ncbi.nlm.nih.gov/clinvar/variation/164401/
gnomAD: 0.00002784, https://gnomad.broadinstitute.org/variant/14-23901923-G-A
FamilyInfo: older brother had sudden death at 33yo with postmortem diagnosis of HCM, patient's siblings, aged 67 and 70, were also found to be heterozygous for this variant, though they are both clinically asymptomatic with no echocardiographic evidence of HCM
7
Case#: 7
DiseaseAssertion: HCM
FamilyInfo: None
CasePresentingHPOs: HP:0032092, HP:0031656, HP:0004756 (LV outflow tract obstruction, systolic anterior motion of the mitral valve, ventricular tachycardia)
CaseHPOFReeText: preserved ejection fraction (EF >60%)
Variant: NM_000257.4:c.1432A>G
ClinVar: 181347 https://www.ncbi.nlm.nih.gov/clinvar/variation/181347/
CAID: PA296828
gnomAD: not found
6
Case#: 6
DiseaseAssertion: HCM
FamilyInfo: None
CasePresentingHPOs: HP:0032092, HP:0031656, HP:0025168 (LV outflow tract obstruction, systolic anterior motion of the mitral valve, diastolic dysfunction)
CaseHPOFReeText: preserved ejection fraction (EF >60%)
Variant: NM_000257.3:c.1988G>A
ClinVar: 42875 https://www.ncbi.nlm.nih.gov/clinvar/variation/42875/
CAID: PA097667
gnomAD: 0.00003097 European (Non-Finnish) https://gnomad.broadinstitute.org/variant/14-23896042-C-T
One patient had reduced LVEF: a 44-year-old man, diagnosed with CM and a MYH7-mutation (c.5401G > A) at the age of 36 years. At age 44 years, he was diagnosed with dilated cardiomyopathy (DCM), LVIDD 74 mm, severe heart failure (LVEF 29%) and had an ICD implantation for primary prevention. The patient was later hospitalized for pulmonary oedema and is currently (age 48 years) awaiting a heart transplantation. There has been no anti-tachycardia pacing or shock therapy from the ICD.
Case: male, 44yo at diagnosis
DiseaseAssertion: Dilated cardiomyopathy (DCM)
CasePresentingHPOs: HP:0012664, HP:0001635, HP:0100598, HP:0001324, HP:0003388 (reduced ejection fraction, heart failure, pulmonary oedema, muscle weakness, fatigability)
HPOsFreeText: reduced LVEF (=29%), diagnosed with congenital myopathy at 36yo, LVIDD = 74mm, creatine kinase < 600 U/l, ICD implantation, waiting heart transplantation at 48yo
CaseNotHPOs:
NotHPOsFreeText: anti-tachycardia pacing or shock therapy from the ICD
CasePreviousTesting: ACTA1, BIN1, DNM2, MYH7, MTM1, NEB, RYR1, SCN4A, SEPN1, TPM2, TPM3
CaseGenotypingMethod: PCR amplification of exons of genes investigated and Sanger sequencing or NGS
Variant: NM_000257.4(MYH7):c.5401G>A (p.Glu1801Lys)
ClinVar: 43069, https://www.ncbi.nlm.nih.gov/clinvar/variation/43069/
gnomAD: absent
HCM506
Case#: HCM506, male, 19 yr, smoker
DiseaseAssertion: HCM
FamilyInfo: None
CasePresentingHPOs: 48mm LAD, 20mm LVST, 43mm LVEDD, 75% LVEF, 21mm Maxi LVWT, 59mmHg Maxi LVOTG, 104464396 raw RNA-seq reads, 98442104 HQ reads (94.24%), 96.88% mapping rate, 721500 total variant, 33453 exonic variant
CaseHPOFreeText: N/A
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
CaseGenotypingMethod: RNA-seq, read mapping, variant calling, identify functional variants, differential expression analysis, miRWalk miRNA target prediction, LncRNA annotation, Co-expression network analysis, PPI network analysis, gene over-representation analysis,
Variant: NM_000257.4(MYH7):c.1816G>A (p.Val606Met)
ClinVar: 14091 https://www.ncbi.nlm.nih.gov/clinvar/variation/14091/
CAID: N/A
gnomAD: 0.00001548 European (non-finnish) https://gnomad.broadinstitute.org/variant/14-23896866-C-T
HCM957
Case#: HCM957, male, 30 years,
DiseaseAssertion: HCM
FamilyInfo: Yes, no other HCM in family
CasePresentingHPOs: syncope (HP:0001279)
CaseHPOFreeText: inverted T-waves, ST-segment depression, left anterior branch block, 28mm MLVWT, 58% LVE F, 1.25 E/A ratio, LVOT-PG 7mm
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
CaseGenotypingMethod: sequencing, physical examination, ECG, 3D modeling, statistical analysis
MultipleGeneVariants:
(1) Variant: NM_000257.4(MYH7):c.2360G>A (p.Arg787His)
ClinVar: 42900 https://www.ncbi.nlm.nih.gov/clinvar/variation/42900/
CAID: N/A
gnomAD: 0.001339 South Asian https://gnomad.broadinstitute.org/variant/14-23894554-C-T
(2) Variant: NM_000257.4(MYH7):c.5561C>T (p.Thr1854Met)
ClinVar: 161320 https://www.ncbi.nlm.nih.gov/clinvar/variation/161320/
CAID: N/A
gnomAD: 0.00005423 European (Non-Finnish) https://gnomad.broadinstitute.org/variant/14-23883310-G-A
HCM275
Case#: HCM275, male, 59 years, I-1
DiseaseAssertion: HCM
FamilyInfo: Yes, daughter has HCM
CasePresentingHPOs: syncope (HP:0001279)
CaseHPOFreeText: inverted T-waves, ST-segment depression, 28mm MLVWT, 65% LVE F, 1.3 E/A ratio, LVOT-PG 68mm
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
CaseGenotypingMethod: sequencing, physical examination, ECG, 3D modeling, statistical analysis
MultipleGeneVariants:
(1) Variant: NM_000257.4(MYH7):c.2081G>A (p.Arg694His)
ClinVar: 264068 https://www.ncbi.nlm.nih.gov/clinvar/variation/264068/
CAID: N/A
gnomAD: 0.00004008 African/African-American https://gnomad.broadinstitute.org/variant/14-23895254-C-T
(2) Variant: NM_000257.4(MYH7):c.4985G>A (p.Arg1662His)
ClinVar: 43049 https://www.ncbi.nlm.nih.gov/clinvar/variation/43049/
CAID: N/A
gnomAD: 0.0002894 Ashkenazi Jewish https://gnomad.broadinstitute.org/variant/14-23885010-C-T
Supplementary Data: Online Table 2a
Case:
CasePresentingHPOs: HP:0001642 (pulmonary stenosis)
CasePreviousTesting: Full sarcomere testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), Additional testing (ABCC9, ACTN2, ANKRD1, BAG3, CALR3, CRYAB, CSRP3, DES, DMD, DSC2, DSG2, DSP, EMD, GLA, JPH2, JUP, LAMA4, LAMP2, LMNA, MYH6, MYPN, MYOZ1, MYOZ2, PKP2, PLN, PRKAG2, RBM20, RYR2, SCN5A, SGCD, TAZ, TCAP, TMEM43, TNNC1, TTN, VCL and LDB3)
CaseGenotypingMethod: DNA isolated from peripheral blood, targeted enrichment, next-gen sequencing with panel of 46 genes
Variant: NM_000257.3(MYH7):c.1325G>A (p.Arg442His)
ClinVar: 181342, https://www.ncbi.nlm.nih.gov/clinvar/variation/181342/
gnomAD: 0.00001414, https://gnomad.broadinstitute.org/variant/14-23898246-C-T
Supplementary Data: Online Table 1a
Case:
CasePreviousTesting: Full sarcomere testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), Additional testing (ABCC9, ACTN2, ANKRD1, BAG3, CALR3, CRYAB, CSRP3, DES, DMD, DSC2, DSG2, DSP, EMD, GLA, JPH2, JUP, LAMA4, LAMP2, LMNA, MYH6, MYPN, MYOZ1, MYOZ2, PKP2, PLN, PRKAG2, RBM20, RYR2, SCN5A, SGCD, TAZ, TCAP, TMEM43, TNNC1, TTN, VCL and LDB3)
CaseGenotypingMethod: DNA isolated from peripheral blood, targeted enrichment, next-gen sequencing with panel of 46 genes
Variant: NM_000257.3(MYH7):c.732+1G>A
ClinVar: 14127, https://www.ncbi.nlm.nih.gov/clinvar/variation/14127/
gnomAD: 0.000003976, https://gnomad.broadinstitute.org/variant/14-23900793-C-T
Supplementary Data: S2 Table
Case 135: Spanish, 50yo, Male
DiseaseAssertion: Hypertrophic Cardiomyopathy
CasePreviousTesting: Full Testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data table S1
CaseGenotypingMethod: genomic DNA obtained from blood or saliva, Next-gen sequencing panels of 55 or 78 genes
Variant: NM_000257.3(MYH7):c.958G>A (p.Val320Met)
ClinVar: 161328, https://www.ncbi.nlm.nih.gov/clinvar/variation/161328/
gnomAD: 0.00001591, https://gnomad.broadinstitute.org/variant/14-23899810-C-T
Supplementary Data: S2 Table
Case 193: Spanish, 47yo, Male
DiseaseAssertion: Hypertrophic Cardiomyopathy
CasePreviousTesting: Full Testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data table S1
CaseGenotypingMethod: genomic DNA obtained from blood or saliva, Next-gen sequencing panels of 55 or 78 genes
Variant: NM_000257.3(MYH7):c.2389G>A (p.Ala797Thr)
ClinVar: 42901, https://www.ncbi.nlm.nih.gov/clinvar/variation/42901/
gnomAD: 0.00002386, https://gnomad.broadinstitute.org/variant/14-23894525-C-T
Supplementary Data: S2 Table
Case 121: Spanish, 23yo, Male
DiseaseAssertion: Hypertrophic Cardiomyopathy
CasePreviousTesting: Full Testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data table S1
CaseGenotypingMethod: genomic DNA obtained from blood or saliva, Next-gen sequencing panels of 55 or 78 genes
Variant: NM_000257.3(MYH7):c.2221G>C (p.Gly741Arg)
ClinVar: 14098, https://www.ncbi.nlm.nih.gov/clinvar/variation/14098/
gnomAD: n/a
MultipleGeneVariants:
(1) TTN Variants:
Variant1: NM_133378.4(TTN):c.52301A>G
ClinVar: 47157, https://www.ncbi.nlm.nih.gov/clinvar/variation/47157/
gnomAD: 0.0005511, https://gnomad.broadinstitute.org/variant/2-179456541-T-C
Variant2: NM_133378.4:c.50516C>G
CAID: CA349508241, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_133378.4%3Ac.50516C%3EG
gnomAD: n/a
Supplementary Data: S2 Table
Case 160: Spanish, 67yo, Female
DiseaseAssertion: Hypertrophic Cardiomyopathy
CasePreviousTesting: Full Testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data table S1
CaseGenotypingMethod: genomic DNA obtained from blood or saliva, Next-gen sequencing panels of 55 or 78 genes
Variant: NM_000257.3(MYH7):c.2389G>A (p.Ala797Thr)
ClinVar: 42901, https://www.ncbi.nlm.nih.gov/clinvar/variation/42901/
gnomAD: 0.00002386, https://gnomad.broadinstitute.org/variant/14-23894525-C-T
MultipleGeneVariants:
(1) TTN Variant:
Variant: NM_133378.4:c.78641C>T
CAID: CA1988519, http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvs=NM_133378.4%3Ac.78641C%3ET
gnomAD: 0.00001646, https://gnomad.broadinstitute.org/variant/2-179424514-G-A
Supplementary Data: S2 Table
Case 2: Spanish, 14yo, Male
DiseaseAssertion: Hypertrophic Cardiomyopathy
CasePreviousTesting: Full Testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing listed in supplementary data table S1
CaseGenotypingMethod: genomic DNA obtained from blood or saliva, PCR, Sanger Sequencing
Variant: NM_000257.3(MYH7):c.1012G>A (p.Val338Met)
ClinVar: 164381, https://www.ncbi.nlm.nih.gov/clinvar/variation/164381/
gnomAD: n/a
HCM003
CaseHCM003: 31 yrs report, Vietnam, Asian
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0002875, HP:0031295, HP:0006698, HP:0001705 (Exertional dyspnea, Left atrial enlargement, Dilatation of the ventricular cavity, Right ventricular outlet obstruction)
HPOsFreeText: Maximal LV thickness 29 mm
CaseNotHPOs: HP:0005110, HP:0001297, HP:0004756 (Atrial fibrillation, Stroke, Ventricular tachycardia)
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: The gene panel included 10 sarcomeric genes (MYH7, MYBPC3, TNNT2, TNNI3, TPM1, MYL2, MYL3, ACTC1, TNNC1, MYH6), 9 genes encoding Z-disk components and Ca2+ homeostasis factors (LDB3, CSRP3, TCAP, VCL, ACTN2, MYOZ2, NEXN, JPH2, PLN), and 4 genes involved in HCM phenocopies (GLA, LAMP2, PRKAG2, TTR), All probands had left ventricular wall thickness >= 15 mm and no other diseases that can cause secondary hypertrophy
CaseGenotypingMethod: The coding region, flanking sequences, and untranslated regions of each gene were enriched by LC-PCR, amplified, and sequenced on the Illumina MiSeq or MiniSeq platform. Identified variants were then filtered for pathogenicity and confirmed by Sanger sequencing.
Variant: NM_000257.4(MYH7):c.2207T>C (p.Ile736Thr)
ClinVar: 164342 https://www.ncbi.nlm.nih.gov/clinvar/variation/164342/
gnomAD: Not in gnomAD
Supplementary Data Table S3
Case: 329
DiseaseEntity: HCM
HPOsFreeText: left ventricular hypertrophy (LVH) ≥15 mm
InheritancePattern: n/a
CasePreviousTesting: MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1 (59 genes total tested)
CaseGenotypingMethod: NGS of 59 genes (Supplemental Table S1), pathogenic and likely pathogenic variants confirmed via Sanger Sequencing
Variant1: NM_000257.4(MYH7):c.3158G>A (p.Arg1053Gln)
ClinVar: 155814 https://www.ncbi.nlm.nih.gov/clinvar/variation/155814/
gnomAD: 0.0006368, https://gnomad.broadinstitute.org/variant/14-23891476-C-T
Variant2: NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys)
ClinVar: 43020 https://www.ncbi.nlm.nih.gov/clinvar/variation/43020/
gnomAD: 0.01265, https://gnomad.broadinstitute.org/variant/14-23886409-G-C
Supplementary Data Table S3
Case: 154
DiseaseEntity: HCM
HPOsFreeText: left ventricular hypertrophy (LVH) ≥15 mm
InheritancePattern: n/a
CasePreviousTesting: MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1 (59 genes total tested)
CaseGenotypingMethod: NGS of 59 genes (Supplemental Table S1), pathogenic and likely pathogenic variants confirmed via Sanger Sequencing
Variant: NM_000257.4(MYH7):c.3158G>A (p.Arg1053Gln)
ClinVar: 155814 https://www.ncbi.nlm.nih.gov/clinvar/variation/155814/
gnomAD: 0.0006368, https://gnomad.broadinstitute.org/variant/14-23891476-C-T
MultipleGeneVariants:
(1) FBN1 Variant
Variant: NM_000138.4(FBN1):c.3077T>C (p.Phe1026Ser)
ClinVar: 199948 https://www.ncbi.nlm.nih.gov/clinvar/variation/199948/
gnomAD: 0.006608, https://gnomad.broadinstitute.org/variant/15-48782053-A-G
(2) JUP Variant
Variant: NM_002230.4(JUP):c.1942G>A (p.Val648Ile)
ClinVar: 45842 https://www.ncbi.nlm.nih.gov/clinvar/variation/45842/
gnomAD: 0.01341, https://gnomad.broadinstitute.org/variant/17-39913771-C-T
Supplementary Data Table S3
Case: 204
DiseaseEntity: HCM
HPOsFreeText: left ventricular hypertrophy (LVH) ≥15 mm
InheritancePattern: n/a
CasePreviousTesting: MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1 (59 genes total tested)
CaseGenotypingMethod: NGS of 59 genes (Supplemental Table S1), pathogenic and likely pathogenic variants confirmed via Sanger Sequencing
Variant: NM_000257.4(MYH7):c.3158G>A (p.Arg1053Gln)
ClinVar: 155814 https://www.ncbi.nlm.nih.gov/clinvar/variation/155814/
gnomAD: 0.0006368, https://gnomad.broadinstitute.org/variant/14-23891476-C-T
Supplementary Data Table S3
Case: 145
DiseaseEntity: HCM
HPOsFreeText: left ventricular hypertrophy (LVH) ≥15 mm
InheritancePattern: n/a
CasePreviousTesting: MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1 (59 genes total tested)
CaseGenotypingMethod: NGS of 59 genes (Supplemental Table S1), pathogenic and likely pathogenic variants confirmed via Sanger Sequencing
Variant1: NM_000257.4(MYH7):c.1816G>A (p.Val606Met)
ClinVar: 14091 https://www.ncbi.nlm.nih.gov/clinvar/variation/14091/
gnomAD: 0.00001548, https://gnomad.broadinstitute.org/variant/14-23896866-C-T
Variant2: NM_000257.4(MYH7):c.3853+7C>T
ClinVar: 42977 https://www.ncbi.nlm.nih.gov/clinvar/variation/42977/
gnomAD: 0.003956, https://gnomad.broadinstitute.org/variant/14-23888685-G-A
MultipleGeneVariants:
(1) SDHA Variant
Variant: NM_004168.4(SDHA):c.1886A>T (p.Tyr629Phe)
ClinVar: 224949 https://www.ncbi.nlm.nih.gov/clinvar/variation/224949/
gnomAD: 0.5249, https://gnomad.broadinstitute.org/variant/5-254599-A-T
(2) TMPO Variant
Variant: NM_001032283.2(TMPO):c.859G>C (p.Ala287Pro)
ClinVar: 43693 https://www.ncbi.nlm.nih.gov/clinvar/variation/43693/
gnomAD: 0.04732, https://gnomad.broadinstitute.org/variant/12-98938295-G-C
Supplementary Data Table S3
Case: 355
DiseaseEntity: HCM
HPOsFreeText: left ventricular hypertrophy (LVH) ≥15 mm
InheritancePattern: n/a
CasePreviousTesting: MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1 (59 genes total tested)
CaseGenotypingMethod: NGS of 59 genes (Supplemental Table S1), pathogenic and likely pathogenic variants confirmed via Sanger Sequencing
Variant: NM_000257.4(MYH7):c.2945T>C (p.Met982Thr)
ClinVar: 42941 https://www.ncbi.nlm.nih.gov/clinvar/variation/42941/
gnomAD: 0.001416, https://gnomad.broadinstitute.org/variant/14-23892910-A-G
MultipleGeneVariants:
(1) MYBPC3 Variant
Variant: NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His)
ClinVar: 177689 https://www.ncbi.nlm.nih.gov/clinvar/variation/177689/
gnomAD: 0.01063, https://gnomad.broadinstitute.org/variant/11-47354442-C-T
Supplementary Data Table S3
Case: 19
DiseaseEntity: HCM
HPOsFreeText: left ventricular hypertrophy (LVH) ≥15 mm
InheritancePattern: n/a
CasePreviousTesting: MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1 (59 genes total tested)
CaseGenotypingMethod: NGS of 59 genes (Supplemental Table S1), pathogenic and likely pathogenic variants confirmed via Sanger Sequencing
Variant: NM_000257.4(MYH7):c.3158G>A (p.Arg1053Gln)
ClinVar: 155814, https://www.ncbi.nlm.nih.gov/clinvar/variation/155814/
gnomAD: 0.00006010, https://gnomad.broadinstitute.org/variant/14-23891476-C-T
Supplementary Data Table S3
Case: 46
DiseaseEntity: HCM
HPOsFreeText: left ventricular hypertrophy (LVH) ≥15 mm
InheritancePattern: n/a
CasePreviousTesting: MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1 (59 genes total tested)
CaseGenotypingMethod: NGS of 59 genes (Supplemental Table S1), pathogenic and likely pathogenic variants confirmed via Sanger Sequencing
Variant: NM_000257.4(MYH7):c.3158G>A (p.Arg1053Gln)
ClinVar: 155814, https://www.ncbi.nlm.nih.gov/clinvar/variation/155814/
gnomAD: 0.00006010, https://gnomad.broadinstitute.org/variant/14-23891476-C-T
MultipleGeneVariants:
(1) EYA4 Variant
Variant: NM_004100.5(EYA4):c.1495G>A (p.Val499Ile)
ClinVar: 534385, https://www.ncbi.nlm.nih.gov/clinvar/variation/534385/
gnomAD: 0.0002548, https://gnomad.broadinstitute.org/variant/6-133834170-G-A
(2) FKTN Variant
Variant: NM_006731.2(FKTN):c.1297A>G (p.Thr433Ala)
ClinVar: 36137, https://www.ncbi.nlm.nih.gov/clinvar/variation/36137/
gnomAD: 0.002206, https://gnomad.broadinstitute.org/variant/9-108397456-A-G
Table 1 and 4
Case A12: Female, 21yo
DiseaseAssertion: HCM
FamilyInfo: positive family history
CaseHPOFreeText: interventricular septum thickness = 25.9mm, left ventricular end diastolic diameter = 32.0mm, left ventricular end systolic diameter = 18.4mm, left ventricular posterior wall thickness = 9.4mm, left atrium = 26.9mm, left ventricular ejection fraction = 75%
CasePreviousTesting: 12-lead ECG, echocardiography, full testing (MYBPC3, TNNT2, TNNI3, MYL2, MYL3, TPM1, ACTC1), additional testing (LMNA, PRKAG2, SCN5A, MYH6)
CaseGenotypingMethod: genomic DNA collected from peripheral whole blood samples, PCR, high-throughput sequencing using PGM Sequencing 400 kit, variants verified via Sanger Sequencing
Variant: NM_000257.3(MYH7):c.2155C>T (p.Arg719Trp)
ClinVar: 14104, https://www.ncbi.nlm.nih.gov/clinvar/variation/14104/
gnomAD: 0.00003185, https://gnomad.broadinstitute.org/variant/14-23895180-G-A
CaseCM1839: Female, 12 years diagnosis, Japan, Asian
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)
NotHPOsFreeText: Neuromuscular disease, Malformation syndromes
CaseAddInfo: Positive family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2
CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.
CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.
Variant: NM_000257.3:c.2221G>T (p.Gly741Trp)
ClinVar: 177665 https://www.ncbi.nlm.nih.gov/clinvar/variation/177665/
gnomAD: Not in gnomAD
MultipleGeneVariants:
(1) BAG3 Variant Variant: NM_004281.3:c.1015A>G (p.Ile339Val)
ClinVar: 228453 https://www.ncbi.nlm.nih.gov/clinvar/variation/228453/
gnomAD: East Asian 5.437e-5, Overall 3.976e-6 https://gnomad.broadinstitute.org/variant/10-121436081-A-G
CaseCM1871: Male, 0 years diagnosis, Japan, Asian
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)
NotHPOsFreeText: Neuromuscular disease, Malformation syndromes
CaseAddInfo: No family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2, Mother shows negative for this variant with no symptoms
CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.
CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.
Variant: NM_000257.3:c.2608C>T (p.Arg870Cys)
ClinVar: 161326 https://www.ncbi.nlm.nih.gov/clinvar/variation/161326/
gnomAD: Ashkenazi Jewish 9.923e-5, Overall 2.386e-5 https://gnomad.broadinstitute.org/variant/14-23894049-G-A
CaseCM1844: Male, 6 years diagnosis, Japan, Asian
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: HP:0001939 (Abnormality of metabolism/homeostasis)
NotHPOsFreeText: Neuromuscular disease, Malformation syndromes
CaseAddInfo: No family history of cardiomyopathy or sudden death, Proband found in Supplementary Table 2, Mother and father are both negative for this variant
CasePreviousTesting: 8 patients with HCM and one with RCM were analyzed by NGS for the eight sarcomere-encoding genes and MYP.
CaseGenotypingMethod: Probands were subject to PCR amplification and direct sequencing of 64 cardiomyopathy-associated genes, including the eight sarcomere-encoding genes. The variants were then filtered for rarity and tested for pathogenicity.
Variant: NM_000257.3:c.1357C>T (p.Arg453Cys)
ClinVar: 14089 https://www.ncbi.nlm.nih.gov/clinvar/variation/14089/
gnomAD: Not in gnomAD
21
CaseVI: Brazil, Caucasian
DiseaseAssertion: Hypertrophic cardiomyopathy
FamilyInfo: Family history of HCM
CasePresentingHPOs: HP:0001712, HP:0001639 (Left ventricular hypertrophy, Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: Only MYH7, MYBPC3, and TNNT2 were tested.
CaseGenotypingMethod: DNA was extracted from peripheral blood and the above genes were subject to PCR amplification and directly sequenced. The resulting sequences were compared with the reference and filtered for pathogenicity.
Variant: NM_000257.3:c.2389G>A (p.Ala797Thr)
ClinVar: 42901 https://www.ncbi.nlm.nih.gov/clinvar/variation/42901/
gnomAD: African 1.230e-4, Overall 2.386e-5 https://gnomad.broadinstitute.org/variant/14-23894525-C-T
HCM1.1
CaseHCM1.1: Indian
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: HP:0000819 (Diabetes mellitus)
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was extracted from the probands' blood, followed by sequencing of the coding regions and exon/intron boundaries of 15 genes associated with HCM. From there, they were amplified by PCR ampliication and variants were filtered by pathogenicity. Every unclassified variant was confirmed by Sanger sequencing afterwards.
Variant: NM_000257.3:c.611G>A (p.Arg204His)
ClinVar: 43095 https://www.ncbi.nlm.nih.gov/clinvar/variation/43095/
gnomAD: East Asian 5.012e-5, Overall 1.767e-5 https://gnomad.broadinstitute.org/variant/14-23900998-C-T
HCM34.1
CaseHCM34.1: Mixed ancestry
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: HP:0000819 (Diabetes mellitus)
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was extracted from the probands' blood, followed by sequencing of the coding regions and exon/intron boundaries of 15 genes associated with HCM. From there, they were amplified by PCR ampliication and variants were filtered by pathogenicity. Every unclassified variant was confirmed by Sanger sequencing afterwards.
Variant: NM_000257.3:c.1357C>T (p.Arg453Cys)
ClinVar: 14089 https://www.ncbi.nlm.nih.gov/clinvar/variation/14089/
gnomAD: Not in gnomAD
HCM14.1
CaseHCM14.1: Mixed ancestry
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: N/A
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: HP:0000819 (Diabetes mellitus)
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See Table 1
CaseGenotypingMethod: DNA was extracted from the probands' blood, followed by sequencing of the coding regions and exon/intron boundaries of 15 genes associated with HCM. From there, they were amplified by PCR ampliication and variants were filtered by pathogenicity. Every unclassified variant was confirmed by Sanger sequencing afterwards.
Variant: NM_000257.3:c.2167C>T (p.Arg723Cys)
ClinVar: 14095 https://www.ncbi.nlm.nih.gov/clinvar/variation/14095/
gnomAD: South Asian 3.266e-5, Overall 1.194e-5 https://gnomad.broadinstitute.org/variant/14-23895023-G-A
CasePT-38: United States
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: N/A
CaseNotHPOs: HP:0001650, HP:0001658 (Aortic valve stenosis, Myocardial infarction)
NotHPOsFreeText: N/A
CaseAddInfo: Two other siblings have the same genotype
CaseGenotypingMethod: DNA was collected from the participants using blood samples. 18 genes suspected on contributing to HCM were targeted and sequenced. The variants were then located and filtered for pathogenicity.
Variant: NM_000257.3:c.727C>T (p.Arg243Cys)
ClinVar: 43101 https://www.ncbi.nlm.nih.gov/clinvar/variation/43101/
gnomAD: European (Non-Finnish) 6.482e-5, Overall 3.184e-5 https://gnomad.broadinstitute.org/variant/14-23900799-G-A
Family B, II:1
CaseBII-1: Male, 23 years diagnosis, China, Asian
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: No family history, pedigree provided
CasePresentingHPOs: HP:0001639, HP:0100749 (Hypertrophic cardiomyopathy, Chest pain)
HPOsFreeText: Interventricular septal thickness at 15.6 mm, Left ventricular posterior wall thickness at 12.1 mm
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: Parents tested negative for variant, therefore it is asserted as de novo
CasePreviousTesting: See list of sequenced genes
CaseGenotypingMethod: Genomic DNA was isolated from whole blood of all patients and controls. Whole coding exons and exon-intron boundaries of the 19 HCM-related genes listed above were amplified and sequenced on Ion Torrent PGM. These variants were then filtered for pathogenicity and compared to the controls. Any mutations found were confirmed by conventional dideoxy sequencing and Sanger sequencing.
Variant: NM_000257.3:c.2572C>T (p.Arg858Cys)
ClinVar: 164324 https://www.ncbi.nlm.nih.gov/clinvar/variation/164324/
gnomAD: Not in gnomAD
A14
CaseA14: Female, 44 years report, China, Asian
DiseaseAssertion: Hypertrophic Cardiomyopathy
FamilyInfo: No family history
CasePresentingHPOs: HP:0001639 (Hypertrophic cardiomyopathy)
HPOsFreeText: Interventricular septal thickness at 17.6 mm, Left ventricular posterior wall thickness at 8.8 mm, Left ventricular end-diastolic diameter at 42.7 mm, Left ventricular septal thickness at 36.6 mm, Left ventricular ejection fraction at 68%
CaseNotHPOs: N/A
NotHPOsFreeText: N/A
CaseAddInfo: N/A
CasePreviousTesting: See list of sequenced genes
CaseGenotypingMethod: Genomic DNA was isolated from whole blood of all patients and controls. Whole coding exons and exon-intron boundaries of the 19 HCM-related genes listed above were amplified and sequenced on Ion Torrent PGM. These variants were then filtered for pathogenicity and compared to the controls. Any mutations found were confirmed by conventional dideoxy sequencing and Sanger sequencing.
Variant: NM_000257.3:c.161G>A (p.Arg54Gln)
ClinVar: 42856 https://www.ncbi.nlm.nih.gov/clinvar/variation/42856/
gnomAD: East Asian 2.506e-4, Overall 2.475e-5 https://gnomad.broadinstitute.org/variant/14-23902781-C-T
At 21 h post-transfection, the EGFP-tagged MyHC-slow was distributed throughout the cytoplasm, aggregating into discrete structures. The wild-type aggregates formed long, filamentous structures (Fig. 6A, B). The Arg1712Trp mutant MyHC-slow instead formed many small, round inclusions (Fig. 6C).
ExperimentalAssay
Variant: NM_000257.4(MYH7):c.5134C>T (p.Arg1712Trp), homozygous
ClinVar: 14118, https://www.ncbi.nlm.nih.gov/clinvar/variation/14118/
Case298: Female, 6 years onset, Japan, Asian
DiseaseAssertion: Left ventricular noncompaction
CasePresentingHPOs: HP:0030682 (Left ventricular noncompaction)
HPOsFreeText: Left Ventricular Ejection Fraction at 65%, LVDD-Z score at 2.1
CaseNotHPOs: HP:0011675 (Arrhythmia)
NotHPOsFreeText: Congenital heart disease with significant hemodynamic changes
CaseAddInfo: No family history
CasePreviousTesting: Genes tested include the 8 sarcomere genes as well as 65 more listed in Table S1.
CaseGenotypingMethod: Genomic DNA was extracted from whole blood from each of the probands. Next Generation Sequencing of 73 genes related to cardiac function was performed, incorporating PCR amplification, and any variants found were subjected to filtering for frequency and pathogenicity. Any variants suggested to be pathogenic were confirmed by Sanger sequencing afterwards.
Variant: NM_000257.3:c.2710C>T (p.Arg904Cys)
ClinVar: 164316 https://www.ncbi.nlm.nih.gov/clinvar/variation/164316/
gnomAD: Ashkenazi Jewish 9.921e-5, Overall 3.977e-6 https://gnomad.broadinstitute.org/variant/14-23893328-G-A
24
Case#: 24
DiseaseAssertion: LVNC
FamilyInfo: N/A
CasePresentingHPOs: N/A
CaseHPOFreeText: 5.9 Fathmm, 0 sift, 0.984 polyphen2, 0 GVGD, mutation taster 1, -4.96 provean, -6.07 CADD
CaseNotHPOs: N/A
CaseNotHPOFreeText: N/A
CasePreviousTesting: N/A
CaseGenotypingMethod: physical examination, ECG, variant screening and classification, genic collapsing test, group statistical analysis
Variant: NM_000257.4(MYH7):c.689T>C (p.Phe230Ser)
ClinVar: 263543 https://www.ncbi.nlm.nih.gov/clinvar/variation/263543/
CAID: N/A
gnomAD: absent