DOI: 10.1016/j.celrep.2019.06.068

Resource: (Abcam Cat# ab16918, RRID:AB_302562)

Curator: @Naa003

SciCrunch record: RRID:AB_302562

Curator comments: HA Tag Antibody [12CA5] Abcam Cat# ab16918

---

What is this?

DOI: 10.1002/cne.24428

Resource: (Molecular Probes Cat# A-11122, RRID:AB_221569)

Curator: @Naa003

SciCrunch record: RRID:AB_221569

Curator comments: GFP Tag Polyclonal Antibody Thermo Fisher Scientific Cat# A-11122 also A11122

---

What is this?

DOI: 10.1002/cne.24428

Resource: (Molecular Probes Cat# A-11122, RRID:AB_221569)

Curator: @Naa003

SciCrunch record: RRID:AB_221569

Curator comments: GFP Tag Polyclonal Antibody Thermo Fisher Scientific Cat# A-11122 also A11122

---

What is this?

DOI: 10.1002/cne.24147

Resource: (Thermo Fisher Scientific Cat# A10262, RRID:AB_2534023)

Curator: @Naa003

SciCrunch record: RRID:AB_2534023

Curator comments: GFP Tag Antibody Thermo Fisher Scientific Cat# A10262

---

What is this?

DOI: 10.1002/cne.24035

Resource: (Molecular Probes Cat# A-11122, RRID:AB_221569)

Curator: @Naa003

SciCrunch record: RRID:AB_221569

Curator comments: GFP Tag Polyclonal Antibody Thermo Fisher Scientific Cat# A-11122 also A11122

---

What is this?

DOI: 10.1002/cne.24035

Resource: (Molecular Probes Cat# A-21311, RRID:AB_221477)

Curator: @Naa003

SciCrunch record: RRID:AB_221477

Curator comments: GFP Tag Polyclonal Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat# A-21311

---

What is this?

DOI: 10.1002/cne.23752

Resource: (Molecular Probes Cat# A-21311, RRID:AB_221477)

Curator: @Naa003

SciCrunch record: RRID:AB_221477

Curator comments: GFP Tag Polyclonal Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat# A-21311

---

What is this?

DOI: 10.1002/cne.23689

Resource: (Molecular Probes Cat# A-21311, RRID:AB_221477)

Curator: @Naa003

SciCrunch record: RRID:AB_221477

Curator comments: GFP Tag Polyclonal Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat# A-21311

---

What is this?

DOI: 10.1093/nar/gky846

Resource: (Thermo Fisher Scientific Cat# CAB1001, RRID:AB_10709700)

Curator: @evieth

SciCrunch record: RRID:AB_10709700

Curator comments: Thermo Fisher Scientific Cat# CAB1001 TAP Tag Polyclonal Antibody

---

What is this?

DOI: 10.1002/cne.24428

Resource: (Molecular Probes Cat# A-11122, RRID:AB_221569)

Curator: @Naa003

SciCrunch record: RRID:AB_221569

Curator comments: GFP Tag Polyclonal Antibody Thermo Fisher Scientific Cat# A-11122 also A11122

---

What is this?

DOI: 10.1002/jnr.23760

Resource: (Molecular Probes Cat# A-11120, RRID:AB_221568)

Curator: @Naa003

SciCrunch record: RRID:AB_221568

Curator comments: GFP Tag Monoclonal Antibody (3E6) Thermo Fisher Scientific Cat# A-11120

---

What is this?

DOI: 10.1002/cne.24158

Resource: (Thermo Fisher Scientific Cat# A10262, RRID:AB_2534023)

Curator: @Naa003

SciCrunch record: RRID:AB_2534023

Curator comments: GFP Tag Antibody Thermo Fisher Scientific Cat# A10262

---

What is this?

DOI: 10.1002/cne.24158

Resource: (Thermo Fisher Scientific Cat# A10262, RRID:AB_2534023)

Curator: @Naa003

SciCrunch record: RRID:AB_2534023

Curator comments: GFP Tag Antibody Thermo Fisher Scientific Cat# A10262

---

What is this?

DOI: 10.7554/eLife.21221

Resource: (Cell Signaling Technology Cat# 2276, RRID:AB_331783)

Curator: @Naa003

SciCrunch record: RRID:AB_331783

Curator comments: Mouse Anti-Myc-Tag Monoclonal Antibody, Unconjugated, Clone 9B11 Cell Signaling Technology Cat# 2276 also 2276S

---

What is this?

DOI: 10.7554/eLife.21221

Resource: (Cell Signaling Technology Cat# 2276, RRID:AB_331783)

Curator: @Naa003

SciCrunch record: RRID:AB_331783

Curator comments: Mouse Anti-Myc-Tag Monoclonal Antibody, Unconjugated, Clone 9B11 Cell Signaling Technology Cat# 2276 also 2276S

---

What is this?

DOI: 10.7554/eLife.21221

Resource: (Cell Signaling Technology Cat# 2276, RRID:AB_331783)

Curator: @Naa003

SciCrunch record: RRID:AB_331783

Curator comments: Mouse Anti-Myc-Tag Monoclonal Antibody, Unconjugated, Clone 9B11 Cell Signaling Technology Cat# 2276 also 2276S

---

What is this?

DOI: 10.7554/eLife.21221

Resource: (Cell Signaling Technology Cat# 2276, RRID:AB_331783)

Curator: @Naa003

SciCrunch record: RRID:AB_331783

Curator comments: Mouse Anti-Myc-Tag Monoclonal Antibody, Unconjugated, Clone 9B11 Cell Signaling Technology Cat# 2276 also 2276S

---

What is this?

DOI: 10.1002/cne.24234

Resource: (Molecular Probes Cat# A-21311, RRID:AB_221477)

Curator: @Naa003

SciCrunch record: RRID:AB_221477

Curator comments: GFP Tag Polyclonal Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat# A-21311

---

What is this?

DOI: 10.1002/cne.24234

Resource: (Molecular Probes Cat# A-21311, RRID:AB_221477)

Curator: @Naa003

SciCrunch record: RRID:AB_221477

Curator comments: GFP Tag Polyclonal Antibody, Alexa Fluor 488 Thermo Fisher Scientific Cat# A-21311

---

What is this?

DOI: 10.1002/cne.24428

Resource: (Molecular Probes Cat# A-11122, RRID:AB_221569)

Curator: @Naa003

SciCrunch record: RRID:AB_221569

Curator comments: GFP Tag Polyclonal Antibody Thermo Fisher Scientific Cat# A-11122 also A11122

---

What is this?

DOI: 10.7554/eLife.44431

Resource: (Molecular Probes Cat# A-11122, RRID:AB_221569)

Curator: @evieth

SciCrunch record: RRID:AB_221569

Curator comments: Thermo Fisher Scientific Cat# A-11122, GFP Tag Polyclonal Antibody

---

What is this?

I had the very same problem with the #reMarkable. I really wanted to like it, but the missng backlight was a showstopper for me.

Now I take my handwritten notes on an iPad Pro 12.9, which is heavy with a less-than-great recharge cycle of one day.

Indeed, Maha! We hope participants in the Summer Open Pedagogy Adventure series might ponder, and explore here in annotation space.

How /what does annotation activity open up? Is that experience going to be the same for all? Yes we can create safer spaces in private group Hypothes.is annotation, but it is more cumbersome and we trade off perhaps the possible serendipity of connection with peers offering different perspectives.

And Why? Reply here and tag your annotation opsa

And this what we are asking participants in the Summer Open Pedagogy Adventure series to explore and question. Is this framing of students as content creation, which is valuable, the full range of what is open pedagogy? Engage with us here and elsewhere we we look at annotation as a form of open pedagogy, of going being the creation and adoption of OERs but building activities around them.

What do you think of Annotations being freely reused as licensed CC0?

What do our adventurers think? Annotate and tag opsa

And that is what we are doing here in the OE Global Open Pedagogy Summer Adventure (2021) in particular, the interactivity strand.

We can use these tools to augment this text but also reply to others, like a greeting space. So if you are here during our live workshop, or maybe later, reply with a greeting to let us know who you are, how you see (or maybe want to ask about) web annotation as an act of open pedagogy.

And explore the many annotations already present here...

And if you remember, add a tag of opsa to your annotations during this activity -- watch what happens.

Let's go adventuring with web annotation

Reviewer #1 (Public Review):

Yao Rang and collaborators find that heterologous expression of TMEM120A from mouse and human in cells that lack Piezo1 does not result in poke- or stretch-activated currents in whole cells or excised patches, and further detect no mechano-sensitive currents when the purified human protein is reconstituted in giant unilamellar vesicles. Together with high-quality positive controls with Piezo1, Piezo2 and TMEM63a, the results presented here call into question a previous proposal (Beaulieau-Laroche et al., Cell 2020) that TMEM120A functions as the long sought-after mechano-activated channel responsible for detecting painful touch.

Although the evidence supporting a channel function for TMEM120A is not strong, it remains to be ruled out that the discrepancies between the two studies arise from the different methods that were used to deliver the mechanical stimuli, as mentioned by the authors in the Discussion, or from the C-terminal mCherry tag attached to human TMEM120A in this study that was not present in the construct used by Beaulieau-Laroche et al.

Upon determination of the structure of full-length human TMEM120A in nanodiscs using cryo-EM, the authors find that the protein forms a dimer with six transmembrane helices per subunit and a cytosolic N-terminal coiled coil domain. Surprisingly, the authors find a density attributable to coenzyme-A (CoASH) located within a highly conserved cytosolic cavity at the transmembrane domain. The authors provide evidence from mass-spectrometry and isothermal titration calorimetry (ITC) to demonstrate that CoASH binds TMEM120A, and solidify their conclusions by showing that mutation of a residue close to the CoASH density in TMEM120A disrupts binding measured by ITC. The authors show that a potential ion-conduction pathway in their TMEM120A structure would be occluded by CoASH on the cytosolic side and on the extracellular side by a series of not well-conserved residues. Finally, the authors solve a structure in detergents where no density for CoASH is observed, as expected from spectroscopic data showing that detergent-reconstitution results in loss of CoASH binding. In this structure, a conformational change is suggested to occur on the cytosolic cavity entrance where a loop becomes reoriented to occlude the cavity that is otherwise occupied by CoASH. Together, the data presented paints an intriguing alternative for the function of TMEM120A proteins with a role in metabolism or CoA transport.

Although the main conclusions are well supported by the evidence, it is challenging to appraise many of the interesting structural observations pointed out by the authors because the experimental data (i.e. the density) is in most cases not depicted. Some of these observations for which only the model rather than the experimental data is shown include the hinge-like motif at the dimer interface (Fig. 3C), the CoASH binding site (Fig. 4E and Fig. 4 Supplement 1C), the difference in the conformation of the IL5 loop between the apo and CoASH-bound structures (Fig. 5), the extracellular constriction of the possible ion-conduction pathway (Fig. 4 Supplement 1D and Fig. 5 Supplement 2), as well as the comment that the observed density in the structures cannot accommodate other CoA-derivatives, for which data is not shown. The relatively low resolution at which the data were obtained raises concerns regarding many of these detailed observations.

Reviewer #2 (Public Review): 

This manuscript describes studies on the structural determinants of activation for the adhesion GPCR (aGPCR) GPR116 both in vitro and in vivo. The authors define key residues for activation on the receptors' N-terminus (the "tethered agonist") and the extracellular loops. Thus, the studies provide novel insights into the structural determinants of GPR116 activation. However, some interpretational issues (detailed below) complicate some of the authors' conclusions. Specific comments are as follows: 

1) Results section, first paragraph, last sentence: The authors write, "These results taken together indicate that the H991A mutant is capable of proper trafficking to the membrane, is able to response to exogenous peptide, but is unable to be cleaved and activated by endogenous ligands in vivo." The last part of this sentence represents an over-interpretation, as the data shown in Figure 1 do NOT show that the non-cleavable receptor is unable to be activated by endogenous ligands in vivo. It is entirely conceivable that a non-cleavable aGPCR could still be activated by endogenous adhesive ligands if those ligands were to change the position of the tethered agonist in manner that alters receptor signaling activity. 

2) The data shown in Fig. 1B (surface expression of non-cleavable H991A mutant) need to be quantified in some way in order to be interpretable. 

3) Results section, second paragraph, penultimate sentence: The authors write, "These data demonstrate that while the non-cleavable receptor is fully activated in vitro by exogenous peptides corresponding to the tethered agonist sequence, cleavage of the receptor and unmasking of the tethered agonist sequence is critical for GPR116 activation in vivo." However, the non-cleavable GPR116 mutant actually has two key differences from WT: i) lack of full liberation of the tethered agonist sequence, and ii) lack of liberation of a free NTF, which might dissociate from the CTF and have important in vivo physiological actions on its own. Isn't it conceivable that the lack of a freely mobile NTF contributes to the similarity in lung phenotype between the non-cleavable knock-in mutant and the GPR116 knockout? Based on the data shown in Figure 2, how can the authors claim these data demonstrate that unmasking of the tethered agonist is critical for GPR116 activation? The data could equally be interpreted as showing that liberation of a free NTF is critical for the physiological effects of GPR116 in vivo. 

4) Figure 3: If the authors' hypothesis is that the tethered agonist must be liberated in order to allow activation of GPR116, then why do ANY of the Flag-tagged mutant constructs exhibit constitutive signaling activity? Doesn't the N-terminal Flag tag prevent the tethered agonist from being exposed? How can these data be reconciled with the authors' model? 

5) The data shown in Fig. 3D are lacking statistical comparisons, so it is not possible to tell whether any of the differences between the mutants are statistically significant. 

6) The data shown in Fig. 4D (surface expression of the ECL mutants) need to be quantified in some way. 

7) In interpreting the results of the ECL mutations on GPR116 signaling activity, it is unclear why the authors so explicitly propose that these data demonstrate that the tethered agonist must be interacting with ECL2. Isn't it possible that ECL2 mutants with impaired receptor signaling activity simply lock the receptor in an inactive state? In this way, the effects of the ECL2 mutations could be explained without invoking a physical interaction between the putative tethered agonist and ECL2.

SciScore for 10.1101/2021.07.19.21260661: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Approval: The University of California San Diego Institutional Review Board approved the study, and women provided oral and written informed consent prior to use of their breast milk samples in the analyses described above.<br>Consent: Study Approval: The University of California San Diego Institutional Review Board approved the study, and women provided oral and written informed consent prior to use of their breast milk samples in the analyses described above.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Collection: Breast milk samples and clinical information were obtained from women participating in the Mommy’s Milk Human Milk Biorepository at the University of California, San Diego.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coronavirus Panel 2 multiplex electrochemiluminescence (ECLIA) serology kits were purchased from Meso Scale Discovery (Rockville, MD) to measure Immunoglobulin A and G (IgA and IgG) antibodies against four antigens related to SARS-CoV-2 in whole breast milk samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated with 150 µL of 1x detection antibody solution containing SULFO-TAG anti-human IgA or IgG prepared with Diluent 100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clinical variables were associated with SARS-CoV-2-specific IgA antibodies using multivariable linear mixed effects regression (LMER) to model antibody responses to each individual SARS-CoV-2 protein or fragment with random intercepts at the subject level to adjust for repeated measures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein microarray analysis of breast milk samples: The first generation multi-coronavirus protein microarray, produced by Antigen Discovery, Inc. (ADI, Irvine, CA, USA), included 935 full-length coronavirus proteins, overlapping 100, 50 and 30 aa protein fragments and overlapping 13-20 aa peptides from SARS-CoV-2 (WA-1), SARS-CoV, MERS-CoV, HCoV-NL63 and HCoV-OC43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 and SARS-CoV S proteins were made in Sf9 insect cells and the SARS-CoV-2 RBD, made in HEK-293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization was performed using the circlize, ComplexHeatmap and ggplot2 packages in R (23, 24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div><div style="margin-bottom:8px"><div>ComplexHeatmap</div><div>suggested: (ComplexHeatmap, RRID:SCR_017270)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

This study had several limitations as well as strengths. The collection of breast milk samples were not directly observed and samples were collected with nonstandard sampling time points. Therefore, the breast milk samples collected at the onset of symptoms may not reflect duration of exposure to SARS-CoV-2, which may be attributed for the differences observed in IgA kinetics. We also relied on the maternal report of SARS-CoV-2 test results, symptoms and treatments received, however, all participants completed a semi-structured interview guided by trained study staff who prompted for specifics with the aid of a calendar. Another limitation in our study was lack of reactivity to the S1 protein and its fragments produced in vitro using an E. coli based reaction mixture. This was likely due to the lack of eukaryotic post-translational modifications, including N-linked glycosylation which is abundant in S1. We compensated for this by including purified S protein and RBD in the array and by assaying purified S, RBD and the NTD of S by electro-chemiluminescent immunoassay (ECLIA). The added value of this study comes from the longitudinal assessment of milk antibody levels and the breadth of antigens covered by the protein microarray and ECLIA platforms, coupled with COVID-19 patient cases with unique profiles.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.07.21.453140: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vectors encoding for all S proteins were transiently transfected into HEK293 Freestyle (HEK293F) cells with polyethylenimine (PEI, linear, 25 kDa, Polysciences, USA) at a ratio of DNA: PEI = 1:2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA sequence corresponding to residues 1-1208 of the S protein was subcloned from the full-length S sequence, appended with the T4 fibritin foldon sequence at the C-terminus, followed by a c-Myc sequence and a hexahistidine (His6) tag, and inserted into the mammalian expression vector pcDNA3.4-TOPO (Invitrogen, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4-TOPO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The buffer viscosity (η) was set to 0.8945 cP at 25 °C based on the theoretical estimate using SEDNTERP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SEDNTERP</div><div>suggested: (Sednterp, RRID:SCR_016253)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Those parameters were applied in ASTRA 6.0 software (Wyatt Technology, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ASTRA</div><div>suggested: (ASTRA, RRID:SCR_016255)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.07.20.453054: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Animal experiment and ethics: The alpaca immunization procedures were conducted in conformity with the institutional guidance for the care and use of laboratory animals, and the protocols were approved by the Institutional Committee of Ethics and Research of the Central Laboratory at Xinyang Agricultural and Forestry University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The resulted emulsion was injected by the subcutaneous route at ten sites near the bow lymph node in the neck base of an adult female alpaca (3-years old).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was then blocked by 0.5 %(w/v) BSA in TBS buffer for 30 min at RT and washed three times using TBS before incubated with anti-Myc antibodies at 1:2,000 dilution in TBS-BSA-T buffer (TBS supplemented with 0.5 %(w/v) BSA and 0.05 %(v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For simultaneous binding of DL28 and monoclonal antibodies (REGN10933, CV30, CB6, all in the IgG form) with RBD, the biotinylated RBD was coated as mentioned above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV30</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CB6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification - Spike (S): The polypeptide containing, from N- to C-terminus, residues Met1 – Gln1208 (without the C-terminal transmembrane helix, Uniprot P0DTC2) of the SARS-CoV-2 S with mutations K986P/V987P, a GSAS linker substituting the furin sites (Arg682- Arg685), a C-terminal T4 fibritin trimerization motif (GYIPEAPRDGQAYVRKDGEWVLLSTFL), a TEV protease cleavage site, a FLAG tag and a polyhistidine tag 5 was encoded in a pCDNA3.1 backbone vector and overexpressed in Expi293 cells by transient transfection using polyethylenimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Retroviral pseudotyped particles were generated by co-transfection of HEK293T cells using polyethylenimine with the expression vectors encoding the various viral envelope glycoproteins, the Murine leukemia virus core/packaging components (MLV Gag-Pol), and a retroviral transfer vector harboring the gene encoding the green fluorescent protein (GFP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-hACE2 cells (104 cells/well) were seeded into a 48-well plate and infected 24 h later with 100 μL of virus supernatant in a final volume of 150 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification - Spike (S): The polypeptide containing, from N- to C-terminus, residues Met1 – Gln1208 (without the C-terminal transmembrane helix, Uniprot P0DTC2) of the SARS-CoV-2 S with mutations K986P/V987P, a GSAS linker substituting the furin sites (Arg682- Arg685), a C-terminal T4 fibritin trimerization motif (GYIPEAPRDGQAYVRKDGEWVLLSTFL), a TEV protease cleavage site, a FLAG tag and a polyhistidine tag 5 was encoded in a pCDNA3.1 backbone vector and overexpressed in Expi293 cells by transient transfection using polyethylenimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification - RBD: The polypeptide containing, from N- to C-terminus, the honey bee melittin signal peptide (KFLVNVALVFMVVYISYIYAA), a Gly-Ser linker, residues 330-531 of the SARS-CoV-2 S, a Gly-Thr linker, the 3C protease site (LEVLFQGP), a Gly-Ser linker, the Avi tag (GLNDIFEAQKIEWHE), a Ser-Gly linker, and a deca-His tag was encoded in a pFastBac-backbone vector for overexpression in Trichoplusia ni High Five suspension cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac-backbone</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, cells carrying nanobody-encoding pSb-init plasmids 46 were grown in Terrific Broth (TB, 0.17 M KH2PO4 and 0.72 M K2HPO4, 1.2 %(w/v) tryptone, 2.4 %(w/v) yeast extract, 0.5% (v/v) glycerol) supplemented with 25 mg L-1 chloramphenicol at 37 °C with shaking at 200 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSb-init</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One microgram of the PCR product and 10 μg of the pDX_init vector 46 were digested separately with 50 units of BspQI (Cat. R0712L, New England Biolabs) for 1.5 h at 50 °C before heat inactivation at 80 °C for 10 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDX_init</div><div>suggested: RRID:Addgene_132697)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The particles were eluted, and the phagemid was sub-cloned into pSb_init vector by fragment-exchange (FX) cloning and transformed into E. coli MC1061 cells for periplasmic expression and screening.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSb_init</div><div>suggested: RRID:Addgene_159422)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotypes for the Alpha (B1.1.7) and Beta (B1.351) variants were generated by incorporating the corresponding Spike mutations into the phCMV-SARS- CoV-2 plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was built with 2Fo-Fc maps in Coot 51, and refined using Phenix 52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structures were visualized using PyMol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay using SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 944703, RRID:AB_2890874)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.07.21.453274: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plaque numbers were scored in at least 3 replicates per dilution by independent readers, who were blinded with respect to the source of the supernatant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Virus: African green monkey kidney cells (Vero, subtype E6) and the human lung epithelial cell line (Calu-3 cells) were cultured in high glucose DMEM and low glucose DMEM medium, both complemented with 10% FBS, 100 U/mL penicillin and 100 µg/mL streptomycin at 37 °C in a humidified atmosphere with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">48-72 h supernatants were collected and the harvested virus was quantified as PFU/mL by titering in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pRSFDuet-1 plasmids (Novagen) encoding SARS-CoV-2 nsp14 or nsp10 engineered with an N-terminal His-SUMO tag were prepared as follows: SARS-CoV-2 RNA isolated from the supernatant of SARS-CoV-2-infected Vero E6 cells was provided by Benjamin R. tenOever48.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSFDuet-1</div><div>suggested: RRID:Addgene_165451)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR products were digested with BamHI and XhoI and subsequently ligated into BamHI and XhoI-digested pRSFDuet-His6-sumo vector and sequence verified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRSFDuet-His6-sumo</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The molecular docking calculations were performed using GOLD 2020.2 software (Cambridge Crystallographic Data Centre, Cambridge, UK)54</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GOLD</div><div>suggested: (GOLD, RRID:SCR_000188)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The figures for the docking poses of the largest docking score value was generated with PyMOL Delano Scientific LLC software (Schrödinger, New York, USA)55</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

basics of pull-down assay

"...makes it really difficult to figure "

wilson Huckleberry may have a solution in his pockets already...

Note: First tag in Booklady's space.

How about this for a test?

Reviewer #3 (Public Review):

The structure of the acid-sensing ion channel ASIC1a, a proton-gated cation channel, has been determined in resting, desensitized, and toxin-bound open states. However, the intracellular N- and C-termini are not resolved in any of these structures. Couch et al. sought to outline their structures and any conformational changes associated with ASIC gating using FRET coupled with patch-clamp electrophysiology. The authors inserted fluorescent protein tags at the N-terminus and various positions on the C-terminus of ASIC1 and measured the distance between these tags and the plasma membrane using the membrane-embedded FRET acceptor dipicrylamine (DPA). Using fluorescence lifetime measurements, the authors demonstrated that the N- and C-termini of a given subunit are in close proximity to one another. By observing FRET between fluorescent proteins on N- and C-termini of the same ASIC subunit, the authors demonstrate that there is no substantial rearrangement between the intracellular termini during pH gating. However, they did observe that the N- and proximal C-termini do move relative to plasma membrane during the transition from the resting to the pH-desensitized state.

This paper should be of interest to those working on acid-sensing ion channels and of broader interest to those working on ion channels, receptors, and membrane protein structural biology. The study was well designed and the data are of high quality. The authors took great care to provide a conservative interpretation of their data. I have only minor concerns regarding sources of error, particularly with respect to interpretation of the small effects the authors observe in many of their FRET experiments.

• Figure 2D shows rather small changes in ΔF/F-15 mV between fluorescent protein labels inserted at different positions in the ASIC sequence, particularly for the YFP constructs. As this metric is determined from the top and bottom asymptotes for the Boltzmann fits shown in Figure 2C, it would be useful to have some estimate as to the error associated with the fits at extreme values. Perhaps the authors could provide fits to their data (as in Figure 2C), including confidence intervals, or some similar estimate as to the size of the expected error compared to the effect size in Figure 2D.

• Along those same lines, the authors use an interesting (and potentially generalizable) approach to reducing background from intracellular proteins in their experiments: co-transfecting their channels with empty plasmid DNA. What percentage of the remaining fluorescence signal is the result of intracellular background? How would that affect the data in Figure 2 and 3? Is the ΔF/Fnorm curve for YFP labeled positions in Figure 2-figure supplement 4 so flat because of contaminating background fluorescence?

• In Figure 3D, the FRET efficiency between CFP-cA1-cA1 and N YFP at a 1:15 ratio of the two plasmids is higher than the FRET efficiency between CFP and YFP in the same subunit, even though the authors conclude that fluorescent proteins on the same subunit show considerably more FRET than fluorescent proteins on neighboring subunits. Could this indicate that the N-termini of adjacent subunits are closer together than the N- and C-termini of a single subunit? If, on the other hand, this effect were entirely the result of crowding in the membrane why is FRET efficiency substantially lower when CFP-cA1-cA1 is co-expressed with C4 YFP? Wouldn't this construct produce a similar crowding effect?

• On page 23, the authors state that they detected no pH-dependent changes in FRET between their GFP tag on the N-terminus of ASIC1 and an RFP tag on the channel's C-terminus. However, Figure 4 shows a small, but significant change in fluorescence between pH 8 and pH 7.

• The interpretation of distances between various tagged position on ASIC and the plasma membrane in Figure 2 is based on using two different colored tags with two different distance dependences. However, the interpretation of the data from Figure 5 provided on page 25 is less clear. For example, the reduction in fluorescence from the N-terminal tag is interpreted as the tag moving closer to the plasma membrane. Without similar data from a YFP tag to verify, it seems equally likely that the reduction in fluorescence (at steady state) could result from a movement away from the plasma membrane.

Author Response:

Reviewer #3 (Public Review):

[...] I have only minor concerns regarding sources of error, particularly with respect to interpretation of the small effects the authors observe in many of their FRET experiments.

• Figure 2D shows rather small changes in ΔF/F-15 mV between fluorescent protein labels inserted at different positions in the ASIC sequence, particularly for the YFP constructs. As this metric is determined from the top and bottom asymptotes for the Boltzmann fits shown in Figure 2C, it would be useful to have some estimate as to the error associated with the fits at extreme values. Perhaps the authors could provide fits to their data (as in Figure 2C), including confidence intervals, or some similar estimate as to the size of the expected error compared to the effect size in Figure 2D.

Thank you for this point. We did use Boltzman’s fits to get the asymptotes for each cell and calculate a ΔF/F. However, we could also use a ‘fit free’ approach of simply taking the difference between fluorescence values measured at -180 mV and that at +120 mV, divided by that at -15 mV to normalize for each cell. This approach completely avoids any error associated with fitting the data or imposing any model at all. Using this approach results in slightly different ΔF/F values but the pattern of statistical significance is identical. This new analysis is included in Figure 2 figure supplement 4. It has also been corrected for multiple comparisons.

• Along those same lines, the authors use an interesting (and potentially generalizable) approach to reducing background from intracellular proteins in their experiments: co-transfecting their channels with empty plasmid DNA. What percentage of the remaining fluorescence signal is the result of intracellular background? How would that affect the data in Figure 2 and 3? Is the ΔF/Fnorm curve for YFP labeled positions in Figure 2-figure supplement 4 so flat because of contaminating background fluorescence?

This is a great question. We originally hoped that the CFP and YFP quenching data from different positions could be used to triangulate both a distance from the membrane and a value for background fluorescence assuming that CFP and YFP would yield similar background fluorescences. An analogous approach was used in Zachariassen et al. Proc Natl Acad Sci, 2016 where an equal background was assumed between conformational states within a recording. In the end, the YFP quenching appeared to have a greater background than CFP. We speculate that this may be because the YFP variant we used matures faster than the CFP (mVenus, 17.6 min verses mTurquiose2, 33.5 min; FPbase.org) and hence the YFP matures faster than the ‘new’ channels get to the plasma membrane. However, at present we are uncertain how much of the background fluorescence signal to confidently attribute to this intracellular FP issue.

• In Figure 3D, the FRET efficiency between CFP-cA1-cA1 and N YFP at a 1:15 ratio of the two plasmids is higher than the FRET efficiency between CFP and YFP in the same subunit, even though the authors conclude that fluorescent proteins on the same subunit show considerably more FRET than fluorescent proteins on neighboring subunits. Could this indicate that the N-termini of adjacent subunits are closer together than the N- and C-termini of a single subunit? If, on the other hand, this effect were entirely the result of crowding in the membrane why is FRET efficiency substantially lower when CFP-cA1-cA1 is co-expressed with C4 YFP? Wouldn't this construct produce a similar crowding effect?

We strongly suspect the N termini of adjacent subunits are closer to each other than N and C of single subunit simply because the N FPs would all be at the same ‘height’ or same depth with respect to the plasma membrane. Thus the measured FRET in this case primarily reflects distances in the x-y plane. This contrasts with the N and C FPs on the same or different subunits where both x-y distances and axial distances come into play.

• On page 23, the authors state that they detected no pH-dependent changes in FRET between their GFP tag on the N-terminus of ASIC1 and an RFP tag on the channel's C-terminus. However, Figure 4 shows a small, but significant change in fluorescence between pH 8 and pH 7.

We have corrected for multiple comparisons within a figure. As a result, this effect is no longer statistically significant (adjusted p value is 0.063).

• The interpretation of distances between various tagged position on ASIC and the plasma membrane in Figure 2 is based on using two different colored tags with two different distance dependences. However, the interpretation of the data from Figure 5 provided on page 25 is less clear. For example, the reduction in fluorescence from the N-terminal tag is interpreted as the tag moving closer to the plasma membrane. Without similar data from a YFP tag to verify, it seems equally likely that the reduction in fluorescence (at steady state) could result from a movement away from the plasma membrane.

This is a very good point. We tried to perform DPA quenching of YFP-containing constructs at pH 6.0, but the acidification resulted in proton-quenching of the YFP fluorescence (Figure 4). We didn’t feel confident in measuring DPA quenching with the concomitant loss of YFP fluorescence due to acidification. Therefore, we relied on the pH 8.0 CFP and YFP data as a starting point (Figure 2). Given the C1 insertion gives the greatest extent of CFP quenching, it is reasonable to place it around the top of the curve. The N position could then be on the left or right side of the hump or peak in the CFP distance curve. The N quenching is comparable to the C2 insertion quenching (Figure 2D, left) yet the N FP is ~ 16 amino acids from the pore-forming membrane helices while the C2 insertions is ~ 40 amino acids away. For reference, the C1 is ~ 24 amino acids. Thus we are reasonably confident the N insertion is on the left side of the hump or peak. A reduction in ΔF/F would indicate movement closer to the plasma membrane. While technically possible that the N position could move further away from the membrane, this would have to be a >25 Å movement. Given there are only 16 amino acids between the CFP and the beginning of TM1 of the channel, we do not think such a dramatic movement outward could occur.

I'm partial to the "Principle of Least Power" in the Axioms of Web Architecture document cited in the bibliography. (The language there better captures the thought and presents it more convincingly, in my opinion.)

Shortcut: https://www.w3.org/DesignIssues/Principles.html#PLP

Reviewer #2 (Public Review):

In the manuscript by Paul W. Maarten and Sidhu A.. et al., the authors surveyed the importance of the DNA binding domain (DBD) and C-terminal domain (CTD) of BRCA2 in response to DNA damaging agents in cells, and the conformations adopted by recombinant constructs. The characterization of these domains are paramount in understanding basic BRCA2 function for novel future exploitation in cancer therapeutics. While the DBD and CTD domain have notable functions in DNA binding, nuclear localization upon DSS1 binding, RPA exchange, and replication fork protection, their role in response to damage and conformational modulation had been unexamined. Studying BRCA2 domain deletion in human cell lines is difficult as human BRCA2 contains a NLS in the C-terminus of the protein. The authors exploit the fact that the murine BRCA2 that has an additional N-terminal nuclear localization sequence to overcome lethality and the study of deletion mutants in human cell lines. Cell survival assays show the DNA binding domain of BRCA2 is most important for cell survival when treated with DNA damaging agents IR, Olaparib, MMC, and Cisplatin. The authors also show this system is functional as they observe the DBD domain is the most important for gene targeting assays that are repaired by homologous recombination. By assessing various DNA damaging agents, the authors highlight the multiple roles of BRCA2 in varying DNA repair processes from DSB repair, BIR, crosslink repair, etc. Interestingly, the C-terminus of BRCA2 does not appear to play a role in to cells when treated with MMC or Cisplatin but plays an important role in mediating self-organization. The authors describe that both the DBD and CTD domains of BRCA2 are important for RAD51 foci formation following IR. Assessing BRCA2 single-particle tracking in live cells, the authors show that the deletion of the DBD and the CTD domain leads to an increased immobile fraction following IR treatment. Using biophysical single molecule analysis, the authors analyzed recombinant BRCA2 DBD , CTD, and double mutants in the presence of ssDNA and interacting protein RAD51. The authors determined these domains are important for BRCA2 self-interactions and BRCA2 conformational rearrangements in the presence of ssDNA supporting in vivo analysis. Biophysical analysis show that the DBD and CTD are important for BRCA2 conformational dynamics that are observed with binding protein RAD51 or DNA substrates.

Strengths:<br> • These studies exploit a murine cellular system to overcome cellular lethality observed in BRCA2 depletion in human cell lines, which allows them to study the mouse BRCA2 protein and associated domain deletions.<br> • The authors also utilize bright photostable fluorophore's called JF646 Halo Tag ligand to study BRCA2, the deletion mutants, and RAD51 using live cell imaging. This is a great technical advancement in observing BRCA2 function in vivo.<br> • The in vivo and in vitro studies both support important roles of the DBD and CTD domain in BRCA2 dynamics.

Weaknesses:<br> • The importance of the in vivo work with these domains and the findings presented is confounded by a lack of biological replicates and clear presentation of statistical analysis within figures in the manuscript.<br> • As both domains are important for response to DNA damaging agents (IR, Olaparib, MMC, and Cisplatin) if a function specification could be made to the deletion mutations this would be most valuable to the field. Assaying molecules with varying substrates (Ex-forked substrates, crosslinked substrates, ssDNA substrates containing DNA lesions) or other protein players (DSS1) may aid in teasing out these roles.<br> • The discussion focuses on DSS1 and the DBD domain, yet the paper lacks any experimental analysis of BRCA2-DSS1. A biophysical analysis with recombinant protein DSS1 may greatly enhance the impact of this work on the field.<br> • It is unclear if the larger BRCA2 assemblies or the deletion mutants in the manuscript form via an oligomerization mechanisms or a phase separated mechanism. Speculation from authors would be valuable.

Reviewer #3 (Public Review):

The biochemical and genetic characterization of BRCA2 has been an ongoing challenge in the DNA repair field as the protein is large, prone to degradation, and expressed at low levels in most cell types. While certain features of BRCA2 have been described previously including its ability to bind and load RAD51 onto resected DNA substrates, much remains to be discovered. In this study, the authors combine genetic studies in mouse ES cells with biochemical analysis to examine the spatial dynamics and molecular architecture of BRCA2. Notably, they utilize an innovative approach coupling endogenous tagging of mouse BRCA2 with a HALO tag to monitor BRCA2 movement within live cells by single particle tracking.

I applaud the authors for achieving a highly technical approach to epitope tagging both endogenous BRCA2 alleles in mouse ES cells and combining this strategy with a HALO tag providing additional utility for a variety of cell biological experiments. By analyzing the endogenous alleles, the authors' system provides physiological levels of protein expression as transcription will be driven by the endogenous promoter thus preserving stoichiometric protein interactions within the cell and avoiding artifacts caused by overexpression.

The authors determine the influence of the DNA binding domain (DBD) and c-terminal binding (CTD) on the dynamic activities of BRCA2. They begin by exposing cells containing 3 different deletion mutants ΔDBD, ΔCTD, and the double mutant ΔDBDΔCTD to four different types of DNA damage (IR, PARPi, MMC, and cisplatin). Notably, ΔDBD displays significant impairment in survival in response to all 4 types of DNA damage. The ΔCTD, in contrast, demonstrates less sensitivity to IR and Olaparib, however, complements as well as WT BRCA2 in response to crosslinking agents MMC and cisplatin. My only criticism in this aspect of the work is that it would have been informative to include a truncated BRCA2 (mimic of a patient pathogenic mutation) or null allele to compare to the survival of the ΔDBD and ΔCTD mutants. I realize that these alleles may be inviable but the authors should clearly state if that was indeed the case.

The authors then go on to demonstrate that the ΔDBD and ΔCTD mutants are recruited to sites of IR damage in a similar manner to WT BRCA2 based on number and intensity of foci. I think it would be informative if the authors provided statistical significance for the graphs depicting the quantitation of foci number and intensity as there do appear to be differences between the mutants and the WT protein. There appears to be a delay in the kinetics of recruitment, especially at the 2 hr timepoint, for the mutants compared to WT BRCA2, which could indicate a defect in the recognition of the DNA damage. Only at the 2 hr timepoint following IR are there less RAD51 foci, and of a lesser intensity, in the three deletion mutants compared to WT BRCA2. Another possibility is the results could be interpreted as a defect in RAD51 loading and/or stabilization of the nucleoprotein filament. While immunofluorescence imaging of DNA repair foci have become common practice to measure protein recruitment to damage, it is impossible to know exactly what is happening in these foci with any granularity.

Next, the authors measure BRCA2 movement in the mouse ES cells taking advantage of the HALO tag to track single particles. While technically and visually alluring, it is difficult to extract mechanistic insight from the results. DNA damage induces changes in diffusion leading to BRCA2 molecules with restricted mobility; the authors demonstrated this phenomenon in a prior publication. The deletion mutants appear to have little effect upon BRCA2 mobility.

Finally, the authors utilize scanning force microscopy to analyze binding of the purified human BRCA2 proteins to RAD51 and ssDNA. In the absence of RAD51/ssDNA binding, there is a notable shift in the deletion mutants from oligomeric forms to monomeric compared to full length WT BRCA2. Upon binding to RAD51, there is a dramatic change from multimeric to monomeric forms for the WT BRCA2 (~7% to 74%) with a slight suppression of these changes shown for the deletion mutants. While WT BRCA2 forms extended molecular assemblies upon binding ssDNA, not surprisingly, deletion of the DBD or CTD fail to demonstrate any significant changes in physical architecture. In both situations, the mutant proteins respond to RAD51 and ssDNA in a dampened manner likely due to altered or loss of binding. While the architectural effects of RAD51 and ssDNA binding to BRCA2 are measurable by SFM, it is difficult to reconcile these changes in shape and oligomerization to defects in response to DNA damage and at which specific steps in homologous recombination these physical forms would impact.

Strengths:

1. Generation of mouse ES cells with both endogenous alleles of BRCA2 containing the deletion mutations in addition to a HALO tag is an incredible technical breakthrough and will be a highly valuable reagent for genetic and cell biological studies of mouse BRCA2.<br> 2. The deletion mutants ablating either the DBD or the CTD, or both, is a great genetic approach to understanding the role of these key domains in BRCA2. The response of these mutants (versus WT BRCA2 as a benchmark) to various DNA damage (IR, PARPI, MMC, cisplatin) provides interesting information delineating the roles of these two important domains in BRCA2. For example, the ΔCTD mutant is significantly sensitive to IR and Olaparib, yet complements as well as WT BRCA2 in response to the crosslinking agents MMC and cisplatin.<br> 3. The BRCA2 protein is notoriously difficult to purify and yet the authors succeeded in purifying 4 different forms of the protein for biophysical analysis. While it is difficult to interpret the various forms of BRCA2 by SFM, there are clear differences in the architecture between WT and the three c-terminal mutants. These differences are highlighted upon binding to RAD51 or ssDNA.

Weaknesses:

1. While the separation-of-function result for the CTD deletion in response to crosslinking agents MMC and cisplatin is a novel and compelling result, it would have been informative to compare the survival results and gene targeting assay using a BRCA2 null or mimic of patient mutation (truncating mutation) to see how these 3 mutants stack up against a completely non-functioning BRCA2 allele. Likely, the BRCA2 null alleles are inviable but perhaps a conditional system or truncating allele similar to a patient germline mutation would give a window into response compared to the DBD and CTD deletion mutants.<br> 2. It's not clear in the manuscript what new information we are learning about the mechanisms of BRCA2 in the single particle tracking (SPT) data. The differences in mobility between the mutants and WT BRCA2 seem minimal, but more importantly, it is not immediately clear how these data help us understand the normal cellular functions of BRCA2. No doubt, the technology and innovation to track single particle proteins in the nuclei of cells is impressive, but the authors should clearly explain how we can gain mechanistic insight from the SPT data that is presented in this manuscript.

General Comments:

It is unclear how missing the c-terminal domain (CTD) or the DNA binding domain (DBD) of BRCA2 can be interpreted as having "roles beyond delivering strand exchange protein RAD51" unless a complete biochemical workup of the deletion mutants was performed to detect any alterations in DNA binding, stimulation of RAD51 dependent strand exchange, etc... While interesting and certainly an impressive technical feat, foci imaging and single particle tracking do not provide much information on mechanism (i.e. whether BRCA2 is binding DNA and loading/nucleating RAD51).

The interpretations in the discussion are not overstated, however, I somewhat disagree with the notion that the data, as presented, clarifies the role of BRCA2 beyond its canonical functions of RAD51 loading and nucleation on resected DNA substrates. I would have liked if the authors discussed the idea that it is surprising that mouse ES cells can tolerate complete loss of the DBD, CTD, and loss of both together. Questions that should be addressed in include some of the following: Are proliferation rates compromised compared to WT cells? Are they experiencing replication stress in the absence of any exogenous damage? Further, is there something unique about mouse ES cells that may differentiate BRCA2 behavior that would be expected in somatic human cells?

It is interesting to note that many years ago Ashworth and Taniguchi published back-to-back papers in Nature (2008) describing BRCA2 reversion alleles from in vitro screens of BRCA2 mutant cells selected in cisplatin or PARPi such that some of these reversions resulted in huge deletions of the entire DBD of BRCA2, and yet, they promoted resistance to PARPi. In this context, I would much appreciate if the authors commented on their findings that their constructed DBD deletion is not resistant to PARPi and if they offered some speculation as to why the reversions in those previous studies were.

iffe格式主要是用于在script上引入的方式

SciScore for 10.1101/2021.07.19.452910: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">or with 1 μg UBE2O antibody (A301-873A, Bethyl) overnight following with 15 μL prewashed protein A/G beads (1:1 mixture, 1614013 and 1614023, Biorad) incubation for another 1.5 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UBE2O</div><div>suggested: (Thermo Fisher Scientific Cat# A301-873A, RRID:AB_1309799)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used in these experiments included Flag (F1804, Sigma), EGFP (50430-2-AP, Proteintech), NSP3 (ab181602, Abcam), UBE2O (A301-873A, Bethyl), pSerine (gtx26639, GeneTex), pThreonine (9386, Cell Signaling), TAB2 (A302-759A, Bethyl), TAB3 (A302-208A, Bethyl)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A301-873A , Bethyl) , pSerine ( gtx26639 , GeneTex) , pThreonine ( 9386 , Cell Signaling) , TAB2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A302-759A , Bethyl) , TAB3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used for the experiment are: CANX (2679, Cell Signaling), TOMM20 (ab56783, Abcam), Flag (F1804 and F7425, Sigma), NSP3 (ab181602, Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CANX ( 2679 , Cell Signaling)</div><div>suggested: (Cell Signaling Technology Cat# 2679, RRID:AB_2228381)</div></div><div style="margin-bottom:8px"><div>TOMM20</div><div>suggested: (Abcam Cat# ab56783, RRID:AB_945896)</div></div><div style="margin-bottom:8px"><div>ab56783 , Abcam) , Flag ( F1804</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NSP3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells from ATCC were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Hyclone, SH30033.01) supplemented with 10% Fetal bovine serum (FBS, Hyclone, SV30160.03) and 1×Penicillin/Streptomycin (Hyclone,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UBE2O plasmid was described before [52] and TNIP cDNA was amplified from HeLa cDNA and cloned in to pCS2 vector with Flag tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCS2</div><div>suggested: RRID:Addgene_62214)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw data were first transformed using FAIMS MzXML Generator and then analyzed using MaxQuant version 1.6.17.0 [54]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-Protein Interaction (PPI) network and pathway annotation of interactors was constructed by Cytoscape plugin Reactome FI v7.2.3 [57].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interactors of NSP3 were divided into 3 groups (CoV1, CoV2 and both) and enriched GO terms were shown using clusterProfiler package [58]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Circos plots was performed using circlize package [59].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Circos</div><div>suggested: (Circos, RRID:SCR_011798)</div></div><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We filtered out the kinases of which matching sites was less than 3 or Z-score is lower than 1 and created Human Kinome Tree illustration using KinMap [36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KinMap</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The targeting drugs that regulate activity changed kinases were extracted from drugbank (https://go.drugbank.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>drugbank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptome data analysis: Raw reads were aligned to the human genome (hg38) using HISAT2 [62].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, we assembled reads to transcripts and quantified the read counts of each genes utilizing StringTie [63].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StringTie</div><div>suggested: (StringTie , RRID:SCR_016323)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We kept genes that CPM is greater than 1 in at least 2 samples and analyzed the differential expression gene using edgeR [64].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Molecular Function (MF) were performed using enrichR in clusterProfiler package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>enrichR</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.07.17.452804: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each library, 45 OD of induced culture was washed twice with PBS-BSA (0.2 mg/mL), and RBD surface expression was labeled via a C-terminal c-Myc tag with 1:100 diluted FITC-conjugated chicken anti-c-Myc antibody (Immunology Consultants Lab, CMYC-45F) in 3mL PBS-BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c-Myc tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-c-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day post-transfection, cells were infected with VSV (G*ΔG-luciferase), and after 2 hr, infected cells were washed 5x with DMEM before adding medium supplemented with anti-VSV G antibody (I1-mouse hybridoma supernatant diluted 1:40, from ATCC CRL-2700)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>G*ΔG-luciferase) ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-VSV G</div><div>suggested: (Fitzgerald Industries International Cat# 10R-2673, RRID:AB_11192005)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of S was done with mouse monoclonal ANTI-FLAG M2 antibody (Sigma F3165) and Alexa Fluor 680 AffiniPure</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ANTI-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F3165, RRID:AB_259529)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected using Lipofectamine 2000 (Life Technologies) with a S encoding-plasmid in Opti-MEM transfection medium and incubated for 5 hr at 37°C with 8% CO2 supplemented with DMEM containing 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV pseudovirus entry assays: HEK293T (293T) cells (ATCC CRL-11268) and 293T cells with stable transfection of human ACE242 were cultured in 10% FBS, 1% PenStrep DMEM at 37°C in a humidified 8% CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.4 expression plasmids were transfected into HD 293F cells for protein expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient expression of R. affinis ACE2-Fc: The R. affinis 787 (GenBank: QMQ39222.1) and R. affinis 9479 (GenBank: QMQ39227.1) ACE2 ectodomains constructs were synthesized by GenScript and placed into a pCMV plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Marginal likelihood ancestral sequence reconstruction was performed with FastML (version 3.11)49 using the amino acid sequence alignment, the maximum likelihood nucleotide tree topology from RAxML, the LG+G substitution matrix, re-optimization of branch lengths, and FastML’s likelihood-based indel reconstruction model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastML</div><div>suggested: (Fastml, RRID:SCR_016092)</div></div><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting CCSs are available on the NCBI Sequence Read Archive, BioSample SAMN18316101.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI Sequence Read Archive</div><div>suggested: (NCBI Sequence Read Archive (SRA, RRID:SCR_004891)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Yeast library sorting experiments were conducted on a BD FACSAria II with FACSDiva software (version 8.0.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 labeling of RBD+ cells was measured on a BD LSRFortessa X50 flow cytometer and data was processed via FlowJo (version 10)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normalized cell entry levels of pseudovirus generated on different days (biological replicates) were plotted in Graph Prism as individual points, and average cell entry across biological replicates was calculated as the geometric mean.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Prism</div><div>suggested: None</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your code and data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.07.18.452826: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This animal experiment protocol was approved by the Animal Ethics Committee of the School of Basic Medical Sciences at Fudan University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 infection of adenovirus transduced mice: Six to eight week-old male mice (BALB/c) were transduced intranasally with adenovirus expressing wild-type ACE2, the D355N variant or empty control (5×1010 viral particles per mouse).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were tested routinely and found to be free of mycoplasma contamination.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 4% paraformaldehyde in PBS, permeablized with 0.2% Triton X-100, and incubated with the rabbit polyclonal antibody against SARS-CoV nucleocapsid protein (Rockland, 200-401-A50, 1 μg/ml) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV nucleocapsid protein ( Rockland , 200-401-A50 , 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes, cells were incubated with the secondary goat anti-rabbit antibody conjugated to Alexa Fluor 488 (Thermo #A11034, 2 μg/ml) for 2 h at room temperature, followed by staining with 4’,6-diamidino-2-phenylindole (DAPI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A-11034, RRID:AB_2576217)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of FLAG-tagged ACE2 delivered by adenovirus, the sections were incubated in blocking reagent and then with FLAG M2 antibody (1:100 dilution, Sigma-Aldrich #1804) at 4 °C overnight, followed by incubation with HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C69682-5000, RRID:AB_1653096)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral antigen detection, the sections were incubated with house-made mouse anti-SARS-CoV-2 nucleocapsid protein serum (1:5000) and HRP465 conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid protein serum</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with homemade mouse anti-SARS-CoV-2 N serum overnight at 4°C, incubated with the secondary goat anti-mouse HRP-conjugated antibody for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell cultures and SARS-CoV-2 virus: HEK293T cells (American Tissue Culture Collection, ATCC, Manassas, VA, CRL-3216), Vero E6 (Cell Bank of the Chinese Academy of Sciences, Shanghai, China) and HeLa (ATCC #CCL-2) were maintained in Dulbecco’s modified Eagle medium (DMEM) (Gibco, NY, USA) supplemented with 10% (vol/vol</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Addgene #12259) and psPAX2 (Addgene #12260) and the transfer vector with VigoFect DNA transfection reagent (Vigorous) into HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface ACE2 binding assay: HeLa cells were transduced with lentiviruses expressing the ACE2 from different species for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pShuttle-ACE2 plasmids were then electroporated 440 into BJ5183 AD-1 cells (Agilent), which were pretransformed with pAdEasy-1 to facilitate recombination with the pShuttle-CMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AD-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The transfected HEK293 cells were maintained until the cells exhibited complete cytopathic effect (CPE) and then harvested and freeze-thawed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection of adenovirus transduced mice: Six to eight week-old male mice (BALB/c) were transduced intranasally with adenovirus expressing wild-type ACE2, the D355N variant or empty control (5×1010 viral particles per mouse).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The cDNAs encoding ACE2 orthologs (Table S1) were synthesized by GenScript and cloned into pLVX-IRES-zsGreen1 vectors (Catalog No. 632187, Clontech Laboratories, Inc) with a C-terminal FLAG tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-IRES-zsGreen1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Addgene #12259) and psPAX2 (Addgene #12260) and the transfer vector with VigoFect DNA transfection reagent (Vigorous) into HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, SARS-CoV-2 RBD (residues Thr333-Pro527), SARS-CoV RBD (residues Arg306–Leu515), or NL63-CoV RBD (residues Gln481-Ile616) with a N-terminal gp67 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFastBac-Dual vector (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac-Dual</div><div>suggested: RRID:Addgene_135584)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of SARS-CoV-2 or SARS-CoV pseudotyped virus: Pseudoviruses were produced in HEK293T cells by co-transfecting the retroviral vector pTG-MLV-Fluc, pTG-MLV-Gag-pol, and pcDNA3.1 expressing the SARS-CoV spike, SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTG-MLV-Fluc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pTG-MLV-Gag-pol</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div><div style="margin-bottom:8px"><div>pMD2 . G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and production of recombinant adenovirus expressing ACE2 variants: cDNA of ACE2 variants with a FLAG tag at the C-terminus was cloned into pShuttle.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pShuttle</div><div>suggested: RRID:Addgene_16402)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pShuttle-ACE2 plasmids were then electroporated 440 into BJ5183 AD-1 cells (Agilent), which were pretransformed with pAdEasy-1 to facilitate recombination with the pShuttle-CMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pShuttle-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pAdEasy-1</div><div>suggested: RRID:Addgene_16400)</div></div><div style="margin-bottom:8px"><div>pShuttle-CMV</div><div>suggested: RRID:Addgene_16403)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were processed using the ImageJ program (http://rsb.info.nih.gov/ij/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

We note that our conclusions are based on experiments performed in cell culture and in an artificial animal model and therefore have certain limitations. It will be important to extend this work to a real-world study, which could bridge the gap between genotype, phenotype and epidemiology. In addition, we only considered the effect of ACE2 SNVs. As the serine protease TMPRSS2 can prime the viral spike for direct fusion with the plasma membrane39, 43, SNPs in TMPRSS2 might also impact SARS-CoV-2 cell entry and be useful target of future studies. Moreover, SNPs in the 5’UTR or other non-coding regions of ACE2 were not included in this study and may also be important in regulating ACE2 transcription or translation, leading to varied ACE2 protein levels in vivo that could affect virus entry and the severity of COVID-19. Due to these limitations, we urge caution not to over interpret the results of this study. Of note, SARS-CoV-2 has evolved rapidly in humans, and a variety of genomic changes, including mutations and deletions in the spike protein, have recently been identified44, 45. Given that genetic variants will continue to arise, it is likely that we will see more genomic changes in the spike protein that might affect the spike interaction with human ACE2. Thus, it will be important to continue testing the interactions of these mutated spike proteins with the ACE2 SNVs. In summary, our study suggest that ACE2 polymorphism could impact human susceptibility to SARS-CoV-2 infec...

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

An interesting idea Shawn.

SciScore for 10.1101/2021.07.16.21260079: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: Use of human samples for this study was approved by the University of Ottawa Ethics Review Board: Certificates H-04-20-5727, H-04-21-6643 and H-07-20-6009.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody responses in pre-pandemic serum samples of all four cohorts were tested for the presence of antibody isotypes (IgA, IgM, IgG, and IgE) and IgG subtypes (IgG1, IgG2, IgG3, and IgG4) using this ELISA binding assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Accordingly, the control calibration antibodies were prepared with appropriate dilutions to generate the calibration curve (anti-COVID Ig).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-COVID Ig) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After two hours, plates were washed three times with 200uL PBS-T followed by the addition of secondary-HRP antibodies (1:3000) diluted in dilution buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>secondary-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50uL of the appropriate diluted secondary antibody-HRP was added to each well and the plates were incubated at RT for one hour of shaking (700rpm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-HRP</div><div>suggested: (Bioworld Technology Cat# MB001H, RRID:AB_2857326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relieff is used to predict classification rank, i.e. within the group significance, for each feature in the training set classification, of serum antibody cross-reactivity to 4 different SARS-CoV-2 antigens (N, RBD, Spike) for IgA, IgM and IgG and separately for antibodies for seasonal viruses (OC43, HKU-1, 229E, NL63).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens ( N , RBD , Spike ) for IgA , IgM and IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NL63</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 ELISA Antigens and Antibodies: To evaluate the functional antibody responses of sCoV antibodies against different SARS-CoV-2 proteins, SARS-CoV-2 S, RBD, and N proteins were used as coating antigen (see antigen production).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen ( see antigen production) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies: Anti-human IgG-HRP (NRC anti-hIgG#5-HRP</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Control antibodies: Anti-SARS-CoV-2 S CR3022 Human IgG1 (Absolute Antibody, Ab01680-10.0), Anti-SARS-CoV-2 S CR3022 Human IgA (Absolute Antibody, Ab01680-16.0), Anti-SARS-CoV-2 S CR3022 Human IgM (Absolute Antibody, Ab01680-15.0), Anti-SARS-CoV-2 S CR3022 Human IgE (Absolute Antibody, Ab01680-14.0), Anti-SARS-CoV-2 S CR3022 Human IgG1 (Absolute Antibody Ab01680-10.0), Anti-SARS-CoV-2 S CR3022 Human IgG2 (Absolute Antibody Ab01680-11.0), Anti-SARS-CoV-2 S CR3022 Human IgG3 (Absolute Antibody Ab01680-12.1), and Anti-SARS-CoV-2 S CR3022 Human Ig4 (Absolute Antibody Ab01680-13.12).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Human</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 S CR3022 Human IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: (Abcam Cat# ab273074, RRID:AB_2847846)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The concentration of antigen, antibodies, and sample diluents were kept as above, although the volume was reduced to 10uL per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen ,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 229E RBD (P15423) was cloned in pCAGGs plasmid with a hexa-his Tag (C-term) with secretory signal (N-term) and transfected into 293F cells maintained in Freestyle 293 expression media (Thermo Fisher, 12338018) at 37°C, 7% CO2, with shaking (125rpm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6 – FLAG tag was synthesized by Genscript with codon-optimization for expression in CHO cells.A biotin acceptor peptide sequence (BAP: GLNDIFEAQKIEWHE) was added in-frame at the C-terminus of ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA was cloned into pTT5 and ACE2-BAP cDNA was expressed by transient gene expression in CHO55E1 cells as described above with the addition of 5% (w:w) of pTT5-BirA (E. coli biotin ligase) expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO55E1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 229E RBD (P15423) was cloned in pCAGGs plasmid with a hexa-his Tag (C-term) with secretory signal (N-term) and transfected into 293F cells maintained in Freestyle 293 expression media (Thermo Fisher, 12338018) at 37°C, 7% CO2, with shaking (125rpm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGs</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike ectodomain (SARS2: MN908947; OC43: AAT84362.1; HKU1: Q0ZME7.1) cDNA constructs with furin site mutated, two stabilizing prefusion proline mutations, the human resistin as trimerization partner and a C-terminal FLAG-(His)6 (SARS2) or FLAG-Twin Strep Tag-(His)6 (OC43 and HKU1) tag were cloned into pTT241 vector and transfected in CHO2353 to generate stable pools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT241</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nucleocapsid (SARS2: YP_009724397; OC43: AY391777; HKU1: HM034837) cDNAs with a C-terminal FLAG-Twin Strep Tag-(HisG)6 tag were synthesized by Genscript (Cricetulus griseus codon bias) and cloned in the cDNA into pTT5™ expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA was cloned into pTT5 and ACE2-BAP cDNA was expressed by transient gene expression in CHO55E1 cells as described above with the addition of 5% (w:w) of pTT5-BirA (E. coli biotin ligase) expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div><div style="margin-bottom:8px"><div>pTT5-BirA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralizing activity was determined by calculating the % inhibition against SARS-CoV-2 S proteins using the following equation:

Statistical and Machine learning analyses: Data analysis was conducted using GraphPad Prism v9, R and Matlab 2021a (Matworks Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample clustering was performed using fuzzy c-means (FCM) clustering method (fcm function running under Matlab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.07.14.21260544: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Viruses and cells: The use of deidentified positive specimens for the above studies was approved by the University of Washington Institutional Review Board (STUDY00010205).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were permeabilized with 0.1% 100X Triton in 1× PBS for 15 min and then incubated with a primary, cross-reactive rabbit anti-SARS-CoV N monoclonal antibody (Sinobiological, distributed by Thermo Fisher, Cat. #40143-R001 at a dilution of 1:20,000) followed by a peroxidase-labelled goat anti-rabbit antibody (SeraCare, Milford, MA, USA, Cat. #5220-0336 diluted to 1:2,000) and then the peroxidase substrate (SeraCare, Cat. #5510-0030).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (SeraCare KPL Cat# 5220-0336, RRID:AB_2857917)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 or Vero E6-TMPRSS2 cells were seeded in diagonally adjacent wells of 24 well plates (12 wells seeded/plate to minimize cross contamination risk) at 3.5⨯105 cells/well one day prior to infecting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial ten-fold dilutions of clarified viral supernatants were used to inoculate Vero E6 cell monolayers (60,000 cells/well seeded one day prior) in 96□well white polystyrene microplates (Thermo Fisher, Cat. #07-200-628).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each 30 µl PCR reaction contained 5 µl of cDNA, 4.7 µl water, 14.3 µl NoROX (Qiagen, Cat. #204745), 0.7 µl Hi Rox (Qiagen, Cat. #204545), 2.5 µl each of 10 uM Tag-F and E_Sarbecco-R primers, and 0.3 µl of 10 µM E_Sarbecco-P probe.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cat.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concentration of the resulting RNA was determined first by NanoDrop spectrophotometer of two high-concentration dilutions (approximately 1 µg/µl and 100 ng/µl) measured in duplicate followed by a dilution in PBS to an approximate concentration of 2×1011 copies/mL, and then by reverse transcription droplet digital PCR (RT-ddPCR) system (Bio-Rad, Hercules, CA, USA) of two low-concentration dilutions (approximately 100 and 10 copies/µl) measured in duplicate with the Mills-sgE primer/probe set.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NanoDrop</div><div>suggested: None</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

There are a number of limitations to the work presented here. Most importantly, it is not known whether viral isolation is a perfect laboratory correlate for viral infectivity and transmission in humans, which can vary significantly by time, distance, anatomy or mask wearing, and host immune status. We did not specifically convert CT to viral load given the multiple loci and tests investigated and the presence of mixed genomic and subgenomic transcripts for certain qRT-PCR sets. CT values are strongly assay-and instrument-dependent, and so other labs would need to validate the sensitivity of these primers against independent standard curves in order to calibrate assay performance before putting either the WHO-E CT limit or the Mills-sgE assay into use in their own labs. Finally, this work raises several important questions regarding the basic virology of SARS-CoV-2. The variation in viral titers generated from samples harvested at similar levels of CPE is intriguing, especially as we observed relatively little variation in RNA levels seen in these same samples (Supplemental Table S2). Potential variations in the ratio of infectious virus titers to RNA levels has important implications, as current dogma generally assumes a constant relationship between total RNA and levels of infectious virus in clinical samples. Higher levels of viral RNA correlate with poorer clinical outcomes for instance [38], but in general it has been difficult if not impossible to routinely measure infe...

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

---

Reply to the reviewers

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

In this manuscript, Mishima et al., designed a reporter system (dubbed PACE, for Parallel Analysis of Codon Effects) to assess the effect of codon usage in regulating mRNA stability in a controlled sequence context. This reporter corresponds to a stretch of 20 repetitions of a given codon (to be tested for its effect on mRNA stability), each repetition being separated by one codon corresponding to each of the 20 canonical amino acids. This stretch is inserted at the 3' end of the coding sequence of a superfolder GFP flanked with fixed 5' and 3' untranslated regions. In vitro transcribed capped and polyadenylated RNAs are then produced from these reporters (each with a specific stretch of repetitions of a given codon), pooled together and injected into zebrafish zygotes to monitor their relative abundance at different time points upon injection.

Using the PACE reporter, the authors were able to obtain a quantitative estimation of the impact of 58 out of the 61 sense codons on modulating mRNA stability. Their results are in agreement with a previous report that estimated the effect of codon usage on mRNA stability using endogenous mRNAs and an ORFeome library (Bazzini et al., 2016). However, contrary to relying on endogenous mRNAs and ORFeome reporters, the advantage of the PACE strategy is that the effect of the codon to be studied can be probed in a defined context, thus avoiding the presence of other motifs or transcript features that could also regulate mRNA stability. Similarly to results from Bazzini et al., 2016, the authors show that blocking translation completely abrogates the effect of codon usage, indicating that translation is required to drive codon-dependent mRNA degradation from their reporters. Also, the extent of codon-dependent mRNA decay is correlated with tRNA abundance and occurs through a process involving mRNA deadenylation as previously described in the zebrafish (Mishima et al., 2016 and Bazzini et al., 2016).

Having validated their PACE protocol, the authors performed ribosome profiling to test whether ribosome occupancy on tested codons is correlated with their capacity to drive mRNA degradation. Their results indicate that, at least for polar amino acids, there is indeed an inverse correlation between ribosome occupancy at tested codons and mRNA stability thus suggesting that slow decoding of codons due to low levels of available cognate tRNA can induce mRNA degradation. The authors further validate this finding by reducing the levels of aminoacylated tRNAAsn (corresponding a polar amino acid) and showing that stability of the reporter RNA carrying a stretch of AAC codons (decoded by tRNAAsnGUU) is reduced. To test whether codon-dependent mRNA degradation in the context of slow ribosome decoding lead to ribosome stalling and collisions, the authors generated a mutant zebrafish strain with impaired expression of ZNF598 (an essential factor of the No-Go decay (NGD) pathway in yeast). They also integrated a known ribosome stalling sequence from hCMV (and a mutant version that does not trigger ribosome stalling) in their sfGFP reporter construct as a positive control for NGD in their assays. Their results indicate that although ZNF598 depletion impairs degradation of the hCMV reporter (as expected), it does not affect codon-dependent mRNA degradation, which appears to occur for most codons through a NGD-independent manner. Finally, through the use of a tandem ORF reporter assay separated by codon tags to be tested, the authors show that destabilizing codons do not stall ribosomes but only lead to their transient slowdown which induces mRNA deadenylation and degradation in a ZNF598-independent manner.

Overall, the manuscript is very well written and pleasant to read. The introduction is well documented and relevant to the study as it allows readers to place the study in the current context of the field while highlighting open questions that have not been addressed yet. The results are clearly presented, the technical approaches are elegant and the conclusions convincing.

Below you will find some major and minor points that, in my opinion, should be addressed by the authors.

**Major point:**

• One interesting aspect of the PACE reporter assay is the possibility to monitor ribosome occupancy in parallel for all codon-tags tested, which the authors did in Figure 3. However, instead of using RNA-seq data to normalize ribosome footprints and obtain ribosome occupancy, the authors used an alternative normalization approach consisting, for each codon-tag, to calculate the number of ribosome footprints with test codons in the A site divided by the number of ribosome footprints with spacer codons in the A site. This approach is elegant and appears to work with codons corresponding to polar amino acids. However, it might have its limitations for other codons.

Indeed, ribosome dwell times (in yeast and mammals) have been shown to respond both to tRNA availability but also to other features such as the nature of the pair of adjacent codons, and the nature of the amino acid within the exit channel (Gobet C et al., 2020 PNAS; Gamble CE et al., 2016 Cell; Pavlov MY et al., 2009 PNAS). However, based on the work of "Buschauer R et al., 2020 Science", only ribosomes lacking an accommodated tRNA at the A site are able to recruit Ccr4-Not to mediate mRNA deadenylation and degradation. Other events that increase ribosome dwell time (and thus occupancy), such as slow peptidyl-transfer, do not lead to Ccr4-Not recruitment and are resolved by eIF5A. It is therefore possible that depending on the nature of the codon that is being tested, ribosome occupancy at test and spacer codons can be biased by the nature of codon-pairs and "dilute" the effects of tRNA availability.

If the authors performed RNA-seq together with the ribosome profiling experiment, it might be interesting to use the RNA-seq data to calculate ribosome occupancy on "tested" and "spacer" codons to check whether using this normalization, they do find a negative correlation between ribosome occupancy and PACE stability. A different approach would be to perform ribosome run-off experiments using harringtonine and estimate the elongation speed across the codon tag. However, I am aware that this experiment could be tedious an expensive.

• Figure 6: Insertion of the Lys x8 AAA stretch in the tandem ORF reporter leads to a decrease in HA-DsRedEx expression compared to that of Myc-EGFP. However, results from "Juszkiewicz and Hedge, 2017" using a similar reporter in mammalian cells indicate that stretches of Lys AAA below 20 repetitions only elicit poor RQC (less than 10% of true ribosome stalling for 12 repetitions of the AAA codon). Instead, most of the loss in RFP signal results from a change in the reading frame of ribosomes due to the "slippery" translation of the poly(A) stretch. I therefore think that it could be important to perform the experiment in ZNF598 KO embryos to validate that the observed reduction in HA-dsRedEx does indeed result from stalling and RQC and not from a change in the reading frame of ribosomes.

On a similar note, how do the authors explain the decrease in signal of the Flag-EGFP and HA-DsRedEx observed when using the Flag-EGFP with non-optimal codons? I understand that RQC occurring through NGD leads to ribosome disassembly at the stalling site and possibly mRNA cleavage (thus explaining the decrease in HA-DsRedEx signal compared to Myc-EGFP). However, I would assume that codon-mediated mRNA decay (even for ORF longer than 200 of non-optimal codons) should trigger mRNA deadenylation, followed by decapping and co-translational 5'to3' mRNA degradation, following the last translating ribosome. I would therefore expect not to see any change in the HA-DsRedEx/Myc-EGFP ratio even for the non-optimal Flag-EGFP reporter. Could the 200 non-optimal codons trigger some background RQC through NGD? Or could there be some ribosome drop-off? It might be interesting to test the optimal and non-optimal Flag-EGFP reporters in the ZNF598 KO background to check whether the observed decrease in the relative amount of HA-DsRedEx results from stalling-dependent RQC.

**Minor comments:**

• The color-coded CSC results from "Bazzini et al., 2016" presented at the bottom of panel B in figure 2 are misleading because many codons (such as PheUUU, AsnAAU, TyrUAC...) are lacking information. I have the impression that the authors used the combined data from the rCSCI (obtained from the reporter RNAs) and CSC (obtained from endogenous transcripts) corresponding to Figure 1F from Bazzini et al., 2016. This data set excluded all codons that were not concordant between the endogenous and reporter CSCs (which are those that are lacking a color code in Figure 2B from this study). However, in the scatter-plot of PACE Vs CSC (from Supplemental Figure 1D of this study), the authors used the complete set of CSC values from Bazzini et al .,2016. Could the authors please use the complete set of CSC values from Bazzini et al., 2016 to color code codons in their Figure 2B?

• Figure 4B. The charged tRNA measurements seem to have been done in a single biological replicate (there aren't any error bars in the chart). I understand that the procedure is tedious and requires a large amount of total RNA to begin with, but it would be preferable to perform it in three biological replicates.

• Supplementary Figure 2B. I do not understand what the figure represents. The legend is quite cryptic and states that the panel corresponds to the information content of each reading frame. More information should be given so that readers can understand how to interpret de figure and extract periodicity information.

Reviewer #1 (Significance (Required)):

Since the seminal work from Jeff Coller's laboratory in 2015 (Presnyak et al., 2015 Cell) showing a global and major role for codon optimality in determining mRNA half-lives in yeast, the role of codon usage in modulating translation and stability of mRNAs has been widely studied in different organisms (including zebrafish and mammals). As stated by the authors in the introduction, most studies have relied on correlation analyses between codon usage and mRNA half-lives from endogenous transcripts or from ORF libraries with fixed 5'UTR and 3'UTRs. This approaches could suffer from the presence of transcript features that can participate in other mRNA degradation pathways, which could limit their use when performing further mechanistic studies.

The work by Mishima and collaborators presents an original reporter assay that allows to evaluate the role of codon usage on regulating mRNA stability in a defined context, thus avoiding the impact of confounding factors that could bias the measurement of mRNA stability. Results obtained using this reporter are in good agreement with previous reports from Zebrafish (Bazzini et al 2016., and Mishima et al., 2016). From this validated reporter approach, the authors further show that codon-dependent mRNA degradation is directly related to tRNA availability and (at least partially) to ribosome occupancy (two factors already suggested as being important for codon-mediated decay in zebrafish, although they were based on correlation analyses). Furthermore, the authors show that codon-mediated mRNA decay occurs during productive mRNA translation and that it is functionally distinct from RQC induced by ribosome stalling. As a consequence, codon-mediated mRNA degradation is independent from the RQC factor ZNF598 (which they also validate for the first time as an important RQC factor in zebrafish). This information is new within metazoans since only in yeast it has been clearly shown that codon-mediated mRNA decay is distinct from RQC induced by ribosome stalling and collisions.

Taken together, the reported findings will be of interest to the community working on mRNA metabolism and translation. It could also interest, more broadly, scientists working on translational selection and genome evolution.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

In this manuscript, Mishima et al aim to determine if the RNA-mediated decay determined by codon optimality is part of the ribosome quality control pathway, triggered by slowed codon decoding and ribosome stalling or it is an independent pathway.

To this end, the authors capitalize on their previous work to design a very elegant high-throughput reporter system that can analyze individually codon usage, ribosome occupancy and tRNA abundance. This reporter system, called PACE, is rigorously validated throughout the manuscript, because blocking translation with a morpholino blocking the AUG codon demonstrated that the effects no RNA stability are translation dependent.

When most of the available codons are tested using the PACE system, the authors recapitulate codon optimality profiles similar to the ones previously uncovered using transcriptome-wide approaches.

Thanks to the design of the reporter, which alternates repeats of a test codon with random codons, the authors can calculate how quickly a ribosome decodes the test codon on average. With this approach, the authors uncover a negative correlation between RNA stability and ribosome density on codons for polar amino acids and suggest that codon optimality is related to a slower decoding of the codons.

With the PACE reporter validated, the authors can interrogate the system to gain mechanistic insights of codon optimality. First, they test if RNA decay and deadenylation mediated by codon optimality is determined, in part, by the levels of aminoacylated tRNAs available. The authors use a very elegant approach, as they overexpress a bacterial enzyme (AnsB) in zebrafish that degrades asparagine, effectively reducing the levels of tRNA-Asn. The authors demonstrate that AnsB turns a previously optimal Asn codon, AAC, into a non-optimal one. This effect is translated into RNA destabilization and deadenylation, but this effect in not extended to other codons encoding amino acids not affected by Asn. These results provide a direct experimental validation of the previously published observation of tRNA levels and codon optimality.

Finally, the authors interrogate the relationship between the codon optimality pathways and the ribosome quality control pathways, that takes care of stalled ribosomes. The authors generate a zebrafish mutant of Znf598, a vertebrate homolog of the yeast protein in charge of resolving stalled ribosomes. Using a maternal-and-zygotic mutant, the authors demonstrate that in these mutant's codon optimality proceeds as usual but ribosome stalling is not resolved, providing evidence for first time that Znf598 is involved in ribosome quality control in vertebrates.

Altogether, this manuscript presents work that builds on the previous findings of the authors and other labs but it is a qualitative leap forward rather than a marginal increment, because the body of work in the current manuscript i) establishes a reporter to dissect the mechanisms of codon optimality, ii) demonstrates that ribosome slow-down but not stalling is part of the trigger of RNA decay mediated by codon optimality, iii) demonstrates that this pathway is independent of ribosome quality control pathway and finally iv) demonstrates that vertebrate Znf598 is involved in the RNA decay mediated by ribosome stalling.

Due to these novel findings, and the rigor of the experimental design, this manuscript should be accepted for publication. The authors should first address the following comments:

**Major comment:**

1. The authors very elegantly demonstrate the impact of AnsB on the stability of the RNA reporter, and it is precisely the simplicity of the reporter that allows the authors to draw clear conclusions. Nevertheless, it would be interesting to determine if the reporter results in embryos injected with AnsB also translate to endogenous genes rich in AAC codons. The authors could perform a polyA-selected RNA-Seq in embryos treated with AnsB to determine if the transcripts rich in AAC codons are destabilized compared to wild-type, thus validating the reporter results in endogenous genes. **Minor comments:**

In figure 5J the authors plot the normalized codon tag levels of the PACE reporter run in the MZznf598 mutant. The authors color code the labels in the x-axis following the PACE results in wild-type (figure 2B). The authors should also plot the wild-type values to have a direct visual comparison of the results trend in both genotypes. The authors focus in the title on the role of Znf598 or the lack thereof in RNA decay induced by codon optimality. However, for the non-aficionados in codon-optimality, ZnF598 is an unknown protein and adds little information to the title. The authors should provide a more informative title, directly pinpointing that codon-optimality is independent of the ribosome quality control pathway.

Reviewer #2 (Significance (Required)):

This manuscript presents work that builds on the previous findings made by the authors and other laboratories but it is a qualitative leap forward rather than a marginal increment, because the body of work in the current manuscript i) establishes a reporter to dissect the mechanisms of codon optimality, ii) demonstrates that ribosome slow-down but not stalling is part of the trigger of RNA decay mediated by codon optimality, iii) demonstrates that this pathway is independent of ribosome quality control pathway and finally iv) demonstrates that vertebrate Znf598 is involved in the RNA decay mediated by ribosome stalling.

In addition to the conceptual findings, the authors establish a new high-throughput reporter system to evaluate the influence of codon optimality in RNA decay.

The work its done in zebrafish embryos, an in vivo model system where codon optimality has been extensively tested by the authors and others, following the stability of reporter and endogenous genes.

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

Mishima et al. address a very timely topic of how the codon composition of the ORF and the associated translation elongation speed affect mRNA stability. Several studies have already shown a strong correlation between codon optimality and mRNA stability - meaning the more "optimal" the codons, the faster supposedly the elongation speed and the more stable the mRNA. Most of these studies were done by analyzing global expression data, with limited follow up, therefore being also impacted by other co-translational mRNA decay pathways and in addition these studies could also not test directly the effect of each single codon on mRNA stability. The authors took a systematic reporter-based assay approach, called PACE, which allowed them to test systematically the effect of codon composition on mRNA decay. By integrating also ribosome profiling data, the authors could nicely show that the speed of translation (measured by ribosome density) correlates with their determined mRNA stability effect of each codon and also the corresponding tRNA levels. However, interestingly this seems to be the case only for codons encoding polar amino acids, but not the ones that encode charged or non-polar amino acids. It will be very interesting to find out why that is? Finally, the authors address if some of the effects they see might be due to ribosome collisions and associated no go decay (NGD). For this they generated a Znf598 mutant by CRISPR-Cas9. Znf598 is the proposed homolog of Hel2, the protein in yeast that is essential for NGD. The authors go on to show that NGD is defective in this mutant, but that codon mediated decay, which is elongation dependent, is not to a large part not dependent on Znf598.

**All minor comments:**

1. It is intriguing why only polar AAs show a tRNA amount specific effect in the ribosome footprint data. Some hypothesis/discussion about this could be expanded further in the discussion or results.
2. On the same token some additional analysis might be helpful. For example, in Figure 2E, the authors group codons in weak, neutral and strong based on PACE measurements and then look at the tRNA expression range for each of the three groups. Could the authors do this also separately for the codons of polar, non-polar and charged amino acids? What do you see - still the same pattern as for all the codons or do again only polar amino acids show the trend?
3. Can the authors elaborate on the development of their PACE system? Why is it designed the way it is? What parameters did they test? For example, why the 20 amino acids tail, did you you test shorter sequences of the amino acid, spacer repeats, etc?
4. The next few questions are a bit more of a technical nature regarding the reporter construct used for PACE.
5. Did all AA pairs (Codon of interest + spacer codon) behave the same in the footprint assay? Does the data have enough information and resolution for this?
6. Was the order of the spacer codons always the same in all the constructs? Could the specific order, if it is consistent, have any unseen consequences (ie. interaction with the exit tunnel)? Did the authors test other orders?
7. Are the spacer codons optimized?
8. Are the codons affected in the NGD mutant the ones that are most different in the Bazzini data?
9. The authors inject directly mRNA into the embryos, therefore avoiding that the reporter mRNA is ever in the nucleus. However, there could be nuclear events (e.g. loading of particular proteins) that might affect the fate of an mRNA in the cytosol, among these the translation efficiency and also stability. Maybe some comment in the discussion as to the effect of missing nuclear factors would be welcome. This is not a criticism; it would just be nice to hear the authors' thoughts on that.
10. Page 6; final paragraph: "Finally, we compared the speed of the ribosome translating mRNA destabilizing codons to that of an aberrantly stalled ribosome." Not sure the authors did that actually. They tested the effect of ribosome slowing down on protein production and mRNA levels and compared that to stalling ribosomes, but did not compare the "speed" directly and I am not even sure what they mean by that in this context. Probably good to rephrase.

Page 7, upper half: ".....by taking the positional effect of codon-mediated decay into account (Mishima and Tomari, 2016)."

This is my limited knowledge of the literature, but I think you should mention what this positional effect is and not just cite a paper.

Very minor, but on page 8 when PACE is introduced, the authors show the different destabilizing effects of the three Ile codons. While that is ok, in the section before, when the authors tested their construct by qRT-PCR, they focused on the two Leu codons. I would also mention them here and do a direct comparison of the qRT-PCR results with the pooled PACE result for these two codons. Based on the figure the two codons seem to behave qualitatively like expected, but I am not sure how good the quantitative behavior matches. The AnsB experiment - the authors only mention data about one of the two Asn codons (AAC), but what about the second Asn codon (AAU) - do you also see an effect on that codon upon overexpression of AnsB as well? AAU is already a quite destabilizing codon and you might not see a further increase in destabilization, but it would be great to know if there was or not. Page 13, second paragraph: More out of interest, but it is quite intriguing that GCG turned into a destabilizing codon (opposite of what one would expect if NGD would play a bit a role). Any speculation why? Page 14, end of page and related to Figure 6C: AAU seems much more destabilizing than AAC. Therefore, I would have expected that the inserted sequence with the AAU codons would lead actually to downregulation of the mRNA and therefore the EGFP and DsRFP total protein signal relative to the construct with the AAC inserted in between, even if the ratio of EGFP/DsRed seems unchanged. However, based on the western blot in 6C the total protein levels seem very similar. Isn't that surprising? Although, AAU obviously allows translation to proceed it should still induce a stronger mRNA decay than AAC and therefore result in less total mRNA (and protein level as a consequence). Did the authors quantify the exact levels of the reporter proteins and mRNA and compared them between the two constructs? Page 15, last sentence: Somehow for me the word "transient" is a bit hard to grasp in this context. What do you mean by that - do you really mean "impermanent" or "lasting only for a short amount of time"? Don't you simply mean "weaker", "less strong"? Page 17, second sentence: I think the authors want to reference here Figure 2E and not Figure 2D.

Reviewer #3 (Significance (Required)):

All in all, I have to say that it was a real pleasure to read this manuscript. The authors were extremely thorough with their experiments and did nearly never overstate any of their conclusions. It is a very insightful story, which in my opinion will contribute greatly to the field of gene expression and posttranscriptional gene expression regulation in particular. The PACE assay, although a bit artificial, gave very clean results, which agree with the previous literature and could be very useful for future studies. Generating the Znf598 mutant and showing that the codon-dependent decay is independent from NGD is a great addition to this paper. Although it is a bit of a pity that we do not see more of a characterization of the Znf598 mutant in this paper, I do agree with the authors that this might take away a bit of the focus of this manuscript and that the mutant deserves actually its own story. I only have very minor comments/questions for the authors that they should be able to address easily. Finally, I can only repeat myself by saying: congrats on this great paper and I fully support publication.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

---

Referee #2

Evidence, reproducibility and clarity

In this manuscript, Mishima et al aim to determine if the RNA-mediated decay determined by codon optimality is part of the ribosome quality control pathway, triggered by slowed codon decoding and ribosome stalling or it is an independent pathway.

To this end, the authors capitalize on their previous work to design a very elegant high-throughput reporter system that can analyze individually codon usage, ribosome occupancy and tRNA abundance. This reporter system, called PACE, is rigorously validated throughout the manuscript, because blocking translation with a morpholino blocking the AUG codon demonstrated that the effects no RNA stability are translation dependent.

When most of the available codons are tested using the PACE system, the authors recapitulate codon optimality profiles similar to the ones previously uncovered using transcriptome-wide approaches.

Thanks to the design of the reporter, which alternates repeats of a test codon with random codons, the authors can calculate how quickly a ribosome decodes the test codon on average. With this approach, the authors uncover a negative correlation between RNA stability and ribosome density on codons for polar amino acids and suggest that codon optimality is related to a slower decoding of the codons.

With the PACE reporter validated, the authors can interrogate the system to gain mechanistic insights of codon optimality. First, they test if RNA decay and deadenylation mediated by codon optimality is determined, in part, by the levels of aminoacylated tRNAs available. The authors use a very elegant approach, as they overexpress a bacterial enzyme (AnsB) in zebrafish that degrades asparagine, effectively reducing the levels of tRNA-Asn. The authors demonstrate that AnsB turns a previously optimal Asn codon, AAC, into a non-optimal one. This effect is translated into RNA destabilization and deadenylation, but this effect in not extended to other codons encoding amino acids not affected by Asn. These results provide a direct experimental validation of the previously published observation of tRNA levels and codon optimality.

Finally, the authors interrogate the relationship between the codon optimality pathways and the ribosome quality control pathways, that takes care of stalled ribosomes. The authors generate a zebrafish mutant of Znf598, a vertebrate homolog of the yeast protein in charge of resolving stalled ribosomes. Using a maternal-and-zygotic mutant, the authors demonstrate that in these mutant's codon optimality proceeds as usual but ribosome stalling is not resolved, providing evidence for first time that Znf598 is involved in ribosome quality control in vertebrates.

Altogether, this manuscript presents work that builds on the previous findings of the authors and other labs but it is a qualitative leap forward rather than a marginal increment, because the body of work in the current manuscript i) establishes a reporter to dissect the mechanisms of codon optimality, ii) demonstrates that ribosome slow-down but not stalling is part of the trigger of RNA decay mediated by codon optimality, iii) demonstrates that this pathway is independent of ribosome quality control pathway and finally iv) demonstrates that vertebrate Znf598 is involved in the RNA decay mediated by ribosome stalling.

Due to these novel findings, and the rigor of the experimental design, this manuscript should be accepted for publication. The authors should first address the following comments:

Major comment:

1. The authors very elegantly demonstrate the impact of AnsB on the stability of the RNA reporter, and it is precisely the simplicity of the reporter that allows the authors to draw clear conclusions. Nevertheless, it would be interesting to determine if the reporter results in embryos injected with AnsB also translate to endogenous genes rich in AAC codons. The authors could perform a polyA-selected RNA-Seq in embryos treated with AnsB to determine if the transcripts rich in AAC codons are destabilized compared to wild-type, thus validating the reporter results in endogenous genes.

Minor comments:

1. In figure 5J the authors plot the normalized codon tag levels of the PACE reporter run in the MZznf598 mutant. The authors color code the labels in the x-axis following the PACE results in wild-type (figure 2B). The authors should also plot the wild-type values to have a direct visual comparison of the results trend in both genotypes.
2. The authors focus in the title on the role of Znf598 or the lack thereof in RNA decay induced by codon optimality. However, for the non-aficionados in codon-optimality, ZnF598 is an unknown protein and adds little information to the title. The authors should provide a more informative title, directly pinpointing that codon-optimality is independent of the ribosome quality control pathway.

Significance

This manuscript presents work that builds on the previous findings made by the authors and other laboratories but it is a qualitative leap forward rather than a marginal increment, because the body of work in the current manuscript i) establishes a reporter to dissect the mechanisms of codon optimality, ii) demonstrates that ribosome slow-down but not stalling is part of the trigger of RNA decay mediated by codon optimality, iii) demonstrates that this pathway is independent of ribosome quality control pathway and finally iv) demonstrates that vertebrate Znf598 is involved in the RNA decay mediated by ribosome stalling.

In addition to the conceptual findings, the authors establish a new high-throughput reporter system to evaluate the influence of codon optimality in RNA decay.

The work its done in zebrafish embryos, an in vivo model system where codon optimality has been extensively tested by the authors and others, following the stability of reporter and endogenous genes.

Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

---

Referee #1

Evidence, reproducibility and clarity

In this manuscript, Mishima et al., designed a reporter system (dubbed PACE, for Parallel Analysis of Codon Effects) to assess the effect of codon usage in regulating mRNA stability in a controlled sequence context. This reporter corresponds to a stretch of 20 repetitions of a given codon (to be tested for its effect on mRNA stability), each repetition being separated by one codon corresponding to each of the 20 canonical amino acids. This stretch is inserted at the 3' end of the coding sequence of a superfolder GFP flanked with fixed 5' and 3' untranslated regions. In vitro transcribed capped and polyadenylated RNAs are then produced from these reporters (each with a specific stretch of repetitions of a given codon), pooled together and injected into zebrafish zygotes to monitor their relative abundance at different time points upon injection.

Using the PACE reporter, the authors were able to obtain a quantitative estimation of the impact of 58 out of the 61 sense codons on modulating mRNA stability. Their results are in agreement with a previous report that estimated the effect of codon usage on mRNA stability using endogenous mRNAs and an ORFeome library (Bazzini et al., 2016). However, contrary to relying on endogenous mRNAs and ORFeome reporters, the advantage of the PACE strategy is that the effect of the codon to be studied can be probed in a defined context, thus avoiding the presence of other motifs or transcript features that could also regulate mRNA stability. Similarly to results from Bazzini et al., 2016, the authors show that blocking translation completely abrogates the effect of codon usage, indicating that translation is required to drive codon-dependent mRNA degradation from their reporters. Also, the extent of codon-dependent mRNA decay is correlated with tRNA abundance and occurs through a process involving mRNA deadenylation as previously described in the zebrafish (Mishima et al., 2016 and Bazzini et al., 2016). Having validated their PACE protocol, the authors performed ribosome profiling to test whether ribosome occupancy on tested codons is correlated with their capacity to drive mRNA degradation. Their results indicate that, at least for polar amino acids, there is indeed an inverse correlation between ribosome occupancy at tested codons and mRNA stability thus suggesting that slow decoding of codons due to low levels of available cognate tRNA can induce mRNA degradation. The authors further validate this finding by reducing the levels of aminoacylated tRNAAsn (corresponding a polar amino acid) and showing that stability of the reporter RNA carrying a stretch of AAC codons (decoded by tRNAAsnGUU) is reduced. To test whether codon-dependent mRNA degradation in the context of slow ribosome decoding lead to ribosome stalling and collisions, the authors generated a mutant zebrafish strain with impaired expression of ZNF598 (an essential factor of the No-Go decay (NGD) pathway in yeast). They also integrated a known ribosome stalling sequence from hCMV (and a mutant version that does not trigger ribosome stalling) in their sfGFP reporter construct as a positive control for NGD in their assays. Their results indicate that although ZNF598 depletion impairs degradation of the hCMV reporter (as expected), it does not affect codon-dependent mRNA degradation, which appears to occur for most codons through a NGD-independent manner. Finally, through the use of a tandem ORF reporter assay separated by codon tags to be tested, the authors show that destabilizing codons do not stall ribosomes but only lead to their transient slowdown which induces mRNA deadenylation and degradation in a ZNF598-independent manner.

Overall, the manuscript is very well written and pleasant to read. The introduction is well documented and relevant to the study as it allows readers to place the study in the current context of the field while highlighting open questions that have not been addressed yet. The results are clearly presented, the technical approaches are elegant and the conclusions convincing.

Below you will find some major and minor points that, in my opinion, should be addressed by the authors.

Major point:

• One interesting aspect of the PACE reporter assay is the possibility to monitor ribosome occupancy in parallel for all codon-tags tested, which the authors did in Figure 3. However, instead of using RNA-seq data to normalize ribosome footprints and obtain ribosome occupancy, the authors used an alternative normalization approach consisting, for each codon-tag, to calculate the number of ribosome footprints with test codons in the A site divided by the number of ribosome footprints with spacer codons in the A site. This approach is elegant and appears to work with codons corresponding to polar amino acids. However, it might have its limitations for other codons.

Indeed, ribosome dwell times (in yeast and mammals) have been shown to respond both to tRNA availability but also to other features such as the nature of the pair of adjacent codons, and the nature of the amino acid within the exit channel (Gobet C et al., 2020 PNAS; Gamble CE et al., 2016 Cell; Pavlov MY et al., 2009 PNAS). However, based on the work of "Buschauer R et al., 2020 Science", only ribosomes lacking an accommodated tRNA at the A site are able to recruit Ccr4-Not to mediate mRNA deadenylation and degradation. Other events that increase ribosome dwell time (and thus occupancy), such as slow peptidyl-transfer, do not lead to Ccr4-Not recruitment and are resolved by eIF5A. It is therefore possible that depending on the nature of the codon that is being tested, ribosome occupancy at test and spacer codons can be biased by the nature of codon-pairs and "dilute" the effects of tRNA availability.

If the authors performed RNA-seq together with the ribosome profiling experiment, it might be interesting to use the RNA-seq data to calculate ribosome occupancy on "tested" and "spacer" codons to check whether using this normalization, they do find a negative correlation between ribosome occupancy and PACE stability. A different approach would be to perform ribosome run-off experiments using harringtonine and estimate the elongation speed across the codon tag. However, I am aware that this experiment could be tedious an expensive.

• Figure 6: Insertion of the Lys x8 AAA stretch in the tandem ORF reporter leads to a decrease in HA-DsRedEx expression compared to that of Myc-EGFP. However, results from "Juszkiewicz and Hedge, 2017" using a similar reporter in mammalian cells indicate that stretches of Lys AAA below 20 repetitions only elicit poor RQC (less than 10% of true ribosome stalling for 12 repetitions of the AAA codon). Instead, most of the loss in RFP signal results from a change in the reading frame of ribosomes due to the "slippery" translation of the poly(A) stretch. I therefore think that it could be important to perform the experiment in ZNF598 KO embryos to validate that the observed reduction in HA-dsRedEx does indeed result from stalling and RQC and not from a change in the reading frame of ribosomes. On a similar note, how do the authors explain the decrease in signal of the Flag-EGFP and HA-DsRedEx observed when using the Flag-EGFP with non-optimal codons? I understand that RQC occurring through NGD leads to ribosome disassembly at the stalling site and possibly mRNA cleavage (thus explaining the decrease in HA-DsRedEx signal compared to Myc-EGFP). However, I would assume that codon-mediated mRNA decay (even for ORF longer than 200 of non-optimal codons) should trigger mRNA deadenylation, followed by decapping and co-translational 5'to3' mRNA degradation, following the last translating ribosome. I would therefore expect not to see any change in the HA-DsRedEx/Myc-EGFP ratio even for the non-optimal Flag-EGFP reporter. Could the 200 non-optimal codons trigger some background RQC through NGD? Or could there be some ribosome drop-off? It might be interesting to test the optimal and non-optimal Flag-EGFP reporters in the ZNF598 KO background to check whether the observed decrease in the relative amount of HA-DsRedEx results from stalling-dependent RQC.

Minor comments:

• The color-coded CSC results from "Bazzini et al., 2016" presented at the bottom of panel B in figure 2 are misleading because many codons (such as PheUUU, AsnAAU, TyrUAC...) are lacking information. I have the impression that the authors used the combined data from the rCSCI (obtained from the reporter RNAs) and CSC (obtained from endogenous transcripts) corresponding to Figure 1F from Bazzini et al., 2016. This data set excluded all codons that were not concordant between the endogenous and reporter CSCs (which are those that are lacking a color code in Figure 2B from this study). However, in the scatter-plot of PACE Vs CSC (from Supplemental Figure 1D of this study), the authors used the complete set of CSC values from Bazzini et al .,2016. Could the authors please use the complete set of CSC values from Bazzini et al., 2016 to color code codons in their Figure 2B?
• Figure 4B. The charged tRNA measurements seem to have been done in a single biological replicate (there aren't any error bars in the chart). I understand that the procedure is tedious and requires a large amount of total RNA to begin with, but it would be preferable to perform it in three biological replicates.
• Supplementary Figure 2B. I do not understand what the figure represents. The legend is quite cryptic and states that the panel corresponds to the information content of each reading frame. More information should be given so that readers can understand how to interpret de figure and extract periodicity information.

Significance

Since the seminal work from Jeff Coller's laboratory in 2015 (Presnyak et al., 2015 Cell) showing a global and major role for codon optimality in determining mRNA half-lives in yeast, the role of codon usage in modulating translation and stability of mRNAs has been widely studied in different organisms (including zebrafish and mammals). As stated by the authors in the introduction, most studies have relied on correlation analyses between codon usage and mRNA half-lives from endogenous transcripts or from ORF libraries with fixed 5'UTR and 3'UTRs. This approaches could suffer from the presence of transcript features that can participate in other mRNA degradation pathways, which could limit their use when performing further mechanistic studies.

The work by Mishima and collaborators presents an original reporter assay that allows to evaluate the role of codon usage on regulating mRNA stability in a defined context, thus avoiding the impact of confounding factors that could bias the measurement of mRNA stability. Results obtained using this reporter are in good agreement with previous reports from Zebrafish (Bazzini et al 2016., and Mishima et al., 2016). From this validated reporter approach, the authors further show that codon-dependent mRNA degradation is directly related to tRNA availability and (at least partially) to ribosome occupancy (two factors already suggested as being important for codon-mediated decay in zebrafish, although they were based on correlation analyses). Furthermore, the authors show that codon-mediated mRNA decay occurs during productive mRNA translation and that it is functionally distinct from RQC induced by ribosome stalling. As a consequence, codon-mediated mRNA degradation is independent from the RQC factor ZNF598 (which they also validate for the first time as an important RQC factor in zebrafish). This information is new within metazoans since only in yeast it has been clearly shown that codon-mediated mRNA decay is distinct from RQC induced by ribosome stalling and collisions.

Taken together, the reported findings will be of interest to the community working on mRNA metabolism and translation. It could also interest, more broadly, scientists working on translational selection and genome evolution.

Reviewer #1 (Public Review):

Strength: Chromatin remodelers regulate chromatin-templated functions through mobilizing and positioning nucleosomes; however, the molecular mechanisms underlying the binding and target-search remain obscure. Kim et al. utilize the powerful live-cell single-molecule tracking technique to investigate the binding and target-search kinetics of a comprehensive set of ATP-dependent chromatin remodelers. They endogenously tag the catalytic subunits of 6 major chromatin remodeling complexes and find that these remodelers reside at chromatin with 4-7 s mean residence times. Their results indicate these chromatin remodelers frequently transition between bound and free states. By using the remodeler mutants that are defective in binding or hydrolyzing ATP, they uncover that the ATPase activity is critical for dissociation of remodelers from chromatin. They reveal that ATP binding rather than ATP hydrolysis facilitates mobility of chromatin-bound fraction of remodelers at chromatin. Finally, they calculate the temporal occupancy of remodelers. Based upon these novel results, they provide a 'tug-of-war' model that explain how remodelers temporally control accessibility of promoters for transcription initiation. These results well support the authors; claims and conclusions and provide novel insights into the dynamic process underlying how remodelers search, locate, and bind target sites.

Weakness: There is no major weaknesses of the manuscript. Re-analysis of some data will strength this manuscript but will not change the claims and conclusions.

Reviewer #3 (Public Review):

The paper by Kim et al uses elegant Halo-tag imaging techniques to study the dynamics of a set of 6 nucleosome remodelers in yeast. They model their data to show two populations of slower and faster turnover or movement, and find that remodeler mobility sits appropriately between that of histones and free Halo tag. The authors find that ATP binding (and not necessarily hydrolysis) regulates the rapid movement, as mutations in the Walker A (and to a lesser extent, Walker B motif in CHD1 and ISW2) reduce movement. They suggest that ATP hydrolysis facilitates a rapid movement along the chromatid fiber. Transcriptional elongation is not a source of remodeler movement, on the other hand.

Complementing other data that supports a model of a "tug-of-war" between various types of remodelers at promoters, the authors argue for nucleosomal "pushing and pulling" (split among pushers and puller enzyme complexes that turn over rapidly) as a mode for balancing promoter accessibility.

SciScore for 10.1101/2021.07.16.452441: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TwinStrep-tagged protein expression and purification: RBDWT, RBDQ498Y and RBDβbaculovirus were used to infect Sf9 cells in a 1:2000 dilution, for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBDQ498Y-ACE2 complex crystallization: Sf9 insect cells were infected with RBDQ498Y and TwinStrep-tagged ACE2 (1:2000) separately for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBDQ498Y-ACE2 complex crystallization: Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were digested from delivery generic vectors using BamHI and NotI restriction enzymes (FastDigest) and cloned in the pAcGP67A transfer vector using Optizyme™ T4 DNA Ligase (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAcGP67A</div><div>suggested: RRID:Addgene_41812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An N-terminal TwinStrep tag and 3C site containing version of ACE2 with no His tag was generated by PCR using ACE2 plasmid DNA as template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:Addgene_164219)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure was solved by molecular replacement using Phaser and previously deposited coordinates for RBDWT-ACE2 complex (PDB accession number 6M0J) as template, and refined using Phenix.refine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final molecule was generated after several cycles of manual building in Coot followed by refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

Industry execs optimistic about runoff, which should benefit from rising pricing trends.

SciScore for 10.1101/2021.07.14.452313: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression was performed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike protein constructs: The SARS-CoV spike protein constructs were expressed in HEK293-6E cells and purified via a C-terminally introduced 6 X His-Tag with Ni-NTA affinity chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-6E</div><div>suggested: RRID:CVCL_HF20)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: hACE2: The biotinylated hACE2-fc (residues 18-740) was purchased by Acrobiosystems and contains a C-terminal IgG1 Fc-Tag (residues 100-330), followed by a biotinylated Avitag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Acrobiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• No funding statement was detected.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

certainly a fiction is a kind of idea but it's not a "lie"....it is just fictional...it may be a lie if some agent remove the "fiction" tag and stamp "historical" instead..

Anyway..is mathemathics fictional? aren't they real?

Reviewer #2 (Public Review):

The paper by Huber et al. analyzes the detoxification strategy of an insect herbivore, the cockchafer, against a prominent defensive compound, taraxinic acid glucopyranosyl ester (TA-G), of dandelions, one of the beetle larvae's preferred food plants. As the authors can convincingly show a beta glucosidase, a digesting enzyme in the herbivore's gut, acts as a detoxification enzyme and simultaneously seems to induce the beetle larvae to avoid plants with this defensive compound. The data presented cover the full range from physiological and chemical analytical data exploring the fate of the plant defense compound in the larvae's digestive system to transcriptomic analyses identifying the beetle's relevant beta glucosidase with their tissue and diet specific expression level to cell culture expression of those beta glucosidases and functional verification whether they are able to deglycosylate TAG. The authors thereby home in on one specific enzyme that has the strongest TAG cleaving activity and further demonstrate its effect by silencing it via RNAi. This knock down results in significantly reduced growth of larvae exposed to the toxin, on the other hand, the presence of the enzyme was necessary to elicit the TAG avoidance behavior previously reported for cockchafer larvae.

The manuscript flawlessly follows up on the observed detoxification ability of the beetle larvae from one organismic level to the next and provides an in depth analysis of the phenomenon. All analyses have been carefully performed, correctly analysed and fully support the conclusions drawn. The manuscript is well written and provides a well laid out case study on how digestive enzymes of an insect herbivore can be coopted to provide a specific adaptation to a preferred host plant and not only circumvent its main defense but also modulate the herbivores behavior.

I had never really wondered about the origins of tags and hashtags, even though I knew they were a somewhat recent phenomenon in terms of use by the general population. But this made me wonder if it happened as a result of the already common practice of tagging in code, or if it developed on its own. Turns out, we owe it all to programmers and wildfires!

iGracias! Frida Silva for demonstrating the scaffold (hashtag, sequence, what to write in). This is a clear example I want to share with my colleagues.

SciScore for 10.1101/2021.07.05.451222: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All human donors were assessed for medical decision-making capacity using a standardized, approved assessment, and voluntarily gave informed consent prior to being enrolled in the study.<br>Field Sample Permit: Ethics Statement: The mice and rhesus macaque animal studies were approved and carried out in accordance with protocols provided to the Institutional Animal Care and Use Committee (IACUC) respectively at The Scripps Research Institute (TSRI; La Jolla, CA) under approval number 19-0020 and at Alphagenesis Institutional Animal Care and Use Committee (IACUC) under approval number AUP 19-10.<br>IACUC: Ethics Statement: The mice and rhesus macaque animal studies were approved and carried out in accordance with protocols provided to the Institutional Animal Care and Use Committee (IACUC) respectively at The Scripps Research Institute (TSRI; La Jolla, CA) under approval number 19-0020 and at Alphagenesis Institutional Animal Care and Use Committee (IACUC) under approval number AUP 19-10.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">One group of 5 mice (C57BL/6 mice (Jackson Laboratory): 3 females and 2 males), aged ∼8 weeks, were immunized with 20µg SARS-CoV-2 S protein immunogen along with 5µg of SMNP adjuvant per animal per immunization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For conjugation, 500 µL (500 µg/mL) of randomly biotinylated SARS-CoV-2-RBD solution was mixed with 5 mg of cleaned T1 beads.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: 96-well half-area plates (Corning cat. #3690, Thermo Fisher Scientific) were coated overnight at 4°C with 2 μg/mL of mouse anti-His-tag antibody (Invitrogen cat. #MA1-21315-1MG, Thermo Fisher Scientific) in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washes, a secondary antibody conjugated with alkaline phosphatase (AffiniPure goat anti-human IgG Fc fragment specific, Jackson ImmunoResearch Laboratories cat. #109-055-008) diluted 1:1000 in 1% BSA/PBST, was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-008, RRID:AB_2337601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage of neutralization was calculated according to the equation:

The 50% pseudovirus neutralizing (IC50) or binding (ID50) antibody titer was calculated by non- linear fitting the plots of luciferase signals against antibody concentrations or sera dilution ratio in Graph Pad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ID50</div><div>suggested: (bNAber Cat# bNAberID_50, RRID:AB_2491067)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization of anti-RBD antibody depleted macaque sera, the immune sera were depleted by two rounds of sequential incubation with SARS-CoV-2 RBD-conjugated with magnetic beads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: Heavy chain sequences of neutralizing and non-neutralizing antibodies collected from animals K398 and K288 were processed using DiversityAnalyzer tool (92).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K288</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient transfection: To express antibodies, the corresponding HC and LC plasmids were transiently transfected into the Expi293 cell (Life Technologies) at 3 x 106 cells/mL with FectoPRO PolyPlus transfection reagent (Polyplus Cat # 116-040).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To express the soluble S ectodomain proteins from SARS-CoV-1, SARS-CoV-2 and their truncations, plasmids were transfected into HEK293F cells (Life Technologies) at 1 million cells/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: To generate HeLa-hACE2 cells, the human ACE2 lentivirus was transduced into HeLa cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production: To generate the pseudoviruses, the MLV-gag/pol and MLV-CMV-Luciferase plasmids were co- transfected with full-length or variant SARS-CoV-1 or SARS-CoV-2 plasmid into HEK293T cells by using Lipofectamine 2000 (Thermo Fisher Scientific, 11668019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus entry and serum neutralization assays: To test the inhibition of pseudovirus infection by serum or mAbs, we used the stable cell line HeLa-hACE2 generated by lentivirus transduction with consistent ACE2 expression level to carry out the assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The truncated heavy chains were co-transfected with the corresponding light chains in 293Expi cells to produce the Fab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293Expi</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One group of 5 mice (C57BL/6 mice (Jackson Laboratory): 3 females and 2 males), aged ∼8 weeks, were immunized with 20µg SARS-CoV-2 S protein immunogen along with 5µg of SMNP adjuvant per animal per immunization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ectodomains of SARS-CoV-1 and SARS-CoV-2 were constructed by PCR amplification and Gibson assembly (NEB, E2621L) cloning into the vector phCMV3 (Genlantis, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate gene fragments encoding SARS-CoV-1 RBD (residue 307-513), SARS-CoV-2 NTD (residue 1- 290), RBD (residue 320-527), RBD-SD1 (residue 320-591), and RBD-SD1-2 (residue 320-681) subdomains, PCR-amplifications were carried out from the SARS-CoV-1 and SARS-CoV-2 plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: RRID:Addgene_164583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce the ACE2 lentivirus, the pBOB-hACE2 plasmid was co-transfected into HEK293T cells with lentiviral packaging plasmids pMDL, pREV, and pVSV-G (Addgene #12251, #12253, #8454) by Lipofectamine 2000 (Thermo Fisher Scientific, 11668019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBOB-hACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMDL</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pREV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Crystal structure determination of Fab-RBD complexes: The coding sequence for receptor binding domain (RBD; residues 333-529) of the SARS-CoV-2 spike (S) protein was synthesized and cloned into a customized pFastBac vector (84), which was designed to fuse an N-terminal gp67 signal peptide and C-terminal His6-tag to the target protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac</div><div>suggested: RRID:Addgene_1925)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protocol was approved by the UCSD Human Research Protection Program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSD Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the Protein A Sepharose was loaded into Econo-Pac columns (BioRad #7321010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRad</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The biotinylated proteins were evaluated by BioLayer Interferometry using the SA biosensor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLayer</div><div>suggested: (Harvard Medical School Center for Macromolecular Interactions Core Facility, RRID:SCR_018270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Micrographs were collected on a ThermoFisher Tecnai Spirit microscope operating at 120kV with a FEI Eagle CCD (4k) camera at 52,000 magnification using Leginon automated image collection software (81).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles were picked using DogPicker (82) and 3D classification was done using Relion 3.0 (83).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (90, 91), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

Edit

Reaching out again with new project MentorsOnline.NET

Notes: 1st edit of annotation for update of info

• 2nd use of tag: LTI-test-team

Scenario: Team building exercise, group tag(s) sorting downstream readers/ viewers (audience).

Note: First use of tag: LTI-test-team

SciScore for 10.1101/2021.07.06.21259528: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Research phlebotomy was performed at the NIH Clinical Research Center in Bethesda, MD under protocols approved by the NIH Institutional Review Board,<br>Consent: All participants provided written informed consent.<br>Field Sample Permit: Blood sample collection and processing: Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll density gradient centrifugation from whole blood collected in EDTA vacutainer tubes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and incubated with MSD SULFO-TAG™ anti-human IgG, IgA or IgM detection antibodies at RT for 60 minutes with shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular flow cytometry: PBMC were first stained with antibodies against cell surface markers CD3, CD19, CD20 and CD27, fixed (Lysing Solution, BD Biosciences), permeabilized (Permeabilizing Solution 2; BD Biosciences) and stained with antibodies against IgG, IgA, IgD and IgM (antibody details in Extended Data Table 5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibodies against IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA , IgD</div><div>suggested: (MyBioSource Cat# MBS531438, RRID:AB_10577295)</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot assay to enumerate SARS-CoV-2 spike-specific PB: Spike protein S1 and RBD-specific antibody-secreting PB were enumerated by modifying the antigen-specific portion of a previously described ELISpot assay31,32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-secreting PB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, wells of Immobilon-P polyvinylidene difluoride (PVDF) membrane 96-well plates (Millipore) were coated with 5ug/ml anti-Ig light-chain antibodies (Rockland Immunochemicals) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Ig light-chain</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated at 37°C for 5 hours, followed by overnight incubation at 4°C with biotinylated antibodies (Jackson Immunoresearch) against IgA (catalogue 109-066-011), IgG (catalogue 709-066-149), IgM (catalogue 709-066-073), or biotinylated proteins S1 (Acrobiosystems, catalogue S1N-C82E8) or RBD (Biolegend, catalogue 790904).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modeling of association between endpoint antibody concentrations and cluster frequencies: A linear model accounting for the age and gender of the longitudinal vaccine participants was used to estimate whether cell cluster frequencies in response to vaccination were associated with SARS-COV2 spike protein (S-2P/RBD) antibody concentration at endpoint (v2D28):

Analyses were carried out on both standardized antigen non-specific and specific frequencies, i.e., cluster cell counts as a fraction of total CD19+ cell counts and RBD+ S1+ cells within the clusters, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV2 spike protein (S-2P/RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA encoding sequence was cloned into the mammalian cell expression vector pCAGGS and confirmed by sequencing, prior to transient transfection in FreeStyle 293-F cells with 293fectin transfection reagent (ThermoFisher)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed with Excel (Microsoft) and Prism 9.0 (Graphpad) software and antibody concentrations were assigned arbitrary units (AU/ml) by interpolation from the standard curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Densities of antibody concentrations at endpoint (v2D28) were estimated using a gaussian kernel with bandwidth automatically selected through biased cross validation using the stat_density function from ggplot2 (3.3.3) with bw = “bcv”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stained cells were acquired on a FACS Canto II flow cytometer (BD Biosciences) and analyzed using FlowJo software v9.9.6 (BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spectral flow cytometry data processing for FlowSOM clustering and UMAP embedding: FCS files generated from spectral flow cytometry with the 17-color panel and associated manual gates were read into R using FlowWorkspace (4.2.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowWorkspace</div><div>suggested: (flowWorkspace, RRID:SCR_001155)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following markers were used to perform clustering CD20, CD138, CD38, CD10, CD11c, CD19, CD27, CD21, IgD, IgM, IgG, IgA, using FlowSOM (1.22.0)33, with the number of desired metaclusters (nClus) set to 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowSOM</div><div>suggested: (FlowSOM, RRID:SCR_016899)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The clusters were then grouped by hierarchical clustering of the mean trends using the Euclidean distance at each timepoint and using Ward’s method, as implemented in the hclust function (method = “ward.D2) in R (4.0.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hclust</div><div>suggested: (HCLUST, RRID:SCR_009154)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT00001281</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Studies of Blood and Reproductive Fluids in HIV-Infected and…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04411147</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Longitudinal Study of COVID-19 Sequelae and Immunity</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04280705</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial (ACTT)</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579393</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Fostamatinib for Hospitalized Adults With COVID-19</td></tr></table>

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

Embeddable search queries for Obsidian

Description of the Diamond. I'm going to tag this as character description assuming we're calling The Moonstone a character.

Lass uns hier eher eine abstraktere Grafik nutzen, statt screenshot vom Dashboard. Oder eventuell einfach so einer art "eingebetteten" code editor als grafik dafür. (Siehe Notion: /code befehl)

SciScore for 10.1101/2021.07.02.450964: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were incubated with the following primary antibodies: mouse anti-Actin (Cell sig, 3700), rabbit anti-IMPDH2 (Proteintec, 12948-1-AP), mouse anti-Strep-tag (Quiagen, 34850).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IMPDH2</div><div>suggested: (Proteintech Cat# 12948-1-AP, RRID:AB_2127351)</div></div><div style="margin-bottom:8px"><div>anti-Strep-tag ( Quiagen , 34850</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies: rabbit anti mouse - HRP conjugated (Millipore), mouse anti rabbit-HRP conjugated (Millipore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti mouse -</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti rabbit-HRP conjugated ( Millipore) .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cell transcriptome was used as a reference to query for Enriched GO terms from up- and down-regulated DEG lists.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon, Jang, et al., 2020) are listed in Table 14 and purified by Midi-prep using Invitrogen kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 1500ng of total DNA (1200 ng of pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Pur + 300ng of pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro) were incubated at RT for 20 min with PEI, with a ratio 3:1=PEI:DNA in 100ul of serum free medium, and the mixture was added to the cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Pur</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro</div><div>suggested: RRID:Addgene_141395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning of Nsp14 ExoN mutants: pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D90A/G92A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BsrGI-HF (NEB) and EcoRI-HF (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLXV-EIF1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>alpha-2xStrep-SARS-CoV-2-nsp14-D90A/G92A-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro</div><div>suggested: RRID:Addgene_141380)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gblock: Gaattcgccgccaccatgtggtcccatccgcagtttgagaagggtggtggttcaggcggaggctccgggggcgggagctggtctcaccc gcaatttgaaaaaggcgctgcggctgctgaaaatgtaacgggcttgtttaaagactgtagtaaagtgatcacaggactccaccccacacaag cacctacccacctttccgtagatacgaagttcaaaacggaaggattgtgtgtggatataccagggataccaaaggatatgacgtaccgaagg ctgatttccatgatgggttttaagatgaattaccaagttaatggctaccccaacatgttcatcaccagggaggaggcaattagacacgtaagag cctggataggcttcGCCgttGCCggttgccatgcaacccgggaagccgtaggcacaaaccttccgttgcagcttggcttttccacgggc gtcaacctcgttgccgtaccgactggctatgttgacacgccgaacaacaccgatttctctcgcgtaagtgctaagcctcctccgggagatcaa ttcaagcatcttatacctctcatgtaca Primers: D90AG92A_F: cacacGaattcgccgccac D90AG92A _R: cacacTGTACATGAGAGGTATAAGA pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D273A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BstBI (NEB) and AfeI (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D273A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers: D273A_F: CCACACTTCGAACTTACTTCTATG D273A_R: cacacagcgctgcttttactacc Cloning of CXCL8-Firefly reporter: pGL_RSV_RF_BG (a modification of the pGL plasmid) was a kind gift from Dr. Marr at Brandeis University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGL</div><div>suggested: RRID:Addgene_119952)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transfected with 75ng of Firefly reporter, 75ng of Renilla reporter, and 600ng of pLVX-EF1alpha-SARS-CoV-2-Nsp14-2xStrep-IRES-Puro or 600ng of empty vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-Nsp14-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Addgene plasmid # 49343; http://n2t.net/addgene:49343; RRID:Addgene_49343)(Wilson et al., 2013) 7xE-Box::Renilla was a gift from Koen Venken (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_49343)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Addgene plasmid # 124532; http://n2t.net/addgene:124532; RRID:Addgene_124532, Sarrion-Perdigones et al., 2020) At the indicated time point, cells were lysate in lysis buffer (25 mM Tris-phosphate at pH 7.8, 10% glycerol, 1% Triton X-100, 1 mg/ml of bovine serum albumin (BSA), 2 mM cyclohexylene diamin tetraacetate, and 2 mM DTT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_124532)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Gemini Bio/Fisher, # 100-602), and 1X Penicillin-Streptomycin (Penicillin-Streptomycin 100x, Genesee Scientific, 25-512)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gemini Bio/Fisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatic analyses: Raw reads were aligned to the human genome (hg38) using STAR (Dobin et al., 2013)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FeatureCounts (Gohr and Irimia, 2019) was used to quantify mapped transcripts from total RNA-seq libraries.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FeatureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DEGs with |L2FC| > 1, p-adjusted value <0.05 were considered significant and used as input in downstream Gene Ontology (GO) analysis (DAVID, v 6.8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAVID</div><div>suggested: (DAVID, RRID:SCR_001881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA) was performed using the fgsea package in R (Sergushichev et al., 2016)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization was carried out using ggplot2 in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed circRNAs were found by DESeq2 (Love, Huber and Anders, 2014)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the motif data base HOmo sapiens COmprehensive MOdel COllection (HOCOMOCO) v11 transcription factor (TF) binding models (binding profiles or binding motifs) for human transcription factors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOCOMOCO</div><div>suggested: (HOCOMOCO, RRID:SCR_005409)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.07.03.450938: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Reagents: Vero E6 cells (CRL-1586, Resource Research Identifier (RRID): CVCL0574) were purchased from American Tissue Type Collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-NP SARS-CoV-2 antibody R001 (40143-R001, RRID Number: AB_2827974), R004 (40143-R004, RRID Number: AB_2827975), R019 (40143-R019, RRID Number: AB_2827973), and R040 (40143-R040, RRID Number: AB_2827976) was purchased from Sino Biological and mouse anti-NP MAb 1C7C7 was provided by Dr. Tomas Moran and purchased from Leinco (LT7000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NP SARS-CoV-2</div><div>detected: (Sino Biological Cat# 40143-R019, RRID:AB_2827973)</div></div><div style="margin-bottom:8px"><div></div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>R040</div><div>suggested: (Sino Biological Cat# 40143-R040, RRID:AB_2827976)</div></div><div style="margin-bottom:8px"><div>anti-NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies R001, R004, R019, R040 were raised against recombinant SARS-CoV nucleocapsid phosphoprotein (NP (Sino Biological, 0143-V08B) and expressed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R019 , R040 were raised against recombinant SARS-CoV nucleocapsid phosphoprotein ( NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>0143-V08B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then antigen-antibody complexes were detected using appropriate anti species HRP-conjugates and West Femto substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti species HRP-conjugates</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies R001, R004, R019, R040 were raised against recombinant SARS-CoV nucleocapsid phosphoprotein (NP (Sino Biological, 0143-V08B) and expressed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of Viral Lysates and Tissue Culture Supernatant (TCS) Production: Vero-E6 cells were plated in 12-well plates at 450 000 cells/well in 1.25 mL of growth media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR fragments were digested with SacI and SmaI and cloned into SacI- and SmaI-digested pCAGGS plasmid containing a C-terminal HA epitope tag (pCAGGS NP-HA) 20 uL of 15,000 Vero E6 cells per well was seeded into half-area 96-well plates and incubated O/N at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR fragments were digested with SacI and SmaI and cloned into SacI- and SmaI-digested pCAGGS plasmid containing a C-terminal HA epitope tag (pCAGGS NP-HA) 20 uL of 15,000 Vero E6 cells per well was seeded into half-area 96-well plates and incubated O/N at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding for SARS-CoV-2 NP (pCAGGS NP-HA) was transfected into the cells using Lipofectamine 2000 according to manufacturer’s recommendations (starting concentration 100 ng of plasmid and two-fold serial dilutions).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS NP-HA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The custom labeling of MAbs was performed by Columbia Biosciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Columbia Biosciences</div><div>suggested: (Columbia Biosciences Corporation, RRID:SCR_004347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide sequences were translated to amino acid sequences using ExPASY online software 31 and the codon frame that contained the full NP was copied to ClustalO (1.2.4)32 for multiple sequence alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExPASY</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphpad Prism V9.1.0 was used to generate all graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

DOI: 10.1073/pnas.1511351113

Resource: (MMRRC Cat# 030779-UCD,RRID:MMRRC_030779-UCD)

Curator: @bandrow

SciCrunch record: RRID:MMRRC_030779-UCD

Curator comments: I reached out to the author about a subsequent manuscript and he will be seeking an erratum to both. The ID of this mouse and the name is incorrect. The corrected information is in the tag. Documented on July 6, 2021.

---

What is this?

Lazy Western journalists refuse to break outside of Western sources to actually learn about what is occurring on the ground. Lends itself to be used by people who may manipulate situations for anti-social gains

INSTRUCTIONS:

1. Read over the poem for the first time to get acquainted with the poem.

Feel free to type page notes that you choose to keep private or share with the group. Note pages are optional.

1. Read it a second time and highlight parts you want to annotate and share your ideas and thoughts with the class.

2. Answer these two questions.

3. Remember to tag each annotation answer with the tag shown after the question.

4. QUESTIONS:

• A - What is the central theme of the poem? tag - #QuestA
• B - What is the overall lesson we should learn from this poem? #QuestB

SciScore for 10.1101/2021.07.02.450896: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Inhibitor treatment: At 24h post transfection, cells were incubated for 6h with two pan-PC inhibitors: the cell permeable decanoyl-RVKR-chloromethylketone (cmk; 50 mM; 4026850.001; Bachem), or with the cell surface PC-inhibitor hexa-D-arginine (D6R; 20 μM; 344931; EMD).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proteins were revealed using a V5-monoclonal antibody (V5-mAb V2660; 1:5000; Invitrogen), ACE2 antibody (rabbit monoclonal ab108252; 1:3,000; Abcam),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-mAb</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>V2660</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMPRSS2 antibody (rabbit polyclonal; 14427-1-AP; 1:1,000; Proteintech)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Actin antibody (rabbit polyclonal A2066; 1:5,000; Sigma), HA-HRP antibody (12-013-819; 1:3,500; Roche), or SARS-CoV-2 spike antibody (rabbit polyclonal GenTex GTX135356; 1:2,000; GenTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (GeneTex Cat# GTX135356, RRID:AB_2887482)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Namely, 0.3 ml of media were immunoprecipitated with either 25 µl EZ view Red anti-HA affinity gel (E 6779; Sigma-Aldrich) or 1.2 µg ACE2 antibody (goat ployclonal AF 933; R&D) and 30 µl TrueBlot anti-Goat Ig IP beads (00-8844-25; Rockland Inc.), respectively, according to the manufacturers’ protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Sigma-Aldrich Cat# E6779, RRID:AB_10109562)</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Goat</div><div>suggested: (Rockland Cat# 00-8844-25, RRID:AB_2610705)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upon SDS-PAGE separation and PVDF transfer, the immunoprecipitated proteins were detected using an HA-HRP antibody (12-013-819; 1:3,500; Roche) or ACE2 antibody (rabbit monoclonal ab108252; 1:3,000; Abcam) and TrueBlot anti-Goat IgG HRP (18-8814-31; Rockland Inc.), respectively. Microscopy: To establish the luciferase assay, cell co-cultures were plated on glass coverslips.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Goat IgG</div><div>suggested: (Rockland Cat# 18-8814-31, RRID:AB_2610843)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with primary antibodies overnight at 4°C using an antibody against V5 (mouse monoclonal R960-25; 1:1000; Invitrogen), Spike (mouse monoclonal GTX632604; 1:500; GeneTex) and ACE2 (goat polyclonal AF933; 1:500; RnDsystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzymatic PC-inhibition by BOS-inhibitors: Biochemical assay: The proprotein convertases Furin (108-574-Tev-Flag-6His), PC5A (PCSK5; 115-63-Tev-Flag-6His), PACE4 (PCSK6; 150-693-Tev-Flag-6His), and PC7 (PCSK7; 142-634-Tev-Flag-6His) enzymes were purified from BacMam transduced CHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cellular assay: Analyses were initiated by the addition of U2OS cells simultaneously transduced with a BacMam-delivered construct containing a Golgi-targeting sequence followed by a 12-amino acid Furin/PCSK cleavage site from Bone Morphogenic Protein 10 (BMP10) and then GFP at the C terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: Monolayers of HeLa, HEK293T, HEK293T17</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Vero E6 and Calu-3 cells were cultured in 5% CO2 at 37°C in Dulbecco’s modified Eagle’s medium (DMEM; Wisent) supplemented with 10% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2[98], a generous gift from Dr. Paul Bieniasz, were maintained in DMEM containing 10% FBS, 1% nonessential amino acids (NEAA) and 50 µg/ml blasticidin (Invivogen)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO-ldlD cells, which are defective in UDP-Gal/UDP-GalNAc 4-epimerase [50] and therefore cannot O-glycosylate proteins, and their parental CHO-K1 cells were cultured in DMEM/F12 medium (50/50) (Wisent) supplemented with 3% FBS and F12K medium (Wisent) containing 10% FBS, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-K1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In certain experiments, 293T17 cells were treated with BOS inhibitors at 6 h post transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell viability assay using MTT: Cells, seeded in a 96-well plate, the day before, at 10,000 (HEK-293T and Vero E6) or 50,000 (Calu-3) cells, were treated with serial 10-fold dilutions of BOS inhibitors for up to 48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-to-cell fusion assay: HeLa or HeLa TZM-bl cells were plated at 200,000 cells in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa TZM-bl</div><div>suggested: NIH-ARP Cat# 8129-442, RRID:CVCL_B478)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The relative light units (RLU) were measured using a Promega GLOMAX plate reader (Promega, Madison, WI, USA) and values were reported as fold increase over the RLU measured in co-culture of HeLa cells transfected EV with respective TZM-bl cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein immunoprecipitation from co-culture media: When indicated, the secreted form of double tagged Spike glycoprotein of Sars-CoV-2 (N-terminal HA tag and C-terminal V5 tag) and the TMPRSS2-shed forms of ACE2 receptor from the FBS containing media of co-cultured HeLA and HeLa-TZM-bl cells were immunoprecipitated for WB analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-TZM-bl</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assay in Vero E6: Vero E6 cells (1.2 x 105 cells/well) were seeded in quadruplicate in 24-well tissue culture plates in DMEM supplemented with 10% FBS two days before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral production in the supernatant was quantified using a plaque assay on Vero E6.1 cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6.1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Single tagged (C-terminal V5 tag) or double tagged (N-terminal HA tag and C-terminal V5 tag) Spike glycoprotein of SARS-CoV-2 (optimized sequence) and its mutants were cloned into the pIRES2-EGFP vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIRES2-EGFP</div><div>suggested: RRID:Addgene_14998)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids pCI-NEO-hACE2 received from DW Lambert (University of Leeds) and pIRES-NEO3-hTMPRSS2 from P Jolicoeur (IRCM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCI-NEO-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luc.R-E-) was obtained from Dr. Nathaniel Landau through the NIH AIDS Reagent Program whereas the pHIV-1NL4-3 ΔEnv-NanoLuc construct was a kind gift from Dr. P</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-1NL4-3 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding VSV-G, as HIV-1 Env and tat were previously described [96, 97].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate HIV particles pseudotyped with SARS-CoV-2 S, 293T17 cells (600,000 cells plated in a 6-well vessel) were transfected with 1 µg pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luc.R-E- (or pHIV-1NLΔEnv-NanoLuc) in the presence or absence of 0.3 µg pIR-2019-nCoV-S V5 plasmids using Lipofectamine-3000 (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-1NLΔEnv-NanoLuc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>V5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were visualized using a confocal laser-scanning microscope (LSM710, Carl Zeiss) with Plan-Apochromat 63x/1.40 Oil DIC M27 objective on ZEN software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaques were counted manually and in parallel, imaged plaque plates were processed and plaques enumerated using an automated algorithm based Matlab software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results from experiments done with two biological replicates and two technical replicates in triplicates were used to calculate the IC50 by nonlinear regression using GraphPad Prism V5.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

Time in the US, Jobs/employment/work, Small business owner, Earnings, Careers, Construction; Time in the US, States, Texas, Indiana, Louisiana, Florida, Ohio

This appears to be evidence that one can (now) use emoji as tags in Hypothes.is?

It's the first time I've seen someone other than me make an attempt in the wild.

SciScore for 10.1101/2021.06.28.21259576: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the University of Pittsburgh Institutional Review Board (Study ID: 21030056/HCC 21-032).<br>Field Sample Permit: Data Collection and Outcomes: Study data were collected by the project coordinators and managed using the Research Electronic Data Capture (REDCap) hosted at the University of Pittsburgh.10 REDCap is a secure, web-based software platform designed to support data capture for research studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody assays: Serum underwent antibody testing using the Beckman Coulter SARS-CoV-2 platform (Spike (S) receptor-binding domain (RBD) IgG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike (S) receptor-binding domain (RBD) IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus (PSV) was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S (Wuhan-1 sequence containing D614G substitution) with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays, 104 293T-hACE2 cells were plated in 100 microliters (μL) media per well in 96 well white-wall white-bottom plates (Perkin Elmer) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus (PSV) was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S (Wuhan-1 sequence containing D614G substitution) with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFC37K-CMV-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3.luc.R-E-mCherry-luciferase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL.luc.R-E-plasmid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3 mCherry luciferase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Collection and Outcomes: Study data were collected by the project coordinators and managed using the Research Electronic Data Capture (REDCap) hosted at the University of Pittsburgh.10 REDCap is a secure, web-based software platform designed to support data capture for research studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

Limitations of this study include lack of longitudinal sampling and assessment of cellular immunity. Nonetheless, our data call for the need for funding to better understand immune responses to COVID-19 vaccines in immunosuppressed patients. Future studies should focus on correlating immune responses with clinical efficacy of COVID-19 vaccines and measurement of other correlates of immunity such as T-cell and memory B-cell responses, particularly in seronegative patients. There is a critical need to develop studies of revaccination, and for countries providing revaccination to publish their data. There is also a critical need to design trials of passive immunity using monoclonal antibodies or direct-acting antivirals for the prevention of COVID-19 in immunocompromised patients. Finally, results such as ours should not be used to fuel vaccine hesitancy, but rather to encourage vaccination and emphasize the need for ongoing vigilance until additional interventions are available.

---

Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04885907</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Third Dose of Moderna COVID-19 Vaccine in Transplant Recipie…</td></tr></table>

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a protocol registration statement.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.06.30.450614: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">E phenotype quantification was performed on 50 cells per condition, with sample identification randomised and blinded during scoring.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">E phenotype quantification was performed on 50 cells per condition, with sample identification randomised and blinded during scoring.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell Culture: STR-profiled, mycoplasma-free vials of 293T and VeroE6 cells were obtained from the Crick Cell Services Science Technology Platform.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and fluorescent labels: An antibody against GAPDH (MAB374) was from Millipore; an antibody against SARS-CoV-2 Spike (GTX632604) was from GeneTex; an antibody against SARS-CoV-2 Nucleocapsid (BS-41408R) was from Bioss; an antibody against SARS-CoV Membrane (101-401-A55) was from (Rockland); an antibody against ERGIC53 (E1031) was from Sigma-Aldrich; an antibody against GM130 (610822) was from BD Biosceinces; an antibody against TGN46 (ab50595) was from Abcam; an antibody against EEA1 (610457) was from BD Biosciences; an antibody against O-GlcNAc (CTD110.6) was from Sigma; an antibody against HA.11 (16B12) was from Biolegend; an antibody against HaloTag (G9211) was from Promega; an antibody against GFP (7.1/13.1) was from Roche; an antibody against RER1 (HPA051400) was from Sigma-Aldrich; an antibody against PALS1 (17710-1-AP) was from Proteintech; an antibody against GORAPS2 (10598-1-AP) was from Proteintech; an HRP-conjugated antibody against Streptavidin (S911) was from Invitrogen; Alexa conjugated secondary antibodies were from Invitrogen and HRP-conjugated secondary antibodies were from Millipore.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (Millipore Cat# MAB374, RRID:AB_2107445)</div></div><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div><div style="margin-bottom:8px"><div>ERGIC53</div><div>suggested: (Sigma-Aldrich Cat# E1031, RRID:AB_532237)</div></div><div style="margin-bottom:8px"><div>GM130</div><div>suggested: (BD Biosciences Cat# 610822, RRID:AB_398141)</div></div><div style="margin-bottom:8px"><div>TGN46</div><div>suggested: (Abcam Cat# ab50595, RRID:AB_2203289)</div></div><div style="margin-bottom:8px"><div>EEA1</div><div>suggested: (BD Biosciences Cat# 610457, RRID:AB_397830)</div></div><div style="margin-bottom:8px"><div>O-GlcNAc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HA.11</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody against HaloTag (G9211</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RER1</div><div>suggested: (Atlas Antibodies Cat# HPA051400, RRID:AB_2681469)</div></div><div style="margin-bottom:8px"><div>HPA051400</div><div>suggested: (Atlas Antibodies Cat# HPA051400, RRID:AB_2681469)</div></div><div style="margin-bottom:8px"><div>PALS1</div><div>suggested: (Proteintech Cat# 17710-1-AP, RRID:AB_2282012)</div></div><div style="margin-bottom:8px"><div>GORAPS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody against Streptavidin (S911</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then prepared for fixed cell imaging, with the presence of HA tagged Dynamin2-K44A detected by detection by an HA antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fixed cell imaging: VeroE6 cells were plated at 40,000 per well on 13mm No. 1.5 coverslips and transfected as described the following day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TurboID Proximity Biotinylation, Pull Down, and Mass Spectrometry: HEK293T cells were grown for at least 5 days in biotin-free growth media to remove all sources of biotin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of post-translational modification on E, 600,000 293T cells in a 35 mm dish were transfected with 2 mg pCR3.1 E-HTSite3, or derivatives.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Insertion of HaloTag in the E coding sequence was performed using HiFi DNA Assembly, with HaloTag amplified by PCR from pHTN-HaloTag CMV-neo (Promega), with a Gly-Gly-Gly-Ser linker placed either side of the HaloTag at site 3 and 4, a single linker placed between E N/C-terminus and HaloTag at tag sites 1 or 5, and a Gly-Gly-Gly-Ser-HaloTag-Gly-Gly-Gly-Ser-Glu-Glu inserted at site 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHTN-HaloTag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hemagglutinin (HA)-TurboID tagging at sites 3 and 4 was performed by HiFi DNA Assembly, with HA-TurboID amplified by PCR from 3xHA-TurboID-NLS_pCDNA3 (Addgene #107171) and inserted with a Gly-Gly-Gly-Ser linker either side of the HA-TurboID sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>3xHA-TurboID-NLS_pCDNA3</div><div>suggested: RRID:Addgene_107171)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Emerald-TurboID was used for a cytosolic control in proximity biotinylation experiments and was generated by using HiFi DNA Assembly to assemble Emerald-TurboID in a pLXIN vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLXIN</div><div>suggested: RRID:Addgene_132935)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mEmerald was amplified from mEmerald-Sec61b-C1 (Addgene #90992) and TurboID amplified from 3xHA-TurboID-NLS_pCDNA3, with AgeI and EcoRI restriction sites for insertion into pEGFP-C1. pHLARE plasmids were a kind gift from Prof. Diana Barber (University of California, San Francisco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mEmerald-Sec61b-C1</div><div>suggested: RRID:Addgene_90992)</div></div><div style="margin-bottom:8px"><div>pEGFP-C1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHLARE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoprecipitation Assay: 25 million 293T cells in a 150 mm dish were transfected with 40 mg pCR3.1 E-HTSite3 or pCR3.1 using Polyethyleneimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3.1</div><div>suggested: RRID:Addgene_106457)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of post-translational modification on E, 600,000 293T cells in a 35 mm dish were transfected with 2 mg pCR3.1 E-HTSite3, or derivatives.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3.1 E-HTSite3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus Like Particle Production Assay: 7.5 million 293T cells in a 100 mm dish were transfected with a mixture comprising 5 mg pCR3.1 SARS-CoV-2 S (codon optimised), 3 mg pCR3.1 SARS-CoV-2 M, 3 mg pCR3.1 SARS-CoV-2 E (or derivatives) and 1 mg of pCR3.1 SARS-CoV-2 N (codon optimised).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3.1 SARS-CoV-2 N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A sequence corresponding to the native sequence of Membrane was synthesised by GeneWIZ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and fluorescent labels: An antibody against GAPDH (MAB374) was from Millipore; an antibody against SARS-CoV-2 Spike (GTX632604) was from GeneTex; an antibody against SARS-CoV-2 Nucleocapsid (BS-41408R) was from Bioss; an antibody against SARS-CoV Membrane (101-401-A55) was from (Rockland); an antibody against ERGIC53 (E1031) was from Sigma-Aldrich; an antibody against GM130 (610822) was from BD Biosceinces; an antibody against TGN46 (ab50595) was from Abcam; an antibody against EEA1 (610457) was from BD Biosciences; an antibody against O-GlcNAc (CTD110.6) was from Sigma; an antibody against HA.11 (16B12) was from Biolegend; an antibody against HaloTag (G9211) was from Promega; an antibody against GFP (7.1/13.1) was from Roche; an antibody against RER1 (HPA051400) was from Sigma-Aldrich; an antibody against PALS1 (17710-1-AP) was from Proteintech; an antibody against GORAPS2 (10598-1-AP) was from Proteintech; an HRP-conjugated antibody against Streptavidin (S911) was from Invitrogen; Alexa conjugated secondary antibodies were from Invitrogen and HRP-conjugated secondary antibodies were from Millipore.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneTex</div><div>suggested: (GeneTex, RRID:SCR_000069)</div></div><div style="margin-bottom:8px"><div>Bioss</div><div>suggested: (Bioss Inc, RRID:SCR_013539)</div></div><div style="margin-bottom:8px"><div>BD Biosceinces</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Sigma</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div><div style="margin-bottom:8px"><div>Biolegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div><div style="margin-bottom:8px"><div>Promega</div><div>suggested: (Promega, RRID:SCR_006724)</div></div><div style="margin-bottom:8px"><div>Proteintech</div><div>suggested: (Proteintech Group, RRID:SCR_008986)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquired images were processed using Zeiss’ “Auto” 2D Airyscan processing, and image brightness levels and image crops were adjusted and performed using the FIJI distribution of ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zeiss’</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw files were then exported into FLIMfit software35 for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLIMfit</div><div>suggested: (FLIMfit, RRID:SCR_016298)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intensity based absolute quantification (iBAQ) in MaxQuant was performed using a built-in quantification algorithm36 enabling the ‘Match between runs’ option (time window 0.7 minutes) within replicates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MaxQuant output files were processed with Perseus, v1.4.0.238.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: 2-tailed Student’s T-tests, or ordinary 1-way ANOVA with the indicated post-hoc tests were used to assess significance between test samples and controls and were performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33 and 30. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

• section : custom tag

Still figuring out Hypothesis, and have never used twitter... I highlighted this text and link to use one of Caulfields methods to verify the link.

A good example here would be the <details> tag, would it make sense to mention it?

hello

SciScore for 10.1101/2021.06.17.448891: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ltd (Guangzhou, China) and inserted into plasmid pET-44b(+) and pET-28a(+), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-44b(+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET-28a(+)</div><div>suggested: RRID:Addgene_108949)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Protein expression and purification: The plasmids pET-44b-NusA-5HB, pET-28a-5HB, and pCold-NusA containing the gene encoding NusA-5HB, 5HB and NusA (with N-terminal His-tag) were transformed into competent E. coli BL21 (DE3) cells (Invitrogen) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a-5HB</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCold-NusA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant E. coli was cultivated in LB medium with antibiotic (50 mg/L Kan for pET-28a-5HB; 100 mg/L Amp for pET-44b-NusA-5HB and pCold-NusA) at 37 °C and rotary shaking at 200 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-44b-NusA-5HB</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained f values were plotted using GraphPad Prism 8 to calculate the IC50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMOL (Version 1.5, Schrö dinger, LLC) was used to prepare figures of the complexes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.06.24.449680: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal experiments were approved by the Institutional Animal Care and Use Committee of XXXXXX.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For Ad5-hACE2-transduced BALB/c mice 51, specific pathogen-free 6-10 weeks old male and female BALB/c mice were lightly anesthetized with isoflurane and transduced intranasally with 2.5×108 fluorescence focus units (FFU) of Ad5-ACE2 in 75 μL DMEM.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then fixed with 4% paraformaldehyde (Sigma-Aldrich) for 30 min at room temperature and stained with anti-His-tag antibodies (Abmart, M30111S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the cells were stained with goat anti-mouse Alexla Fluor 488-conjugated secondary antibodies (Invitrogen, A11001), and were detected with flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In some experiments, LAD2 cells were prior-treated with 0.25% trypsin (without EDTA) for 10 min at 37 °C or prior-blocked with anti-ACE2 antibody (5 μg/mL, R&D Systems, AF933) for 2 h at 37 °C before the incubation with Spike-RBD protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-ACE2 antibody (Abcam, EPR4435), anti-MMP9 antibody (signal antibody, 29091), anti-GAPDH antibody (Abcam, 6C5), and the horseradish peroxidase-conjugated secondary antibody were used in Western blotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MMP9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Abcam Cat# ab92412, RRID:AB_2278693)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detecting tight junction proteins ZO-1, Occludin, Claudin-5 and JAM2 in A549 cells, cells were blocked with 5% BSA in PBS for 1 h at room temperature then incubated with primary antibodies for 2h at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZO-1, Occludin,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Claudin-5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JAM2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against ZO-1 (Invitrogen, 402200), Occludin (Invitrogen, OC-3F10), Claudin-5 (Invitrogen, 4C3C2) and JAM-2 (Abcam, EPR2489), were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZO-1</div><div>suggested: (Thermo Fisher Scientific Cat# 40-2200, RRID:AB_2533456)</div></div><div style="margin-bottom:8px"><div>Occludin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JAM-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus was generated by EZ Trans cell transfection reagent-mediated co-transfection of HEK293T cells with the Spike-expressing plasmid pcDNA3.1-2019-nCoV-S-IRES (strain 2019-nCoV WIV04) and pNL4-3. Luc. ΔR ΔE 81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immuno-staining assay, A549 cells were added leukocyte activation cocktail containing BD GolgiPlug (BD, 550583) and cultured for 6 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-humanzied mice and rhesus macaques experiments: 3-4 months old C57BL/6N-Ace2em2(hACE2-WPRE,pgk-puro)/CCLA mice were provided by Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Science 47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6N-Ace2em2(hACE2-WPRE,pgk-puro)/CCLA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Ad5-hACE2-transduced BALB/c mice 51, specific pathogen-free 6-10 weeks old male and female BALB/c mice were lightly anesthetized with isoflurane and transduced intranasally with 2.5×108 fluorescence focus units (FFU) of Ad5-ACE2 in 75 μL DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus was generated by EZ Trans cell transfection reagent-mediated co-transfection of HEK293T cells with the Spike-expressing plasmid pcDNA3.1-2019-nCoV-S-IRES (strain 2019-nCoV WIV04) and pNL4-3. Luc. ΔR ΔE 81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike-expressing</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-2019-nCoV-S-IRES</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were detected with BD Accuri C6 and analyzed with FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw RNA sequencing (RNA-seq) reads were filtered using Trimmomatic v0.36 82.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered reads were mapped to the human (hg38) reference genomes using HISAT v2.1 with corresponding gene annotations (GRCh38.p13) with default settings 83.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total counts per mapped gene were determined using featureCounts function in SubReads package v1.5.3 with default parameter 84.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, counts matrix obtained from featureCounts was used as input for differential expression gene analysis with the bioconductor package DESeq2 v1.26 in R v4.085.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Filtered counts matrix was normalized using the DESeq2 method to remove the library-specific artifacts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcription-factor enrichment analysis and functional enrichment analysis was performed using Metascape server tool 86 (https://metascape.org/gp/index.html#/main/step1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA) were performed using the R package clusterProfiler v3.18.1 87.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-protein interaction (PPI) networks of DEGs were built using STRING v11 with a confidence score threshold of 0.7 and visualized with Cytoscape v3.8.1 88,89.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

The limitation of our study is that the administration of Eba or Lor significantly reduced SARS-CoV-2-induced inflammation and lung injury, but showed limitation in suppressing viral replication in lungs of ACE2 humanized mice. A combination of MC stabilizers with antiviral drugs such as the RNA polymerase inhibitors Remdesivir and Favipiravir 6,78–80, may provide more optimal treatment strategy that dampening inflammation and clearing viruses at the same time. In summary, we demonstrate that SARS-CoV-2 triggers lung MCs degranulation, which induces the remodeling of various cellular signalings in human alveolar epithelial cells, particularly, MCs degranulation induces the alveolar epithelial inflammation and leads to the consequent disruption of tight junction proteins; importantly, we find that the clinically used MC degranulation stabilizers Eba and Lor are potent agents at reducing virus-induced production of pro-inflammatory factors and preventing lung injury. Our finding uncovers a potentially novel mechanism of SARS-CoV-2 infection initiates alveolar epithelial inflammation and induces lung Injury. Significantly, our results suggest a potential off-label use of MC stabilizers as immunomodulators to treat the severe cases of COVID-19.

---

Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04324021</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Efficacy and Safety of Emapalumab and Anakinra in Reducing H…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04338958</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ruxolitinib in Covid-19 Patients With Defined Hyperinflammat…</td></tr></table>

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• No funding statement was detected.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.06.22.449355: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Mice were injected intramuscularly into the gastroc nemius muscle of each hind leg using a 27-gauge needle (BD, San Diego, CA) with 50 mL per injection site (100 mL total) of immunogen under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">HEK293F is a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">De-identified clinical serum samples were randomly used for spiking in target proteins.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">No sample was excluded from data analysis, and no blinding was used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMPRSS2 expression was confirmed using an anti-V5 antibody (Thermo Fisher Scientific, 2F11F7) or anti-TMPRSS2 mAb (Abnova, Clone 2F4) and APC-conjugated goat anti-mouse IgG (BioLegend, 405308).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# 37-7500, RRID:AB_2533339)</div></div><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (BioLegend Cat# 405308, RRID:AB_315011)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day post-transfection, cells were infected with VSV(G*ΔG-luciferase) and after 2 h were washed five times with DMEM before adding medium supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant, CRL-2700, ATCC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody levels were quantified by conversion of the optical density to a z-score relative to pre-pandemic serum anti-S1 IgG concentrations, as previously described23,33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1 IgG</div><div>suggested: (Imported from the IEDB Cat# 2E10, RRID:AB_2848047)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293F cells are derived from the HEK293F cell line (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 (CRL-1586, American Type Culture Collection), Vero-TMPRSS2 (a gift of S. Ding, Washington University) and Vero-hACE2-TMPRSS2 (a gift of A. Creanga and B. Graham, National Institutes of Health (NIH)) cells were cultured at 37°C in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES (pH 7.3), 1 mM sodium pyruvate, 1× nonessential amino acids and 100 U mL-1of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-hACE2-TMPRSS2 cell cultures were supplemented with 10 μg ml-1of puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly for MLV, HEK293T cells were co-transfected using Lipofectamine 2000 (Life Technologies) with an S-encoding plasmid, an MLV Gag-Pol packaging construct, and the MLV transfer vector encoding a luciferase reporter according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells in DMEM supplemented with 10% FBS, 1% PenStrep seeded in 10-cm dishes were transfected with the plasmid encoding for the corresponding S glycoprotein using lipofectamine 2000 (Life Technologies) following manufacturer’s indications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live and pseudovirus entry and serum neutralization assays: SARS2-02 and SARS2-38 were assayed for neutralization potency by focus-reduction neutralization test (FRNT) as described previously34, and using Vero-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immune complexes were then added to Vero-TMRPSS2 cell monolayers in a 96-well plate and incubated for 1 h at 37°C prior to the addition of 1% (w/v) methylcellulose in MEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMRPSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the mAbs CV30, B38, and CR3022 and for the vaccinated human serum samples, HEK-hACE2 cells were cultured in DMEM with 10% FBS (Hyclone) and 1% PenStrep with 8% CO2 in a 37C incubator (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies: The murine mAbs SARS2-02 and SARS2-38 studied were isolated from BALB/c mice immunized with SARS-CoV-2 spike and RBD proteins and have been described previously25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes encoding CR302226, B3827, and CV3018 heavy and light chains were ordered from GenScript and cloned into pCMV/R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">General procedures for bacterial protein production and purification: The E. coli Lemo21(DE3) strain (NEB) was transformed with a pET29b+ plasmid encoding the synthesized gene of interest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET29b+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid construction for RBD: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-with</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units were plotted and normalized in Prism (GraphPad) using a zero value of cells alone and a 100% value of 1:2 virus alone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Systems of ordinary differential equations describing the kinetics of the interactions between the species involved in each sensor were numerically integrated using integrate.odeint() as implemented in Scipy (version 1.6.3)35.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The python code for running these simulations is provided as a Jupyter notebook: https://github.com/bwicky/covid_nAb_sensor_simulation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analyzed and plotted using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your code.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.06.28.450190: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were approved either by the Geneva Cantonal Ethics Commission (2020-00516) or by the ethics committee of Charité-Universitätsmedizin Berlin (EA2/066/20, EA4/244/20, EA2/092/20, and EA4/245/20).<br>IACUC: Animal experimentation ethics declarations: All ferret and hamster experiments were evaluated by the responsible ethics committee of the State Office of Agriculture, Food Safety, and Fishery in Mecklenburg–Western Pomerania (LALLF M-V) and gained governmental approval under registration number LVL MV TSD/7221.3-1-004/21.<br>Field Sample Permit: Mouse studies were conducted in compliance with the Swiss Animal Welfare legislation and approved by the commission for animal experiments of the canton of Bern under license BE-43/20.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunohistochemistry (IHC) was performed using an anti-SARS nucleocapsid antibody (Novus Biologicals #NB100-56576, dilution 1:200) according to standardized avidin-biotin-peroxidase complex-method producing a red labelling and hematoxylin counterstain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: (Novus Cat# NB100-56576, RRID:AB_838838)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Vero E6 cells (kindly provided by Doreen Muth, Marcel Müller, and Christian Drosten, Charité, Berlin, Germany) or Vero-TMPRSS2 22 (kindly provided by Stefan Pöhlmann, German Primate Center - Leibniz Institute for Primate Research, Göttingen, Germany) were propagated in Dulbecco’s Modified Eagle Medium-GlutaMAX™ supplemented with 1 mM sodium pyruvate, 10% (v/v) heat-inactivated fetal bovine serum (FBS), 100 μg/ml streptomycin, 100 IU/ml penicillin, 1% (w/v) nonessential amino acids, and 15 mM HEPES (Gibco, Gaithersburg, Maryland, United States of America).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Contemporary clinical isolates from the B.1.160 (SD614G) (EPI_ISL_414019), B.1.1.7 (EPI_ISL_2131446, EPI_ISL_751799 (L4549)) and B.1.351 (EPI_ISL_803957 (L4550)) were isolated and minimal passaged upon Vero E6 cells. B.1.351 (EPI_ISL_981782) was initially isolated on A549 cells expressing hACE2 before passaging on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isogenic viruses were grown on Vero-TMPRSS2 cells, after one passage on human bronchial airway epithelial cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were washed 1x with PBS and inoculated with the virus serum/plasma mixture for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 B.1.1.7 (L4549) and B.1.351 (L4550) 18 were received from the Robert-Koch-Institut Berlin,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 B.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression, purification, and biolayer interferometry assay: SARS-CoV-2 spike protein expression plasmids were constructed to encode the ectodomain of spike protein S614G or SB.1.1.7 (residues 1–1208, with a mutated furin cleavage site and K986P/V987P substitutions) followed by a T4 foldon trimerization domain and a polyhistidine purification tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SB.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation and interpretation was performed by board-certified veterinary pathologists (DiplECVP) (AB, IBV).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse studies: Homozygous hACE2 knock-in mice (B6.Cg-Ace2tm1(ACE2)Dwnt; henceforth hACE2-KI) and hemizygous transgenic mice (Tg(K18-hACE2)2Prlmn; henceforth hACE2-K18Tg) were described previously 4, 16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Ace2tm1 ( ACE2)Dwnt; henceforth hACE2-KI )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Tg(K18-hACE2)2Prlmn; henceforth hACE2-K18Tg</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day after inoculation, infected hACE2-K18Tg mice were placed in the cage of another hACE2-K18Tg contact mouse.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-K18Tg</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistical analysis was performed using the GraphPad Prism version 8 or R (version 4.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.06.29.450397: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibody 5-7 for cryo-EM experiments was expressed and purified as Fab: VHCH1 with a C-terminal His-tag (His8) and LC were constructed separately into the gWiz expression vector, and then co-transfected and expressed in Expi293.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag ( His8 )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T/17 cells and Vero E6 cells were cultured in 10% Fetal Bovine Serum (FBS, GIBCO cat# 16140071) supplemented Dulbecco’s Modified Eagle Medium (DMEM, ATCC cat# 30-2002) at 37 °C, 5% CO2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression was carried out in Human Embryonic Kidney (HEK) 293 Freestyle cells (Invitrogen) in suspension culture using serum-free media (Invitrogen) by transient transfection using polyethyleneimine (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NTD-Avi tag-expression plasmid was transiently co-transfected with the pVRC8400 plasmid encoding the biotin-Ligase BirA from E. coli (Lys2-Lys321) into HEK293 cells suspension culture in serum-free media using polyethyleneimine transfectant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 microplate neutralization: The SARS-CoV-2 viruses USA-WA1/2020 (WA1), USA/CA_CDC_5574/2020 (B1.1.7), hCoV-19/South Africa/KRISP-EC-K005321/2020 (B1.351), hCoV-19/Japan/TY7-503/2021 (P.1) and hCoV-19/USA/CA (B.1.429) were obtained from BEI Resources (NIAID, NIH) and propagated for one passage using Vero E6 cells. hCoV-19/USA/NY-NP-DOH1/2021 was isolated and sequence was verified (Annavajhala et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were grown to 80% confluency before transfection with the spike gene using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NTD-Avi tag-expression plasmid was transiently co-transfected with the pVRC8400 plasmid encoding the biotin-Ligase BirA from E. coli (Lys2-Lys321) into HEK293 cells suspension culture in serum-free media using polyethyleneimine transfectant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVRC8400</div><div>suggested: RRID:Addgene_63164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NTD-expression plasmid and BirA plasmid were mixed at a 10:1 ratio for transfection and 3 hrs post-transfection the media was supplemented with 50 μM Biotin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BirA</div><div>suggested: RRID:Addgene_113640)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Motion correction, CTF estimation, particle extraction, 2D classification, ab initio model generation, 3D refinements and local resolution estimation for all datasets were carried out in cryoSPARC 3.2(Punjani et al., 2017); particles were picked using Topaz (Bepler et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated and manual model building were iteratively performed using real space refinement in Phenix (Adams et al., 2004) and Coot (Emsley and Cowtan, 2004) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half maps were provided to Resolve Cryo-EM tool in Phenix to support manual model building.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geometry validation and structure quality assessment were performed using EMRinger (Barad et al., 2015) and Molprobity (Davis et al., 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Molprobity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Map-fitting cross correlation (Fit-in-Map tool) and figures preparation were carried out using PyMOL, UCSF Chimera (Pettersen et al., 2004) and Chimera X (Pettersen et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was processed and fit to 1:1 interaction model using the Scrubber 2.0 (BioLogic Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Scrubber</div><div>suggested: (Scrubber2, RRID:SCR_015745)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">N AND STATISTICAL ANALYSIS: The statistical analyses for the pseudovirus neutralization assessments were performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM data were processed and analyzed using cryoSPARC and RELION.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

§ 3 (1) Krankenhaus-Covid-19-Verordnung

§ 12 (3) 3. PflegeM-Cov-19-V

§ 4 (1) Zweite Krankenhaus-Covid-19-Verordnung i.V.m. § 4 (2) Zweite Krankenhaus-Covid-19-Verordnung

anchor tag to plugins link

Author Response:

Reviewer #1 (Public Review):

The physical principles underlying oligomerization of GPCRs are not well understood. Here, authors focused on oligomerization of A2AR. They found that oligomerization of A2AR is mediated by the intrinsically disordered, extramembraneous C-terminal tail. Using experiment and MD simulation, they mapped the regions that are responsible for oligomerization and dissected the driving forces in oligomerization.

This is a nice piece of work that applies fundamental physical principles to the understanding of an important biological problem. It is a significant finding that oligomerization of A2AR is mediated by multiple weak interactions that are "tunable" by environmental factors. It is also interesting that solute-induced, solvent-mediated "depletion interactions" can be a key driving force in membrane protein-protein interactions.

Although this work is potentially a significant contribution to the fields of GPCRs and molecular biophysics of membrane proteins in general, there are several concerns that would need to be implemented to strengthen the conclusions.

1) How reasonably would the results obtained in the micellar environment be translated into the phenomenon in the cell membranes?

1a) Here authors measured oligomerization of A2AR in detergent micelles, not in the bilayer or cellular context. Although the cell membranes would provide another layer of complexity, the hydrophobic properties and electrostatics of the negatively charged membrane surface may cooperate or compete with the interactions mediated by the C-terminal tail, especially if the oligomerization is mediated by multiple weak interactions.

The translatability of properties of membrane proteins in detergent micelles to the cellular context is a valid concern. However, this shortcoming applies to all biophysical studies of membrane proteins in non-native environments. Even for membrane proteins reconstituted in liposomes, the question arises whether the artificial lipid composition that differs from that in the human plasma membrane would alter protein properties, especially as surface charges and cholesterol content can impact membrane protein dynamics, association, and stability. In that sense, this question cannot be answered satisfyingly, especially for GPCRs that are notoriously difficult to isolate. However, we can offer some perspectives. The propensity for membrane proteins to associate and oligomerize, if anything, is greater in lipid bilayers compared to that in detergent micelles, while detergent micelles can effectively solubilize membrane protein monomers (Popot and Engelman, Biochem 1990, 29 (17), 4031–4037). Hence, the findings that A2AR readily oligomerizes in detergent micelles and that the degree of oligomerization can be systematically tuned by the C-terminal length of A2AR in the same micellar system suggest that inter-A2AR interactions are modulating receptor oligomerization; we speculate that A2AR oligomers will be present or be enhanced in the lipid bilayer environment. In fact, in the cellular context, it has been shown that A2AR assembles into homodimers at the cell surface in transfected HEK293 cells (Canals et al, J Neurochem 2004, 88, 726–734) and into higher- order oligomers at the plasma membrane in Cath.A differentiated neuronal cells (Vidi et al, FEBS Lett 2008, 582, 3985–3990). Furthermore, C-terminally truncated A2AR has been demonstrated to show no protein aggregation or clustering on the cell surface, a process otherwise observed in the WT form (Burgueno et al, J Biol Chem 2003, 278 (39), 37545–37552). These results provide the research community with a valid starting point to discover factors that control oligomerization of A2AR in the cellular context.

1b) Related to the point above (1a), I wonder if MD simulation could provide an insight into the role of the lipid bilayer in the inter- or intra-molecular interactions involving the tail. Although the neutral POPC bilayer was employed in the simulation, the tail-membrane interaction may affect oligomerization since the tail is intrinsically disordered and possess a significant portion of nonpolar residues (Fig. S4).

The reviewer brings up a valid point about the ability for MD simulations to provide insights into the role of membrane-protein interactions. In response to the reviewer, we performed additional analysis focusing on the interactions of the C-terminus with the lipid bilayer. Overall, as the C-terminus is extended, there is a decrease in its interaction with the cytoplasmic leaflet of the membrane (left figure below). More specifically, we find that the C-terminal segment associated with helix 8 (residues 291 to 314) interacts tightly with the membrane, while the rest of the C-terminus (an intrinsically disordered segment) more weakly interacts with the membrane, regardless of truncation (right figure below). As the C-terminus is extended, the inherent conformational flexibility leads to a decrease in the interactions between the protein and the bilayer. We also observe that shorter stretches of the disordered segment do have the ability to interact more closely with the membrane. While these portions include charged residues that can participate in formation of the dimer interface, no general trends are observed. We therefore cannot draw any conclusions regarding the role of C-terminal-membrane interactions on the dimerization of A2AR. What we do know is that the MD simulations presented here should be considered a model study that reveals that the charged and disordered C-terminus of A2AR can account for oligomerization via multiple and weak inter-protomer contacts.

MD simulations showing (Left) average distance of all C-terminal residues and (right) average per-residue distance from the cytoplasmic membrane of the lipid bilayer.

2) Ensuring that the oligomer distributions are thermodynamic products.

Since authors interpret the SEC results on the basis of thermodynamic concepts (driving forces, depletion interactions, etc.), it would be important to verify that the distribution of different oligomeric states is the outcome of the thermodynamic control. There is a possibility that the distribution is the outcome of the "kinetic trapping" during detergent solubilization.

This is an important question. As we have shown in the manuscript, the A2AR dimer level was found to be reduced in the presence of TCEP (Figure 2B), suggesting that disulfide linkages have a role in facilitating A2AR oligomerization. However, disulfide cross-linking reaction cannot be the sole driving force of A2AR oligomerization because (1) a significant population of A2AR dimer remained resistant to TCEP (Figure 2B), (2) A2AR oligomer levels decreased progressively with the shortening of the C-terminus (Figure 3), and (3) A2AR oligomerization is driven by depletion interactions enhanced with increasing ionic strength (Figure 5).

To answer whether A2AR oligomer is a thermodynamic or kinetic product, we tested the stability and reversibility of the A2AR monomer and dimer/oligomer population. We used SEC to separate these populations of both the A2AR-WT and A2AR-Q372ΔC variants, then performed a second round of SEC to observe their repopulation, if any. The results are summarized in the figure below, which we will include in the revised manuscript as Figure 5-figure supplement 1.

We find that the SEC-separated monomers repopulate measurably into dimer/oligomer, with the total oligomer level after redistribution comparable with that of the initial samples for both A2AR WT (initial: 2.87; redistributed: 1.60) and A2AR-Q372ΔC (initial: 1.49; redistributed: 1.40) (Figure 5-figure supplement 1A). This observation indicates that A2AR oligomer is a thermodynamic product with a lower free energy compared with that of the monomer. This is consistent with the results we have shown in the manuscript that the oligomer levels of A2AR-WT are consistent (1.34–2.87; Table S1) and that A2AR oligomerization can be modulated with ionic strengths via depletion interactions (Figure 5).

Figure S5. The dimer/oligomerization of A2AR is a thermodynamic process where the dimer and HMW oligomer once formed are kinetically trapped. (A) SEC chromatograms of the consecutive rounds of SEC performed on A2AR-WT and Q372ΔC. The first rounds of SEC are to separate the dimer/oligomer population and the monomer population, while the second rounds of SEC are performed on these SEC-separated populations to assess their stability and reversibility. The total oligomer level is expressed relative to the monomeric population in arbitrary units. (B) Energy diagram depicting A2AR oligomerization progress. The monomer needs to overcome an activation barrier (EA), driven by depletion interactions, to form the dimer/oligomer. Once formed, the dimer/oligomer populations are kinetically trapped by disulfide linkages.

Interestingly, the SEC-separated dimer/oligomer populations do not repopulate to form monomers (Figure 5-figure supplement 1). This observation is, again, consistent with a published study of ours on A2AR dimers (Schonenbach et al, FEBS Lett 2016, 590, 3295–3306). This observation furthermore indicates that once the oligomers are formed, some are kinetically trapped and thus cannot redistribute into monomers.

We believe that disulfide linkages are likely candidates that kinetically stabilize A2AR oligomers, as demonstrated by their redistribution into monomers only in the presence of a reducing agent (Figure 2B). Taken together, we suggest that A2AR oligomerization is a thermodynamic process (Figure 5-figure supplement 1B), with the monomer overcoming the activation energy (EA) by depletion interactions to repopulate into dimer/oligomer with a slightly lower free energy (given that we see a distribution between the two). Once formed, the redistributed dimer/oligomer populations can be kinetically stabilized by disulfide linkages.

3) The claim that the C-terminal tail is engaged in "cooperative" interactions is too qualitative (p. 11 line 274, p.12 line 279 and p.18 line 426).

This claim seems derived from Fig. 3b and Figs. 4b-c. However, the gradual decrease in the dimer level and the number of interactions may indicate that different parts in the C-terminal tail contribute to dimerization additively rather than cooperatively. The large decrease in the number of interactions may stem from the large decrease in the length (395 to 354). Probably, a more quantitative measure would be the number of interactions (H-bonds/salt bridges) normalized to the tail length upon successive truncation. Even in that case, the polar/charged residues would not be uniformly distributed along the primary sequence, making the quantitative argument of cooperativity challenging.

The request to clarify our basis to refer to a cooperative interaction is well taken. Figure 4B and 4C show that the truncation of one part of the C-terminus (segment 335–394) leads to a reduction in contacts of a different part (segment 291–334) of A2AR. Therefore, we conclude that the binding interactions that occur in segment 291–334 are altered by the interactions exerted by the segment 335–394. This characteristic is consistent with allosteric interactions. We believe that characterizing these interactions as “cooperative” is possible but is not fully justified in this work. We also agree with the comment that quantifying the role and segments involved in contacts would be challenging. The manuscript has been amended to use the term “allosteric” in place of “cooperative”.

4) On the compactness and conformation of the C-terminal tail:

Although the C-terminal tail is known as "intrinsically disordered", the results seem to indicate that its conformation is rather compact (or collapsed) with a number of intra- and intermolecular polar interactions (Fig. 4) and buried nonpolar residues (Fig. 6), which are subject to depletion interactions (Fig. 5). This raises a question if the tail indeed "intrinsically disordered" as is known. Recent folding studies on IDPs (Riback et al. Science 2017, 358, 238-; Best, Curr Opin Struct Biol 2020, 60, 27-) suggest that IDPs are partially expanded or expanded rather than collapsed.

We agree that our results seem to suggest that the conformation of the C-terminus could be partially compact. However, by stating that the C-terminus on average is an intrinsically disordered region (IDR), we do not exclude the possibility of partially structured regions, or greater compactness than that of an excluded volume polymer. IDR or IDP should refer to all proteins or protein regions that do not adopt a unique structure. By that standard, we know that the C-terminus of A2AR falls into that category according to our experiments and MD simulation, as well as the literature. In isolation, the majority the C-terminus is indeed an IDR, as has been demonstrated not only by simulations but also by experimental data. In fact, the C-terminus exhibits partial alpha-helical structure, and transiently populates beta-sheet conformations, depending on its state and buffer conditions (Piirainen et al, Biophys J 2015, 108 (4), 903–917). The literature studies suggest that A2AR’s C-terminus may adopt a greater level of compactness when interactions are formed between the C-terminus and the rest of the A2AR oligomer.

Reviewer #2 (Public Review):

The authors expressed A2A receptor as wild type and modified with truncations/mutations at the C-terminus. The receptor was solubilized in detergent solution, purified via a C-terminal deca-His tag and the fraction of ligand binding-competent receptor separated by an affinity column. Receptor oligomerization was studied by size exclusion chromatography on the purified receptor solubilized in a DDM/CHAPS/CHS detergent solution. It was observed that truncation greatly reduces the tendency of A2A to form dimers and oligomers. Mechanistic insights into interactions that facilitate oligomerization were obtained by molecular simulations and the study of aggregation behavior of peptide sequences representing the C-terminus of A2A. It is concluded that a multitude of interactions including disulfide linkages, hydrogen bonds electrostatic- and depletion interactions contribute to aggregation of the receptor.

The general conclusions appear to be correct and the paper is well written. This is a study of protein association in detergent solution. It is conceivable that observations are relevant for A2A receptors in cell membranes as well. However, extrapolation of mechanisms observed on receptor in detergent micelles to receptor in membranes should proceed with caution. In particular, the spatial arrangement of oligomerized receptor molecules in micelles may differ from arrangement in lipid bilayers. The lipid matrix may have a profound influence on oligomerization.

The ultimate question to answer is how oligomerization alters receptor function. This will have to be addressed in a future study.

We could not agree more. We address the concern regarding the translatability of properties of membrane proteins in detergent micelles to the cellular context in our response to Reviewer 1. In short, we believe the general propensity for A2AR to form dimers/oligomers and the role of the C-terminus will hold in the cellular context. However, even if it does not, given that biophysical structure-function studies of GPCRs are conducted in detergent micelles and other artificial environments, it is critical to understand the role of the C-terminus in the oligomerization of reconstituted A2AR in detergent micelles. How oligomerization alters receptor function is a question that is always on our mind and should be the the focus of future studies. Indeed, it has been demonstrated that truncation of the A2AR C-terminus significantly reduces receptor association with Gαs and cAMP production in cellular assays (Koretz et al, Biophys J 2021, https://doi.org/10.1016/j.bpj.2021.02.032). The results presented in this manuscript, which have demonstrated the impact of C-terminal truncation on A2AR oligomerization, will offer critical understanding for such study of the functional consequences of A2AR oligomerization.

Reviewer #3 (Public Review):

The work of Nguyen et al. demonstrates the relevant role of the C-terminus of A2AR for its homo-oligomerization. A previous work (Schonenbach et al. 2016) found that a point mutation of C394 in the C-terminus (C394S) reduces homo-oligomerization. Following this direction, more mutants were generated, the C-terminus was also truncated at different levels, and, using size-exclusion chromatography (SEC), the oligomerization levels of A2AR variants were assessed. Overall, these experiments support the role of the C-terminus in the oligomerization process. MD studies were performed and the non-covalent interactions were monitored. To 'identify the types of non-covalent interaction(s)', A2AR variants were also analysed modulating the ionic strength from 0.15 to 0.95 M. The C-terminus peptides were investigated to assess their interaction in absence of the TM domain.

The SEC results on the A2AR variants strongly support the main conclusion of the paper, but some passages and methodologies are less convincing. The different results obtained for dimerization and oligomerization are low discussed. The MD simulations are performed on models that are not accurately described - structural information currently available may compromise the quality of the model and the validity of the results (i.e., applying MD simulations to low-resolution models may not be appropriate for the goal of this analysis, moreover the formation of disulfide bonds cannot be simulated but this can affect the conformation and consequently the interactions to be monitored). Although the C-terminus is suggested as 'a driving factor for the oligomerization', the TM domain is indeed involved in the process and if and how it will be affected by modulating the solvent ionic strength should be discussed.

We thank the reviewer for the overall positive assessment and critical input. We will respond to the comments as followed.

The qualitative trend for dimerization is consistent with that for oligomerization, as demonstrated in Figs. 2A, 3B, and 5. For example, a reduction in both dimerization and oligomerization was observed upon C394X mutations (Figure 2A), as well as upon systematic truncations (Figure 3B), while very similar trends were seen for the change in the dimer and oligomer levels of all four constructs upon variation of ionic strength (Figure 5).

We agree that the experimental observation and MD simulation only incompletely describe the state of the A2AR dimer/oligomer. For example, we discover the impact of ERR:AAA mutations of the C-terminus (Figure 3C) on oligomer formation, but do not know whether this segment interacts with the TM domain or C-terminus of the neighboring A2AR. MD simulations suggest that the inter-protomer interface certainly involves inter-C-termini contact. We also mention that the A2AR oligomeric interfaces could be asymmetric, suggesting that the C-terminus can interact with other parts of the receptor, including the TM domain. However, we do not have evidence that the TM domain directly interact with each other to stabilize A2AR oligomers, and thus cannot discuss the effect of the solvent ionic strength on how the TM domain contributes to A2AR oligomerization. We minimize such discussion in our manuscript because we have incomplete insights. What we can say is that multiple and weak inter-protomer interactions that contribute to the dimer and oligomer interface formation prominently involve the C-terminus. Ultimately, the structure of the A2AR dimer/oligomer needs to be solved to answer the reviewer’s question fully.

With respect to the validity of our model, we restricted ourselves to using the best-available X-ray crystal structure for A2AR. Since this structure (PDB 5G53) does not include the entire C-terminus, we resorted to using homology modeling software (i.e., MODELLER) to predict the structures of the C-terminus. In our model, the first segment of the C-terminus consisting of residues 291 to 314 were modeled as a helical segment parallel to the cytoplasmic membrane surface while the rest of the C-terminus was modeled as intrinsically disordered. MODELLER is much more accurate in structural predictions for segments less than 20 residues. This limitation necessitated that we run an equilibrium MD simulation for 2 µs to obtain a well-equilibrated structure that possesses a more viable starting conformation. We have included this detailed description of our model in lines 641–650. To validate our models of all potential variants of A2AR, we calculated the RMSD and RMSF for each truncated variant. Our results clearly show that the transmembrane helical bundle is very stable, as expected, and that the C-terminus is more flexible (see figure below). This flexibility is somewhat consistent for lengths up to 359 residues, with a more noticeable increase in flexibility for the 394-residue variant of A2AR.

Root mean square fluctuation (RMSF) from sample trajectories of truncated variants modeled from the crystal structure of the adenosine A2AR bound to an engineered G protein (PDB ID 5G53), and the root mean square deviation (RMSD) of the C-terminus of each variant starting from residue 291.

Reviewer #2 (Public Review):

The authors expressed A2A receptor as wild type and modified with truncations/mutations at the C-terminus. The receptor was solubilized in detergent solution, purified via a C-terminal deca-His tag and the fraction of ligand binding-competent receptor separated by an affinity column. Receptor oligomerization was studied by size exclusion chromatography on the purified receptor solubilized in a DDM/CHAPS/CHS detergent solution. It was observed that truncation greatly reduces the tendency of A2A to form dimers and oligomers. Mechanistic insights into interactions that facilitate oligomerization were obtained by molecular simulations and the study of aggregation behavior of peptide sequences representing the C-terminus of A2A. It is concluded that a multitude of interactions including disulfide linkages, hydrogen bonds electrostatic- and depletion interactions contribute to aggregation of the receptor.

The general conclusions appear to be correct and the paper is well written. This is a study of protein association in detergent solution. It is conceivable that observations are relevant for A2A receptors in cell membranes as well. However, extrapolation of mechanisms observed on receptor in detergent micelles to receptor in membranes should proceed with caution. In particular, the spatial arrangement of oligomerized receptor molecules in micelles may differ from arrangement in lipid bilayers. The lipid matrix may have a profound influence on oligomerization.

The ultimate question to answer is how oligomerization alters receptor function. This will have to be addressed in a future study.

An interesting tool for taking notes from Jeremy Ho. Designed with Roam Research in mind.

The Eloquent tool is available to install! Capture ideas in-context with:<br>• On-page highlighting<br>• Nested bullets<br>• /snippets<br>• [[braces]] and #tag syntax<br>Quick capture is a hotkey away. Bonus hotkey sends your highlights/links to @RoamResearch pic.twitter.com/vLLbPX4zwW

— Jeremy Ho (@jeremyqho) July 21, 2020

<script async src="https://platform.twitter.com/widgets.js" charset="utf-8"></script>

I wish it could save data as a local text or markdown file so it would also be easier to use with Obsidian or other note taking tools. It's similar in nature to the Roam Highlighter extension.

Details at https://www.notion.so/Eloquent-Resource-Center-72f95c2a71d34c5181e4907edf7a96e1

Tag:vertebrados,aves,mamiferos

Tag:vertebrados,peces,anfibios,reptiles,

Tag:vertebrados