PatientID: 3

KindredID: 3

Case: M, 15Y0M, Ethnicity Unknown

DiseaseAssertion: adrenal pheochromocytoma

FamilyInfo: None - The family history was negative for hypertension, PHEO or other neuroendocrine tumours. Their parents however, decided not to be tested neither to extend the test to other family members

CasePresentingHPOs: HP:0006748 (adrenal pheochromocytoma)

CaseHPOFreeText: Apparently sporadic pheo. He had a history of occipital headache, slightly elevated blood pressure with normal ophthalmological examination for 2 months was found to have a 4-cm-diameter left adrenal mass at MRI, being the abdominal sonography negative. He underwent surgery of the pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D197N (c.589G>A)

LegacyVariant: p.D197N (g.13,278)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756524 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.589G%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: D197N (c.589G>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: M, 29Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: His elder sister also had features suggestive of Type 1 VHL syndrome (cerebellar hemangioblastomas, RCC of the left kidney, bilateral renal cysts, and pancreatic serous cystic neoplasm). However, her adrenal glands were normal. None of the other family members have features suggestive of VHL syndrome.

CasePresentingHPOs: HP:0009713; HP:0000822; HP:0006770; HP:0005562; HP:0001737; HP:0008256 (Spinal Hemangioblastoma, Hypertension, Clear cell renal cell carcinoma, Multiple renal cysts, Pancreatic cysts, Adrenocortical adenoma)

CaseHPOFreeText: CT of the abdomen revealed a lesion in the left adrenal gland having central necrosis. There was more than 50% washout in postcontrast delayed image suggestive of adrenal adenoma (later confirmed by immunohistochemistry to be an adrenocortical adenoma). In bilateral kidneys, there were multiple lesions with intense enhancement (RCC - morphological features were compatible with the clear cell type of RCC) along with nonenhancing cystic areas (renal cysts). Pancreas also showed multiple well-defined fluid attenuating cysts.

CaseNotHPOs: HP:000266; HP:0001962; HP:0003118; HP:0001069 (Pheochromocytoma, Palpitations, Increased circulating cortisol level, Episodic hyperhidrosis)

CaseNotHPOFreeText: No history of paroxysm of sweating or palpitation nor any stigmata of hypercortisolism. Immunochemistry excluded the possibility of the adrenal lesion being pheochromocytoma.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.340+1G>A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223190, https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.340+1G>A)

MultipleGeneVariants: N/A

PatientID: IV-19

KindredID: 1

Case: F, 25Y0M, Iranian

DiseaseAssertion: assumed VHL

FamilyInfo: Familial history was positive. See Fig 1. A total of 43 members of the kindred, 24 males and 19 females, aged 2-77 years were reached for evaluation. It is stated in the paper that all affected subjects (13) were positive for the same mutation (c.500G>A). Additionally, gene sequencing revealed that 4 asymptomatic members of the kindred also harbored the pathogenic mutation. Phenotypes include pheochromocytoma, hemangioblastoma, and retinal HB.

CasePresentingHPOs: HP:0002666; HP:0006880 (Pheochromocytoma, cerebellar hemangiomblastoma)

CaseHPOFreeText: Patient had a unilateral PCC and cerebellar HB at 23Y which was surgically removed at the time. She presently has no abnormal findings.

CaseNotHPOs: HP:0000077 (abnormality of the kidney)

CaseNotHPOFreeText: There was no case of kidney tumors among the kindred.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216, https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977, https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 2

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: hemangioblastoma

FamilyInfo: N/A - Not specified

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: VHL syndromic HB (both germline and somatic variants were observed

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R120_121S (c.360_362delAGA)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131861 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131861

gnomAD: N/A

VariantEvidence: A VHL subject in our patient population had a full length deletion (FLD) in the germline VHL gene, but a VHL gene tumor second hit mutation (c.360_362delAGA) causing an amino acid change of p.R120-121S detected in the HB tumor

MutationType: delins

CivicName: Deletion AND R120_121S (c.360_362delAGA)

MultipleGeneVariants: Germline, VHL, complete deletion

PatientID: 6

KindredID: 3

Case: F, 10Y0M, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: A family pedigree is provided in figure 1. Both the father and brother of patient 6 were found to have the same mutation. Her father had retinal, cerebellar and spinal hemangioblastomas, as well as retinal detachment. Her 7-year-old brother did not have any known tumours.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseNotHPOFreeText: Patient did not have retinal capillary hemangioma or other known tumours.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2217, https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: 12

KindredID: 6

Case: M, 12Y0M, Ethnicity Unknown

DiseaseAssertion: Hemangioblastom

FamilyInfo: A family pedigree is provided in figure 1. The patient’s father carried the same mutation as patient 12, but the father’s occurred de novo, as neither of the father’s parents carried the mutation. The patient’s father had cerebellar, retinal and bulbar hemangioblastomas, and retinal detachment. The patient’s 14-year-old brother (patient 11) was asymptomatic.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: Patient had a CNS hemangioblastoma.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: Patient did not have Retinal capillary hemangiomas.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.341+1_341–1(463*1_?)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: delins

CivicName: Null (c.341+1_341–1)

MultipleGeneVariants: N/A

PatientID: 8

KindredID: 4

Case: M, 14Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: A family pedigree is provided in figure 1. The parents of patient 8 were molecularly tested and neither possessed the mutation; thus, the mutation was identified as de novo. Neither parent had VHL syndrome characterized by retinal capillary hemangiomas (RCHs).

CasePresentingHPOs: HP:0006880; HP:0009711 (Cerebellar hemangioblastoma; Retinal capillary hemangioma)

CaseHPOFreeText: In 2019, a 14-year-old boy was diagnosed with visual impairment, due to visual acuity of 20/20 in the right eye and 20/640 in the left eye. Four peripheral RCHs were detected in the right eye. The visual impairment of the left eye was due to the severe exudative process involving the macula. Moreover, numerous microhemangioblastomas were revealed by fluorescein angiography. Laser therapy was performed in both eyes, but vitreous hemorrhage occurred in the left eye. Bevacizumab was given three times, as well simultaneous cryotherapies were performed under general anesthesia. Many laser sessions were performed for regression of the RCHs to occur. Further testing revealed a cerebellar hemangioblastoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: Patient did not have other known tumours.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R113* (c.337C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 220414, https://www.ncbi.nlm.nih.gov/clinvar/variation/220414/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R113* (c.337C>T)

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 4

Case: 29Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0030405; HP:0009711 (hemangioblastoma; renal cell carcinoma; pancreatic endocrine tumor; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2-3 deletion

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Stated in paper as “del ex 2.3”

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 22

KindredID: 22

Case: 33Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0009711 (hemangioblastoma; renal cell carcinoma; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2-3 deletion

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Stated in paper as “del ex 2.3”

MutationType: exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 21

KindredID: 21

Case: 23Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0009711 (hemangioblastoma; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.464-1G>T

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 223221 https://www.ncbi.nlm.nih.gov/clinvar/variation/223221/

CAID: N/A

gnomAD: N/A

VariantEvidence: Stated in paper as “IVS2-1G>T”

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: F, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: Positive. Patient's mother did not undergo genetic testing but had a hemangioblastoma at age 50 and a pancreatic cyst or tumour at age 62. The patient's sister (the proband) also had this mutation and presented with hemangioblastoma (age 35), retinal angioma (age 37), pancreatic cysts or tumours (age 37), and renal cell carcinoma (age 39). Another one of the patient's sisters presented with hemangioblastoma (age 40), renal cell carcinoma (age 43), and pancreatic cysts or tumours (age 43). This patient died before diagnosis. The proband's brother also died before diagnosis and presented with hemangioblastoma and retinal angioma at age 27.

CasePresentingHPOs: None

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666, HP:0009715, HP:0010797, HP:0005584, HP:0001732, HP:000971(pheochromocytoma, Papillary cystadenoma of the epididymis, hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Y98N (c.292T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750883 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 16

Case: Sex Unknown, 31Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The patient's father had a hemangioblastoma of the central nervous system at age 45. He was deceased before diagnosis could occur. The patient's sister, daughter, and nephew were all confirmed to have the same genetic mutation but were asymptomatic.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas)

CaseHPOFreeText: The patient presented with hemangioblastoma at age 18. Later at age 31, he/she presented with renal cell carcinoma and pancreatic cysts or tumours.

CaseNotHPOs: HP:0009711, HP:0002666, HP:0009715 (retinal capillary hemangioma, pheochromocytoma)

CaseNotHPOFreeText: The patient did not have epididymal or ovarian cystadenoma.

CasePreviousTesting: N/A

PreviouslyPublished:29330336

Variant: Exon 1 deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: None

KindredID: 7

Case: Unknown, 31Y0M, Chinese

DiseaseAssertion:VHL

FamilyInfo: None.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732, HP:0002666 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, pheochromocytoma)

CaseHPOFreeText:The patient presented with hemangioblastoma and pheochromocytoma at age 30. One year later he was found to have renal cell carcinoma and pancreatic cysts or tumors.

CaseNotHPOs: HP:0009711(retinal capillary hemangioma)

CaseNotHPOFreeText: No epididymal/ovarian cystadenomas.

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

Variant: p.V130L (c.388G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2229 https://www.ncbi.nlm.nih.gov/clinvar/variation/2229/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V130L (c.388G>C)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 5

Case: Sex Unknown, 54, Chinese

DiseaseAssertion:VHL

FamilyInfo: Positive. The patient's nephew and niece although did not undergo genetic testing, presented with VHL associated conditions. The nephew had renal cell carcinoma at age 34 and cysts or tumours of the pancreas at age 37. The niece had renal cell carcinoma and cysts or tumours of the pancreas at age 35.

CasePresentingHPOs: HP:0005584, HP:0001732 (renal cell carcinoma, abnormality of the pancreas)

CaseHPOFreeText: The patient had renal cell carcinoma at age 37 and cysts or tumours of the pancreas at age 54.

CaseNotHPOs: HP:0002666, HP:0009715, HP:0010797, HP:000971(pheochromocytoma, Papillary cystadenoma of the epididymis, hemangioblastoma, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

SupplementalData: N/A

Variant: p.Q73* (c.217C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223164 https://www.ncbi.nlm.nih.gov/clinvar/variation/223164/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: stop_gained

CivicName: Q73* (c.217C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: M, 34Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: None.

CasePresentingHPOs: HP:0000957, HP:0000997, HP:0009737, HP:0006880, HP:0010797, HP:0200034, HP:0005306, HP:0001067 (Cafe-au-lait spot, Axillary freckling, Lisch nodules, cerebellar hemangioblastoma, hemangioblastoma, Papule, Capillary hemangioma, Neurofibromas)

CaseHPOFreeText: Referred to dermatology for multiple bleeding papules, the lesions of concern were exophytic, red, vascular papules located on the right jawline, front of the right shoulder, left lower aspect of the back, and right lower aspect of the back, consistent with lobular capillary hemangiomas. The patient was given the diagnosis of NF1 based on clinical findings that were first noted in childhood including multiple café au lait macules, axillary freckling, and Lisch nodules. VHL was suspected after magnetic resonance imaging showed hemangioblastoma of the left cerebellum during evaluation of sensorineural hearing loss. On the face, trunk, and extremities there were at least 20 scattered well-defined, ovoid, light-brown macules. Involving the chest, abdomen, and back were multiple discrete 4- to 8-mm subcutaneous rubbery-soft nodules. Axillary freckling was noted on both axilla and the groin.

CaseNotHPOs: N/A

CaseNotHPOFreeText: He did not have any additional tumors or cysts in the central nervous system or visceral organs that are common in VHL.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P81S(c.241C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2233 https://www.ncbi.nlm.nih.gov/clinvar/variation/2233/

CAID: N/A

gnomAD: 0.0002179 https://gnomad.broadinstitute.org/variant/3-10183772-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P81S(c.241C>T)

MultipleGeneVariants: N/A

PatientID: IV-6

KindredID: 1

Case: F, 38Y0M, Chinese

DiseaseAssertion: Glioblastoma

FamilyInfo: Eight affected individuals in the patient’s family were retrospectively identified by reviewing medical records and from the recall of relatives. Three had passed away before 40 years of age because of central nervous system hemangioblastoma. Among the 10 living family members that carried the same NM_000551.3:c.326_339dupTCCACAGCTACCGA the patient carried, 3 had renal cysts and 1 had developed renal cell carcinoma, 2 had central nervous system hemangioblastoma, 1 had retinal hemangioblastomas, 1 was diagnosed with glioblastoma, and 5 were asymptomatic.

CasePresentingHPOs: ORPHA:360 (Glioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0009711; HP:0010797; HP:0000107; HP:0005584 (Retinal hemangioblastoma, hemangioblastoma, renal cyst, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Gly114Serfs*50(c.326_339dupTCCACAGCTACCGA)

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA2573051018 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573051018

gnomAD: N/A

VariantEvidence: N/A

MutationType: duplication

CivicName: G114fs (c.326_339dupTCCACAGCTACCGA)

MultipleGeneVariants: N/A

PatientID: III-16

KindredID: 1

Case: F, 52Y0M, Chinese

DiseaseAssertion: Assumed VHL

FamilyInfo: Eight affected individuals in the patient’s family were retrospectively identified by reviewing medical records and from the recall of relatives. Three had passed away before 40 years of age because of central nervous system hemangioblastoma. Among the 10 living family members that carried the same NM_000551.3:c.326_339dupTCCACAGCTACCGA the patient carried, 3 had renal cysts and 1 had developed renal cell carcinoma, 2 had central nervous system hemangioblastoma, 1 had retinal hemangioblastomas, 1 was diagnosed with glioblastoma, and 5 were asymptomatic.

CasePresentingHPOs: HP:0000107; HP:0010797 (Renal cyst, CNS hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0009711; HP:0005584 (Retinal hemangioblastoma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Gly114Serfs*50(c.326_339dupTCCACAGCTACCGA)

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA2573051018 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573051018

gnomAD: N/A

VariantEvidence: N/A

MutationType: duplication

CivicName: G114fs (c.326_339dupTCCACAGCTACCGA)

MultipleGeneVariants: N/A

PatientID: 86

KindredID: 27

Case: M, Age Unknown, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 81) had 3 family members confirmed with the mutation: his aunt 2 (patient 85) had pancreatic cysts and/or tumors at age 50, his cousin/ the son of Aunt 2 was asymptomatic at the time of assessment, and the granddaughter of aunt 2 was also asymptomatic at the time of assessment. The proband also had 3 family members who passed away before diagnosis/ before confirming the mutation: his mother (patient 82) had a CNS hemangioblastoma at 33, his Aunt 1 (patient 83) had a CNS hemangioblastoma at 32, and his cousin/ the son of Aunt 1 (patient 84) had a CNS hemangioblastoma at 30.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's cousin (son of aunt 2) was asymptomatic at the time of assessment.

CaseNotHPOs: HP:0009711; HP:0010797; HP:0002666; HP:0005584; HP:0001737; HP:0001732 (Retinal capillary hemangioma, Hemangioblastoma, Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.N90I (c.269A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223172; https://www.ncbi.nlm.nih.gov/clinvar/variation/223172/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: N90I (c.269A>T)

MultipleGeneVariants: N/A

PatientID: 104

KindredID: 35

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 104, presented with multiple pancreatic cysts/tumors at age 27. Their sister, patient 105 presented with pancreatic cysts/tumors at age 28. Their mother presented with a CNS hemangioblastoma at 45 but passed away before diagnosis/genetic testing.

CasePresentingHPOs: HP:0001737; HP:0001732 (Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's sister presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0009711; HP:0010797 (Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98S (c.293A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 219160; https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PatientID: 252

KindredID: 97

Case: M, 46Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001737; HP:0001732; HP:0005584 (Hemangioblastoma, Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma, retinal angioma, renal cell carcinoma, and multiple pancreatic cysts/tumors at age 46.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 1 Deletion (c.1-?_340+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: 144

KindredID: 52

Case: F, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's niece (daughter of sister 1) was asymptomatic at the time of analysis.

CaseNotHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0002666; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 288

KindredID: 113

Case: M, 24Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 288) presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors at 23, and a retinal angioma at 24. Their sister (patient 289) presented with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma at 30.

CasePresentingHPOs: HP:0010797; HP:0001732; HP:0001737; HP:0005584; HP:0009711 (Hemangioblastoma, Abnormality of the pancreas, Pancreatic cysts, Renal cell carcinoma, Retinal capillary hemangioma)

CaseHPOFreeText: The proband (patient 288) presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors at 23, and a retinal angioma at 24.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

PatientID: 101

KindredID: 34

Case: F, 51Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 99) presented with a CNS hemangioblastoma, retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma at age 40. Their mother (patient 100) presented with a CNS hemangioblastoma at age 50 and multiple pancreatic cysts/tumors at age 63, but passed away before diagnosis/ genetic testing. Their sister (patient 101) had the mutation and presented with a CNS hemangioblastoma and a retinal angioma at age 51. Their second sister (sister 2, patient 102) passed away before diagnosis/genetic testing but presented with a CNS hemangioblastoma at 40, renal cell carcinoma at 43 and multiple pancreatic cysts/tumors at 43. Their brother (patient 103), who also passed away before diagnosis/genetic testing, presented with a CNS hemangioblastoma and retinal angioma at age 47.

CasePresentingHPOs: HP:0010797, HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: The sister (patient 101) presented with a CNS hemangioblastoma and a retinal angioma at age 51.

CaseNotHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0002666 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in an earlier paper by Wang et al., 2014 (PMID 24581539) as well as a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.Y98N (c.292T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351750883, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.292T%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98N (c.292T>A)

MultipleGeneVariants: N/A

PatientID: 163

KindredID: 63

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 163) had a brother and niece who were both confirmed with the mutation. The brother (patient 164) had a CNS hemangioblastoma at 27, retinal angioma at 26, and pheochromocytoma at 8 years old. The niece (patient 165) was asymptomatic at the time of analysis. The proband also had a mother (patient 166) who had multiple pancreatic cysts/tumors and a pheochromocytoma at age 56, but for whom no DNA sample was available for analysis.

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0010797; HP:0002666; HP:0005584 (Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma, Pheochromocytoma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with a pheochromocytoma at 37, and at age 37 presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 94

KindredID: 31

Case: F, 56Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 31) has a son who has also genetically confirmed with the mutation. The proband's son presented at age 29 with retinal angioma, renal cell carcinoma, multiple pancreatic cysts/tumors, and pheochromocytoma.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband presented with renal cell carcinoma and multiple pancreatic cysts/tumors at 51, and CNS hemangioblastoma at age 56.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E94* (c.280G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 584477; https://www.ncbi.nlm.nih.gov/clinvar/variation/584477/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: E94* (c.280G>T)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 2

Case: M, 22Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: His father also had this mutation and presented with renal cell carcinoma and pancreatic cysts at age 48. His father's mother (his grandmother) presented with a CNS hemangioblastoma at age 61, and his father's brother (his uncle) presented with a CNS hemangioblastoma at age 33. His grandmother passed away before diagnosis, and there was no DNA sample available for his uncle.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma at the age of 22.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0005584; HP:0001737 (Retinal Capillary Hemangioma, Pheochromocytoma, Renal cell carcinoma, Pancreatic cysts)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.S65W (c.194C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43597, https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID:

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: 230

KindredID: 86

Case: F, 40Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 229) had a sister (patient 230) who was genetically confirmed with the mutation, and presented with a CNS hemangioblastoma at age 40. The proband's brother 1 (patient 231) was also confirmed with the mutation and had a retinal angioma at 25, and renal cell carcinoma at 54. The proband's brother 2 passed away before they could be diagnosed/ confirmed with the mutation, but they had a CNS hemangioblastoma at 35. Finally, the proband's nephew (son of brother 2) was genetically confirmed with the mutation and presented with renal cell carcinoma at age 30.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The proband's sister (patient 230) had a CNS hemangioblastoma at age 40.

CaseNotHPOs: HP:0002666; HP:0001737; HP:0001732; HP:0005584; HP:0009711 (Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

PatientID: 142

KindredID: 52

Case: F, 36Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's sister 1 (patient 142) had a CNS hemangioblastoma at 31, and multiple pancreatic cysts/tumors and renal cell carcinoma at 36.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 175

KindredID: 69

Case: F, 35Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The male proband, patient 143, was diagnosed with renal cell carcinoma and multiple pancreatic cysts/tumors at age 33. His mother, who was not confirmed with the mutation, had a CNS hemangioblastoma at 30, retinal angioma at 54, and renal cell carcinoma at 50. His sister had a CNS hemangioblastoma at 28, and renal cell carcinoma/ multiple pancreatic cysts/tumors at 35. His niece, who was not confirmed with the mutation, had a CNS hemangioblastoma at age 12. His aunt had a CNS hemangioblastoma at 37, retinal angioma at 45, and renal cell carcinoma at 53. The son of his aunt was asymptomatic at the time of analysis.

CasePresentingHPOs: HP:0005584; HP:0001737; HP:0001732; HP:0010797 (Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseHPOFreeText: The proband's sister presented with a CNS hemangioblastoma at age 28 and renal cell carcinoma and multiple pancreatic cysts/tumors at age 35.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.C162W (c.486C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223227; https://www.ncbi.nlm.nih.gov/clinvar/variation/223227/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: C162W (c.486C>G)

MultipleGeneVariants: N/A

PatientID: 140

KindredID: 52

Case: M, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: The proband (patient 138) had multiple family members affected with the mutation. Their daughter (pt 139) was asymptomatic at the time of assessment; their son (pt 140) was also asymptomatic at the time of assessment; their mother (pt 141) presented with a CNS hemangioblastoma at 66, renal cell carcinoma at 69, and multiple pancreatic cysts/tumors at 66; their sister 1 (pt 142) presented with a CNS hemangioblastoma at 32, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 36; the son of sister 1 was asymptomatic at the time of analysis; the daughter of sister 1 was asymptomatic at the time of analysis; the proband's sister 2 presented at age 39 with CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors; and the son of sister 2 was asymptomatic at the time of analysis. All members of this family were genetically confirmed to have this mutation.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's son was asymptomatic at the time of assessment.

CaseNotHPOs: HP:0010797, HP:0001737; HP:0001732; HP:0005584; HP:0002666; HP:0009711 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>C

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223220; https://www.ncbi.nlm.nih.gov/clinvar/variation/223220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>C)

MultipleGeneVariants: N/A

PatientID: 93

KindredID: 30

Case: M, 31Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; (Hemangioblastoma)

CaseHPOFreeText: The proband presented with a CNS hemangioblastoma at age 51.

CaseNotHPOs: HP:0002666; HP:0009711; HP:0005584; HP:0001737; HP:0001732 (Pheochromocytoma, Retinal capillary hemangioma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E94* (c.280G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 584477; https://www.ncbi.nlm.nih.gov/clinvar/variation/584477/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: E94* (c.280G>T)

MultipleGeneVariants: N/A

PatientID: 147

KindredID: 53

Case: F, 18Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband's mother presented with a CNS hemangioblastoma at age 17. She passed away before she could be diagnosed/ genetically confirmed with the same mutation as her daughter.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The proband presented with a CNS hemangioblastoma at age 18.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0001737; HP:0001732; HP:0005584 (Retinal capillary hemangioma, Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: c.464-1G>A

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43603, https://www.ncbi.nlm.nih.gov/clinvar/variation/43603/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Site (c.464-1G>A)

MultipleGeneVariants: N/A

PatientID: V-18

KindredID: 1

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: HP:0002666; HP:0002668 (Pheochromocytoma, Paraganglioma)

CaseHPOFreeText: Phenotype noted as: Pheo/PGL (unclear which of the two or if both apply to this patient).

CaseNotHPOs: HP:0005584; HP:0009711 (Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: IV-13

KindredID: 1

Case: M, 24Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Pheochromocytoma found on autopsy. Deceased (24Y). Cause of death: cardiac and renal failure.

CaseNotHPOs: HP:0005584; HP:0009711; HP:0002668 (Renal cell carcinoma, Retinal capillary hemangioma, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: VI-7

KindredID: 1

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: HP:0002666; HP:0002668 (Pheochromocytoma, Paraganglioma)

CaseHPOFreeText: Phenotype noted as: Pheo/PGL (unclear which of the two or if both apply to this patient).

CaseNotHPOs: HP:0005584; HP:0009711 (Renal cell carcinoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: V-8

KindredID: 1

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0002666; HP:0002668 (Renal cell carcinoma, Pheochromocytoma, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: VII-3

KindredID: 1

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL (Asymptomatic)

FamilyInfo: Family’s roots were traced to the German town of Leipzig in Saxony, from whence the original 11 siblings had immigrated to America around 1670. The following report is a 2011 updated pedigree on the previously reported Tisherman kindred. At the time of this study, 43/49 patients have undergone mutational analysis revealing the VHL familial mutation (Y112H) and 35/49 patients have clinical VHL manifestations. Phenotypic cumulative lifetime risk was 71% for Pheo/PGL, 15% for hemangioblastoma, 33% for retinal angioma, 3% for renal cell carcinoma, and 3% for pancreatic cysts. 6 members of the family (all deceased; 4 males, 2 females) had suspected VHL and 2 (males) of these were suspected to have had Pheo/PGL.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0009711; HP:0002666; HP:0002668 (Renal cell carcinoma, Retinal capillary hemangioma, Pheochromocytoma, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 9201016; 8239848 (no genetic information; only phenotypes)

SupplementalData: N/A

Variant: p.Y112H (c.334T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2222, https://www.ncbi.nlm.nih.gov/clinvar/variation/2222/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y112H (c.334T>C)

MultipleGeneVariants: N/A

PatientID: I.2

KindredID: F10

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: This patient’s partner and two children were all carriers of the D143= (c.429C>T) germline VHL variant. Their son was diagnosed with splenomegaly and polycythemia and was homozygous for the variant. All other family members were asymptomatic.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D143= (c.429C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 416990, https://www.ncbi.nlm.nih.gov/clinvar/variation/416990/

CAID: N/A

gnomAD: 0.000007953, https://gnomad.broadinstitute.org/variant/3-10188286-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition; synonymous_variant

CivicName: D143= (c.429C>T)

MultipleGeneVariants: N/A

PatientID: II.6

KindredID: F8

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 6/10 genetically tested family members across two generations were found to harbor the c.340+648T>C and c.340+617C>G germline mutations of the VHL gene. Patient I.2 presented with retinal capillary hemangioma, pheochromocytoma (pheo) and renal cell carcinoma. Patient I.3 presented with CNS hemangioblastoma and pheo. Patient II.1 presented with pheo. Patients II.2, II.6 and II.7 presented with retinal capillary hemangioma.

CasePresentingHPOs: HP:0009711 (Retinal capillary hemangioma)

CaseHPOFreeText: Presented with retinal capillary hemangioma. Tumor detected at age 16.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: c.340+617C>G

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 827582, https://www.ncbi.nlm.nih.gov/clinvar/variation/827582/

CAID: N/A

gnomAD: N/A

VariantEvidence: These variants segregated in 6 patients of this family who developed VHL disease and were absent in 4 healthy tested descendants, indicating their presence on a single disease-associated allele. Sequencing of tumor DNA did not display loss of heterozygosity, suggesting that a WT VHL deletion (as observed in classic VHL disease) may not be a prerequisite in cells of patients with this specific VHL genotype.

MutationType: missense_variant;transversion; splice_site_variant

CivicName: c.340+617C>G and c.340+648T>C

MultipleGeneVariants: Germline, VHL, c.340+648T>C

PatientID: None (Father)

KindredID: F6

Case: M, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: N/A

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q164H (c.492G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 456566, https://www.ncbi.nlm.nih.gov/clinvar/variation/456566/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Q164H (c.492G>T)

MultipleGeneVariants: N/A

PatientID: I (mother)

KindredID: F12

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 4 members of this family (I.mother, II.daughter, II.son, III.granddaughter) presented with pheochromocytoma and were found to have the P138= (c.414A>G) germline variant of the VHL gene.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P138= (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition; synonymous_variant

CivicName: P138= (c.414A>G)

GroupID: 33

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

GroupPresentingHPOs: N/A

GroupHPOFreeText: These 2 patients with a c.388G>A mutation did NOT have retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.

GroupNotHPOs: HP:0009711 (retinal capillary hemangioma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V130I (c.388G>A)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753916 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.388G>A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: V130I (c.388G>A)

MultipleGeneVariants: N/A

GroupID: 14b

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: N/A

CaseHPOFreeText: This was 1 of 3 patients discussed with this mutation. The individual did NOT have retinal hemangiomas; Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: p.Q164* (c.490C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223228 https://www.ncbi.nlm.nih.gov/clinvar/variation/223228/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q164* (c.490C>T)

MultipleGeneVariants: N/A

GroupID: 30a

DiseaseAssertion: VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

GroupPresentingHPOs: HP:0009711 (retinal capillary hemangioma)

GroupHPOFreeText: These 4/5 patients with a R107H (c.320G>A) mutation had retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R107H (c.320G>A)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: 223184 https://www.ncbi.nlm.nih.gov/clinvar/variation/223184/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R107H (c.320G>A)

MultipleGeneVariants: N/A

GroupID: 41

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: This individual patient was the only one discussed with this mutation. They had retinal hemangiomas; Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

GroupID: 30b

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: N/A

CaseHPOFreeText: This was 1 of 5 patients discussed with this mutation. The individual did NOT have retinal hemangiomas; Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: p.R107H (c.320G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223184 https://www.ncbi.nlm.nih.gov/clinvar/variation/223184/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: R107H (c.320G>A)

MultipleGeneVariants: N/A

GroupID: 7b

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

CohortInfo: a retrospective cohort study from an eye centre in Germany involved 148 VHL patients and their genetic data involved in retinal capillary hemangiomas.

CasePresentingHPOs: N/A

CaseHPOFreeText: This individual patient was 1/9 with an exon 3 deletion that did NOT have retinal capillary hemangiomas. Other VHL manifestations were discussed but not per- variant.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes - Supplementary Table S1

Variant: Exon 3 deletion

LegacyVariant: N/A

GroupProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: exon 3 deletion

MultipleGeneVariants: N/A

PatientID: II-1

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL (Asymptomatic)

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: N/A

CaseHPOFreeText: Deceased.

CaseNotHPOs: HP:0005584; HP:0002666 (Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: IV-5

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-4

KindredID: 2

Case: M, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-11

KindredID: 2

Case: F, Age Unknown, German

DiseaseAssertion: VHL (Asymptomatic)

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0002666 (Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: V-30

KindredID: 2

Case: M, Age Unknown, German

DiseaseAssertion: VHL

FamilyInfo: Family 2 is comprised of 131 individuals over six generations including 65 members (50% of those at risk) with VHL type 2A (72% clinically affected, 12% obligate carriers, and 15% positive genetic analysis alone) and nearly equal gender distribution for affected status (54% male). An additional six members (II-3, II-4, II -5, III-1, III-2, and III-3) are suspected to have VHL without confirmation. Of note, the nuclear family (branch IV-13) contains 13 siblings, of whom 12 have been diagnosed with pheo. The presenting tumor types in Family 2 were pheo (70%), HB (17%), and RA (13%). No Family 2 member had RCC as the initial manifestation. Distribution of HB and RA are not described except for patient IV-8.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 7759077

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2223, https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343, https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

PatientID: 23

KindredID: 23

Case: F, 45Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: None - apparently sporadic

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F76del (c.224_226delTCT)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA357012 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.224_226delTCT

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.224_226delTCT)

MultipleGeneVariants: N/A

PatientID: 16

KindredID: 16

Case: F, 20Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: positive family history

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: bilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161Q (c.482G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182983 https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 17

KindredID: 17

Case: F, 6Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: positive family history

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161Q (c.482G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182983 https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: 31

KindredID: 31

Case: M, 21Y0M, Asian Indian

DiseaseAssertion: pheochromocytoma

FamilyInfo: None - apparently sporadic

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: patient had unilateral pheochromocytoma

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178Q (c.533T>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 625260 https://www.ncbi.nlm.nih.gov/clinvar/variation/625260/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L178Q (c.533T>A)

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 15

Case: M, 12Y0M, Asian Indian

DiseaseAssertion: assumed VHL

FamilyInfo: Positive family history

CasePresentingHPOs: HP:0002666; HP:0002668; HP:0000107; HP:0001737 (pheochromocytoma; paraganglioma; renal cyst; pancreatic cysts)

CaseHPOFreeText: unilateral pheochromocytoma with sympathetic paraganglioma. Renal and pancreatic cysts

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/ SDHB/ SDHD/ NF1

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98S (c.293A>C)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 219160 https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: F, 45Y0M, Japanese

DiseaseAssertion: VHL

FamilyInfo: No evidence of a family history of VHL.

CasePresentingHPOs: HP:0001737; HP:0030405; HP:0006880; HP:0006748; HP:0009711; HP:0001732; HP:0002896 (Pancreatic cysts, Pancreatic endocrine tumor, Cerebellar hemangioblastoma, Adrenal pheochromocytoma, Retinal capillary hemangioma, Abnormality of the pancreas, Neoplasm of the liver)

CaseHPOFreeText: The proband had a cerebellar hemangioblastoma resected at age 17, retinal hemangioblastoma surgery at age 26, and an adrenalectomy for pheochromocytoma at age 30. An abdominal CT revealed a 4cm abdominal mass and diffuse pancreatic cystic lesions, diagnosed as pancreatic neuroendocrine tumor.

CaseNotHPOs: N/A

CaseNotHPOFreeText:

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q132* (c.394C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 288749, (https://www.ncbi.nlm.nih.gov/clinvar/variation/288749/)

CAID: CA10606205 (http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA10606205)

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Q132* (c.394C>T)

MultipleGeneVariants: N/A

PatientID: N/A (brother of index case)

KindredID: 1

Case: M, 45Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: The patient's sister was the index case in this VHL family, as she was diagnosed with bilateral pheochromocytoma at age 23 and underwent bilateral adrenalectomy. Genetic screening revealed the VHL variant, which prompted screening of family members. DNA sequencing from blood of consenting family members confirmed the presence of the VHL variant in seven family members (three generations) (see figure 1 for familial pedigree). This included the sister (index case), two nephews, mother, and two daughters. The patient's two daughters both had the mutation. One of which was found to have pheochromocytoma at age 15 due to routine screening. The other 8 year old daughter has not had any manifestations. The patient’s nephew was asymptomatic until age 7, where an abdominal ultrasound revealed a left adrenal mass. A total adrenalectomy was performed and at age 1 another mouse was found in the right adrenal gland, which was also removed. 6 years later he was asymptomatic. The patient’s other nephew presented with an adrenal mass at 11Y0M, which required total adrenalectomy and remains well 2.5 years later. No phenotype was noted for the patient’s mother.

CasePresentingHPOs: HP:0006748;HP:0010797; HP:0005584 (adrenal pheochromocytoma; Hemangioblastoma; Renal cell carcinoma)

CaseHPOFreeText: Patient developed hemangioblastoma, multiple bilateral renal cell carcinomas, bilateral pheochromocytomas, and succumbed to his disease at age 45.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V170G (c.509T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756196, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.509T%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; tranversion

CivicName: V170G (c.509T>G)

MultipleGeneVariants: N/A

PatientID: None

KindredID: VHL2

Case: M, 33Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 190 patients recruited by the COMETE network over 15 years were included in the study.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient had one benign pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHB/SDHC/SDHD

PreviouslyPublished: N/A

SupplementalData: Table 1 of Supplementary

Variant: p.S80I (c.239G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625229, https://www.ncbi.nlm.nih.gov/clinvar/variation/625229/

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had LOH found in the BAC array CGH data.

MutationType: missense_variant;transversion

CivicName: S80I (c.239G>T)

MultipleGeneVariants: N/A

PatientID: IV:8

KindredID: 1

Case: M, Age Unknown (deceased), Chinese

DiseaseAssertion: VHL

FamilyInfo: A 5-generation family with VHL in 15 members. Both second generation children (presumed), 5 third generation, and 8 further generation individuals were affected and haplotyping was conducted using three polymorphic microsatellite markers. All of the 5th generation children (9 total at time of publication) had been sequenced and haplotyped as unaffected.

CasePresentingHPOs: N/A

CaseHPOFreeText: unknown phenotype, however they were said to be affected

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: Death before genetic diagnostic, however presumed by authors due to extensive family history (See pedigree).

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: III:12

KindredID: 1

Case: M, Age Unknown (deceased), Chinese

DiseaseAssertion: VHL

FamilyInfo: A 5-generation family with VHL in 15 members. Both second generation children (presumed), 5 third generation, and 8 further generation individuals were affected and haplotyping was conducted using three polymorphic microsatellite markers. All of the 5th generation children (9 total at time of publication) had been sequenced and haplotyped as unaffected.

CasePresentingHPOs: N/A

CaseHPOFreeText: unknown phenotype, however they were said to be affected

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: Death before genetic diagnostic, however presumed by authors due to extensive family history (See pedigree).

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 8

KindredID: AD

Case: F, 34Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737 (Pancreatic cysts)

CaseHPOFreeText: Multi-cystic pancreatic lesions.

CaseNotHPOs: HP:0005584; HP:0002666; HP:0030393; HP:0009711; HP:0010797 (Renal cell carcinoma, Pheochromocytoma, Endolymphatic sac tumor, Retinal capillary hemangioma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114D (c.340+1G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223190, https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant; missense_variant;transition

CivicName: G114D (c.340+1G>A) and c.340+5G>C

MultipleGeneVariants: N/A

PatientID: 22

KindredID: P

Case: F, 25Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737; HP:0009711; HP:0010797 (Pancreatic cysts, Retinal capillary hemangioma, Hemangioblastoma)

CaseHPOFreeText: Multi-cystic pancreatic lesions, retinal angioma and CNS hemangioblastoma.

CaseNotHPOs: HP:0030393; HP:0002666; HP:0005584 (Endolymphatic sac tumor, Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

PatientID: 14

KindredID: AD

Case: F, 50Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0001737; HP:0005584 (Hemangioblastoma, Pancreatic cysts, Renal cell carcinoma)

CaseHPOFreeText: Multi-cystic pancreatic lesions, RCC and CNS hemangioblastoma.

CaseNotHPOs: HP:0009711; HP:0002666; HP:0030393 (Retinal capillary hemangioma, Pheochromocytoma, Endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114D (c.340+1G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223190, https://www.ncbi.nlm.nih.gov/clinvar/variation/223190/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant; missense_variant;transition

CivicName: G114D (c.340+1G>A) and c.340+5G>C

MultipleGeneVariants: Germline, VHL, c.340+5G>C

PatientID:18

KindredID: D

Case: M, 46Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0001737, HP:0010797, HP:0005584, HP:0030393 (pancreatic cyst, hemangioblastoma, renal cell carcinoma, endolymphatic sac tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218 https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007 https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_transition

CivicName: R167W(c.499C>T)

MultipleGeneVariants: N/A

PatientID: 29

KindredID: PM

Case: F, 35Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737 (Pancreatic cysts)

CaseHPOFreeText: Multi-cystic pancreatic lesions.

CaseNotHPOs: HP:0010797; HP:0030393; HP:0009711; HP:0002666; HP:0005584 (Hemangioblastoma, Endolymphatic sac tumor, Retinal capillary hemangioma, Pheochromocytoma, Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: This variant is noted as a full-length deletion involving genes BRK1 and FANCD2.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 9 (Grandmother)

KindredID: 13

Case: F, 67Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 5 members of this family were found to harbour the deletion of one VHL allele. The proband (ID 1), sister (ID 2) and uncle (ID 5) were all asymptomatic. The father (ID 3) presented with CNS hemangioblastoma (34Y).

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (57Y).

CaseNotHPOs: HP:0002666; HP:0005584; HP:0009711; HP:0000077; HP:0001732 (Pheochromocytoma, Renal cell carcinoma, Retinal capillary hemangioma, Abnormality of the kidney, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: Complete Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Reported as “del one vHL allele”.

MutationType: deletion

CivicName: Null (del one VHL allele)

MultipleGeneVariants: N/A

PatientID: 8 (Cousin)

KindredID: 17

Case: F, 4Y0M, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: 6 members of this family tested positive for the c.496_506del germline variant of the VHL gene. ID 4 presented with CNS hemangioblastoma, retinal angioma and renal and pancreatic abnormalities. ID 1 and 25 were asymptomatic.ID 22 presented with CNS hemangioblastoma. ID 5 presented with retinal angioma. 2 members were assumed to have the variant but were not genetically confirmed (ID 20 and ID 11). ID 11 and 20 presented with CNS hemangioblastoma.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584; HP:0002666; HP:0010797; HP:0000077; HP:0001732; HP:0009711 (Renal cell carcinoma, Pheochromocytoma, Hemangioblastoma, Abnormality of the kidney, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: p.V166Sfs*4 (c.496_506del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223229, https://www.ncbi.nlm.nih.gov/clinvar/variation/223229/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/AVariantEvidence: It is unclear from the publication if this variant is reported according to legacy (AF010238.1) or NM_000551.3 reference sequence. Clinical notes from the case confirm the reference sequence to be NM_000551.3.

MutationType: deletion; minus_2_frameshift_variant

CivicName: V166SFS*4 (c.496_506del)

MultipleGeneVariants: N/A

PatientID: 21 (Aunt)

KindredID: 1

Case: F, 48Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 9 members of this family were found to harbor the c.193T>G germline variant of the VHL gene. ID 35 was asymptomatic. IDs 1 (proband), 28, 2, 6, 17 and 19 all presented with pheochromocytoma. ID 5 presented with CNS hemangioblastoma, retinal angioma and renal cyst OR tumor (not specified).

CasePresentingHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseHPOFreeText: The patient presented with a pheochromocytoma at age 39 and retinal angioma at age 41.

CaseNotHPOs: HP:0005584; HP:0001732; HP:0000077; HP:0010797 (Renal cell carcinoma, Abnormality of the pancreas, Abnormality of the kidney, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: p.S65A (c.193T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223160, https://www.ncbi.nlm.nih.gov/clinvar/variation/223160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65A (c.193T>G)

MultipleGeneVariants: N/A

PatientID: 1 (Proband)

KindredID: 7

Case: M, 12Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 6 members of this family were found to harbor the c.319C>G germline variant of the VHL gene. ID 11 presented with renal and pancreatic abnormalities, pheochromocytoma and other undefined phenotypes. ID 24 presented with renal abnormalities, and pheochromocytoma, and died at age 62. ID 2 presented with pancreatic abnormalities. ID 10 presented with CNS hemangioblastoma, pancreatic abnormalities and pheochromocytoma. ID 4 presented with pheochromocytoma.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient presented pheochromocytoma (4Y).

CaseNotHPOs: HP:0009711; HP:0005584; HP:0001732; HP:0010797; HP:0000077 (Retinal capillary hemangioma, Renal cell carcinoma, Abnormality of the pancreas, Hemangioblastoma, Abnormality of the kidney)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table 1.

Variant: p.R107G (c.319C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43599, https://www.ncbi.nlm.nih.gov/clinvar/variation/43599/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R107G (c.319C>G)

MultipleGeneVariants: N/A

PatientID: 46

KindredID: 46

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1b.

Variant: p.Y156H (c.466T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756040

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y156H (c.466T>C)

MultipleGeneVariants: N/A

PatientID: 85

KindredID: 85

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history of VHL but no details provided.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1. There is additional tumour specific information in Supplemental Table 2.

Variant: p.P138P (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: Functionally validated by mRNA analysis, which showed a splicing alteration (data not shown). Membrane CA9 immunostaining was observed (supplemental table 1).

MutationType: missense_variant;transition; synonymous_variant

CivicName: P138= (c.414A>G)

MultipleGeneVariants: N/A

PatientID: 57

KindredID: 57

Case: Sex Unknown, 16Y0M, Ethnicity Unknown

DiseaseAssertion: Pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: The patient had a single pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1. There is additional tumour specific information in Supplemental Table 2.

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: Carbonic anhydrase 9 (CA9) mRNA level of 25.67 was detected. Membrane CA9 immunostaining was observed (supplemental table 1).

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: 74

KindredID: 74

Case: Sex Unknown, 31Y0M, Ethnicity Unknown

DiseaseAssertion: Assumed VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Single benign PCC.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Patient information pulled from Supplemental Table 1a.

Variant: Complete Deletion (c.1-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Carbonic anhydrase 9 (CA9) mRNA level of 34.31 was detected. Membrane CA9 immunostaining was observed.

MutationType: deletion

CivicName: Deletion

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 4

Case: F, 41Y0M, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: Familial VHL mutation - This one index case and their 4 relatives harbored p.Arg161X mutation - all with the same phenotypes hemangioblastoma, renal cell carcinoma and pancreatic cysts

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737 (hemangioblastoma; renal cell carcinoma; pancreatic cysts)

CaseHPOFreeText: With an age of diagnosis of VHL at 41

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: Patients with clinical manifestations suggestive of VHL or MEN2 were first screened for VHL or RET mutation, respectively. Possible screening of RET, SDHB and SDHD as well

PreviouslyPublished: N/A

SupplementalData: Yes

Variant: p.R161* (c.481C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: V5

KindredID: 3

Case: M, 47Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Sister presented with the same germline mutation and at least one cerebellar hemangioblastoma at the age of 29.

CasePresentingHPOs: HP:0006880(Cerebellar hemangioblastoma)

CaseHPOFreeText: Presented with at least two brainstem hemangioblastoma at the age of 35 and and 47.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.H110P (c.329A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351751310, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_canonicalid?canonicalid=CA351751310

gnomAD: N/A

VariantEvidence: The c.329A>C variant was not genetically confirmed to be germline but was found in samples from both tumors presented by this patient.

MutationType: missense_variant;transversion

CivicName: H110P (c.329A>C)

MultipleGeneVariants: N/A

PatientID: 29

KindredID: 372

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma, pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584 (renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500 G >A)

MultipleGeneVariants: N/A

PatientID: 15

KindredID: 503

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: One other member belonging to family 503 was mentioned (Patient: 7). This patient was found to have a pancreatic endocrine tumour, pheochromocytoma and renal cell carcinoma.

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumour)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666; HP:0005584 (pheochromocytoma, renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86S (c.256C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 178692 https://www.ncbi.nlm.nih.gov/clinvar/variation/178692/

CAID: N/A

gnomAD: N/A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: P86S (c.256C>T)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: 12

Case: Sex unknown, Age unknown, French

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0030405; HP:0002666; HP:0005584 (pancreatic endocrine tumour, pheochromocytoma, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R82P (c.245G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 193118 https://www.ncbi.nlm.nih.gov/clinvar/variation/193118/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: R82P (c.245G>C)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 1

Case: F, 14Y0M, Japanese

DiseaseAssertion: assumed VHL

FamilyInfo: Mother (39Y) with retinal angiomas and cerebellar hemangioblastoma, and her older sister (P1) with cerebellar hemangioblastoma, retinal capillary hemangioma, pancreatic cysts and a hearing impairment both had the p.P86L VHL mutation. Father did not.

CasePresentingHPOs: HP:0006880; HP:0010302; HP:0009711; HP:0001737; HP:0000107 (cerebellar hemangioblastoma; spinal cord tumor; retinal capillary hemangioma; Pancreatic cysts; renal cyst)

CaseHPOFreeText: at age 14 had 3 small inter cranial tumors (not removed) and by at 19 years had obstructive hydrocephalus caused by enlargement of the cerebellar tumors (hemangioblastomas). Retinal angiomas were found in the right eye, cystic lesions in the pancreas and the left kidney, and a cystic tumor in the cervical cord

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86L (c.257C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182977 https://www.ncbi.nlm.nih.gov/clinvar/variation/182977/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P86L (c.257C>T)

MultipleGeneVariants: N/A

PatientID: 4

KindredID: 2

Case: F, 14Y0M, Brazilian (Latino/Admixed American)

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma, pancreatic endocrine tumor)

CaseHPOFreeText: The patient developed bilateral pheo (as large as L = 6.0cm and R = 5.5cm) at 8Y of age. These recurred after 24months. They later presented with multiple PNET (largest 1.5cm) at 14Y.

CaseNotHPOs: HP:0002668; HP:0005584; HP:0001737; HP:0010797; HP:0009711; HP:0000107 (paraganglioma, renal cell carcinoma, pancreatic cyst, hemangioblastoma, retinal capillary hemangioma, renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114S (c.340G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 583094 https://www.ncbi.nlm.nih.gov/clinvar/variation/583094/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: G114S (c.340G>A)

MultipleGeneVariants: N/A

PatientID: 23

KindredID: 16

Case: Sex Unknown, 17Y0M, Brazilian (Latino/Admixed American)

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0030405; HP:0010797; HP:0001737; HP:0009711 (pancreatic endocrine tumor, hemangioblastoma, pancreatic cyst, retinal capillary hemangioma)

CaseHPOFreeText: The patient developed a 2.2 cm PNET at age 17. Patient was also recorded with all of the above manifestations

CaseNotHPOs: HP:0002668, HP:0002666; HP:0005584; HP:0000107 (Paraganglioma, pheochromocytoma, renal cell carcinoma, renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P86T (256C>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA351750624 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.256C%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: P25L (c.74C>T) and P86T (c.256C>A)

MultipleGeneVariants: Germline, VHL, c.74C>T (p.Pro25Leu)

PatientID: 21

KindredID: 14

Case: Sex Unknown, 36Y0M, Brazilian (Latino/Admixed American)

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0001737; HP:0010797; HP:0005584 (pancreatic cyst, hemangioblastoma, renal cell carcinoma)

CaseHPOFreeText: The patient at 36Y was confirmed with VHL. They had developed the above manifestations

CaseNotHPOs: HP:0009711; HP:0030405; HP:0002668, HP:0002666; HP:0000107 (retinal capillary hemangioma, pancreatic endocrine tumor, paraganglioma, pheochromocytoma, renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.C162* (c.486C>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 223226 https://www.ncbi.nlm.nih.gov/clinvar/variation/223226/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: C162* (c.486C>A)

MultipleGeneVariants: N/A

PatientID: 17

KindredID: 10

Case: Sex Unknown, 44Y0M, Brazilian (Latino/Admixed American)

DiseaseAssertion: VHL

FamilyInfo: None.

CasePresentingHPOs: HP:0001737; HP:0010797; HP:0005584; HP:0009711 (pancreatic cyst, hemangioblastoma, renal cell carcinoma, retinal capillary hemangioma)

CaseHPOFreeText: The patient at 44Y was confirmed with VHL. They developed pancreatic cyst, hemangioblastoma, renal cell carcinoma, and retinal capillary hemangioma

CaseNotHPOs: HP:0002668, HP:0002666; HP:0030405; HP:0000107 (paraganglioma, pheochromocytoma, pancreatic endocrine tumor, renal cyst)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.F76del (c.227_229delTCT)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA357012 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.227_229delTCT

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.227_229del)

MultipleGeneVariants: N/A