flow cytometry using the red fluorescent nucleic acid dye SYTO17 as a counterstain to improve detection of cells with a low GFP signal
- Dec 2020
-
academic.oup.com academic.oup.com
-
-
news.rice.edu news.rice.edu
-
has developed novel bioinformatics software called OliVar, which allows researchers and assay developers to automate and design assays that target regions of the virus genome that have the lowest frequency of mutation
-
-
-
mRNA-1273 vaccine candidate, manufactured by Moderna, encodes the S-2P antigen, consisting of the SARS-CoV-2 glycoprotein with a transmembrane anchor and an intact S1–S2 cleavage site. S-2P is stabilized in its prefusion conformation by two consecutive proline substitutions at amino acid positions 986 and 987, at the top of the central helix in the S2 subunit
Tags
Annotators
URL
-
-
openwetware.org openwetware.org
-
Lithium Acetate Borate (LAB) buffer is an agarose gel electrophoresis media for DNA gels
Lithium and Borate are both teratogenic (reproductive toxicity).. Is it worth the risk?
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
Cell densities achieved with TB were over 3 times greater than those seen with the most commonly used broth, LB, and DNA yields were 2.5 fold higher
high cell density => blocks spin columns?
Have you observed that?
-
SOC is added to E. coli cells to aid recovery after exposure to high salt concentrations and heat shock in many chemical-based DNA transformation protocols
Elbing and Brent, 2002, Green and Sambrook, 2012
-
In this study, we have quantitated yields of low copy and single copy number plasmid DNAs after growth of cells in four widely used broths (SB, SOC, TB, and 2xYT) and compared results to those obtained with LB, the most common E. coli cell growth medium
TB (terrific broth) consistently generated the greatest amount of plasmid DNA, in agreement with its ability to produce higher cell titers. The superiority of TB was primarily due to its high levels of yeast extract (24 g/L) and was independent of glycerol, a unique component of this broth. Interestingly, simply preparing LB with similarly high levels of yeast extract (LB24 broth) resulted in plasmid yields that were equivalent to those of TB.
-
-
www.zymoresearch.com www.zymoresearch.com
-
tools.thermofisher.com tools.thermofisher.com
-
Performcalibrations
Good explanation of calibration - https://tools.thermofisher.com/content/sfs/manuals/4387777d.pdf
-
ROI/Uniformity plate
A regions of interest (ROI) calibration maps the positions of the wells on the sample block of the Applied Biosystems 7500/7500 Fast Real-Time PCR System. The 7500 software uses the ROI calibration data to associate increases in fluorescence during a run with specific wells of the plate. The instrument uses a set of optic filters to distinguish the fluorescence emissions gathered during runs. You must generate a calibration image for each individual filter to account for minor differences in the optical path.
-
Custom dyes must excite between 455–672 nm and emit between 505–723 nm.
-
-
cedricscherer.netlify.app cedricscherer.netlify.app
-
occupy the fill scale with a slightly darker version of the palette used for color.
Using colorspace package.
geom_boxplot(aes(color = season, fill = after_scale(desaturate(lighten(color, .6), .6))), size = 1)
-
-
www.r-graph-gallery.com www.r-graph-gallery.com
-
All the existing color palettes are available in Paletteer. Just specify the package and palette names to use!
Ggplot, color palettes
-
-
www.biorxiv.org www.biorxiv.org
-
We report the preclinical development of BNT162b2, a lipid-nanoparticle (LNP) formulated N1-methyl-pseudouridine (m1Ψ) nucleoside-modified mRNA (modRNA) vaccine candidate that encodes P2 S with a native furin cleavage site resulting in the S1 and S2 cleavage fragments
-
To generate the template for RNA synthesis, a DNA fragment encoding the SARS-CoV-2 P2 279 S protein (based on GenBank: MN908947), including the amino acid exchanges K986P and 280 V987P, was cloned into a starting plasmid vector with backbone sequence elements for 281 improved RNA stability and translational efficiency19,34
BNT162b2
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
The pBHR1 plasmid is a derivative of the small (2.6-kb), mobilizable broad-host-range plasmid pBBR1, which was isolated from the gram-negative bacterium Bordetella bronchiseptica
pBBR1
Tags
Annotators
URL
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
Antibiotics, according to strain sensitivity, were used at the following concentrations: tetracycline 2 μg/ml for Rm1021, BM7, BM299 and BM300, 4 μg/ml for LMG18864, 10 μg/ml for other Sinorhizobium strains and for E. coli; streptomycin 600 μg/ml and kanamycin 200 μg/ml were used for Rm1021; kanamycin for E. coli S17.1 was used at 40 μg/ml; gentamicin was used at 20 μg/ml for all strains
-
All Sinorhizobium strains were grown in TY medium (Beringer, 1974) at 30 °C
TY contained, per litre, 5 g Difco Bacto- Tryptone, 3 g Difco Bacto-yeast extract and 1-3 g CaC1,.6H20.
-
-
www-microbiologyresearch-org.ezproxy.rice.edu www-microbiologyresearch-org.ezproxy.rice.edu
-
TY contained, per litre, 5 g Difco Bacto- Tryptone, 3 g Difco Bacto-yeast extract and 1-3 g CaC1,.6H20.
TYc media
-
-
www.ryananddebi.com www.ryananddebi.com
-
LEFT(A1,FIND(“,”, A1))
split text to columns with formula
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
The slopes and efficiency for the SARS-CoV-2 standard curves were not consistent over time, confirming the need to include a standard curve each run rather than using a single curve for multiple plates.
Is the standard curve performed with matrix or in pure water?
-
-
indianexpress.com indianexpress.com
-
Look at filmmaker Anubhav Sinha’s last three films. He went for Muslim minority story (Mulk) then he went to do a Dalit-related, anti-caste-related story in Article 15, and now he has gone for domestic violence (Thappad). He has touched religion, caste and gender.
-
-
2015.igem.org 2015.igem.org
-
P.putida Competent Cells
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
P. aeruginosa cells were made competent utilizing a microcentrifuge-based procedure.
-
-
journals.plos.org journals.plos.org
-
Combining acetate with borate retains the deficiencies of both
This is counter to the argument that the combination works well - https://bitesizebio.com/25078/faster-even-cooler-dna-gels
- The article recommends a pH of 6.5, which was the best pH found for sodium borate buffers in this paper
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
The voltage is kept low, ∼10 V/cm, where cm refers to the length of the gel
This is wrong - the cm refers to the inter-electrode distance. It is a misonomer that people confuse it with the length of the gel
-
-
bitesizebio.com bitesizebio.com
-
Between them, the three buffers cover all of the molecular biologist’s DNA gel needs
-
-
gmo-crl.jrc.ec.europa.eu gmo-crl.jrc.ec.europa.eu
-
Since most of the power produced in the electrophoretic process is dissipated as heat the following detrimental effects can result: • an increased rate of diffusion of sample and buffer ions leading to broadening of the separated samples • the formation of convection currents, which leads to mixing of separated samples; • thermal instability of samples that are rather sensitive to heat (e.g. denaturation of DNA) • a decrease of buffer viscosity hence a reduction in the resistance of the medium
-
-
www.bio-rad.com www.bio-rad.com
-
Using a lower concentration running buffer (0.25x TAE) and higher voltage (300 V), agarose gels can be run 33% faster.
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
found that the P R promoter from rhizobial phage 16-3 was active in M. extorquens and engineered the promoter to be inducible by either p-isopropyl benzoate (cumate) or anhydrotetracycline. These hybrid promoters, P R/cmtO and P R/tetO, were found to have high levels of expression in M. extorquens with a regulatory range of 10-fold and 30-fold, respectively
Tags
Annotators
URL
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Currently, the majority of quorum sensing systems used in synthetic biology rely on self-produced small molecules that result in spatially and temporally self-organized systems, which can not be easily externally regulated
Why can't the LasI or LuxI proteins be inducible?
-
-
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov
-
All replication in R6K relies on the two essential components of a minimal replicon, the γ ori, and its cognate Rep, π protein, encoded by the pir gene
-
-
www.sciencedirect.com www.sciencedirect.com
-
appropriately selecting sets of functionally redundant species and adding their abundances can help identify environmental drivers of microbiome composition
The set of functionally redundant species will be specific to the environmental parameter in question and members could possibly be present in multiple functional groups corresponding to different parameters also.
For example: When looking at nitrate level, species A,B,C are the same functional group, for sulphate species B, D, E are same group, for early colonizers A, D, F etc.
-
in most conceivable cases, we study a particular microbiome in order to understand, predict, and potentially control its functioning, with no particular regard for species content.
this is profound
-
-
www.jstage.jst.go.jp www.jstage.jst.go.jp_pdf1
-
Since currentanalytical technologies for genes and metabolites provideonly a “snapshot” information at the time of measurement,temporal shift s in plan t an d microbial physiologies hav e bee na majo r obstacl e to detaile d analyses. Therefore, a stabl e syn‐thetic system may facilitate clearer investigations of plant-microbe interactions, leading to unique insights in this field
snapshot vs dynamic information
-
-
pubs.acs.org pubs.acs.org
-
transformation efficiencies using a chemical transformation protocol
~ 1e5 CFU/ug DNA
-
-
www.fishersci.com www.fishersci.com
-
Fully autoclavable racks (moist heat, 121°C, 20 min., 1 bar); remove blister packaging before autoclaving
First time I'm seeing filter tips that are autoclavable
-
- Nov 2020
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Here we present a detailed, genome-wide transcriptomics and proteomics dataset of E. coli grown under 34 different conditions. Additionally, we provide measurements of doubling times and in-vivo metabolic fluxes through the central carbon metabolism
34 different conditions:
We manipulate concentrations of sodium and magnesium in the growth media, and we consider four different carbon sources glucose, gluconate, lactate, and glycerol. Moreover, samples are taken both in exponential and stationary phase, and we include two extensive time-courses, with multiple samples taken between 3 hours and 2 weeks
-
-
www-geodyn.mit.edu www-geodyn.mit.edu
-
sequences from tRNAs are italic
tRNAs are too short - around 76 bp. Not relevant for ribozyme recognition
-
-
www.theatlantic.com www.theatlantic.com
-
But humans, we have demonstrated, are not inherently self-interested.
Would be good to build a tighter argument for this demonstration before writing such a strong statement
-
some anthropologists now argue that millions of years of evolution have hard-wired us for altruism, not self-interest.
Altruism has also been difficult to explain, even in more primitive organisms such as microbial communities which have much simpler behaviors.
Isn't it a stretch to claim that it is hard-wired through evolution by giving specific examples of altruism in primitive humans and primates?
-
-
openwetware.org openwetware.org
-
Since each strand is replicated independently, it is possible for the ssDNA form to accumulate.
How do you deal with ssDNA during plasmid extraction?
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
Previously, we and others have shown that the inclusion of an antitoxin and the careful balancing of toxin and antitoxin expression levels across relevant conditions can mitigate this effect, resulting in a kill switch that is evolutionarily stable over biologically relevant periods
-
-
-
Cells are aliquoted into chilled tubes, frozen in a dry ice bath and stored at −80 °C until use.
How long do the cells hold their competency?
-
-
www.sigmaaldrich.com www.sigmaaldrich.com
-
Solutions can be autoclaved for 15-20 minutes at a maximum of 121 °C. There will be some hydrolysis to glucose and fructose, depending in part on how rapidly the autoclave comes to the required temperature and pressure. Care must be taken to prevent solutions from caramelizing.
-
-
aem-asm-org.ezproxy.rice.edu aem-asm-org.ezproxy.rice.edu
-
V. natriegens grows rapidly in BHIN complex medium with a μ of up to 4.43 h−1 (doubling time of 9.4 min) as well as in minimal medium supplemented with various industrially relevant substrates.
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Antibiotic concentrations used for plasmid selection in V. natriegens: ampicillin–carbenicillin 100 µg ml−1, kanamycin 75 µg ml−1, chloramphenicol 5 µg ml−1, spectinomycin 100 µg ml−1. E. coli experiments were performed in standard LB and M9 media.
-
-
-
model incorporated the time series correlation structure through an autoregressive model of order 1 for the error process
To understand time series corelation structure (de-trending) - https://www.svds.com/avoiding-common-mistakes-with-time-series/
-
might also translate to other respiratory
any refs on other respiratory viruses that stumble into the GI tract and end up in wastewater?
-
. For example, when applied to the sewershed 177MUD#203 (Fig. 3B) the predictive model could be used to estimate positivity rate during periods 178when clinical testing data was sparse. This approach illustrates the power of using wastewater 179viral load to forecast positivity rates in communitie
Does this only work when there is good clinical testing in general, but poor testing in a few weeks?
-
. We observed a 110strong cross-correlation up to fourteen days
Have you tested cross-correlation shifting in the other direction as well?
-
-
en.wikipedia.org en.wikipedia.org
-
A moving average is commonly used with time series data to smooth out short-term fluctuations and highlight longer-term trends or cycles. The threshold between short-term and long-term depends on the application, and the parameters of the moving average will be set accordingly.
Tags
Annotators
URL
-
-
stats.idre.ucla.edu stats.idre.ucla.edu
-
Linear mixed models are an extension of simple linear models to allow both fixed and random effects, and are particularly used when there is non independence in the data, such as arises from a hierarchical structure
-
-
medium.com medium.com
-
Adjusted R-squared values
What does adjusted R-square mean?
-
Let’s fit regression line to our model:
plot() and lines() seem to plot regression lines
- Can they be added to a ggplot?
- Can they be used to print R2 on the plot?
-
-
www.nature.com www.nature.com
-
partial amplification of the dcp gene, located in close proximity to terC, opposite the oriC region
TerC: qPCR copy number of e coli chromosome
-
-
purrr.tidyverse.org purrr.tidyverse.org
-
list
Map on a data frame operates by each column (from example below)
Working with data frames
-
-
journals.plos.org journals.plos.org
-
Replication begins
Rolling circle replication overview
Replication begins when the Rep protein, which is encoded on the plasmid (ORF A), recognizes a specific site on the plasmid (double-strand origin, or DSO) and catalyzes the nicking of one DNA strand. The Rep protein remains bound to the 5′ phosphate after the nicking action. The newly released 3′ hydroxyl on the opposite end serves as a primer for DNA synthesis. The host DNA polymerase uses the unnicked circular strand as a template, so that a single replication fork moves around a plasmid until it regenerates the DSO. A second copy of Rep protein catalyzes the cleavage of the newly formed DSO, effectively releasing a single stranded copy of the plasmid. In the absence of Rep, the replication fork continues to move around the template, forming a single stranded concatemer. The single strand origin (SSO), a non-coding element that forms extensive secondary structure, is required for synthesis of the lagging strand. SSO sequences vary considerably among different RCR plasmids, but are extremely important for robust replication of the plasmid in the cell [10]. Here we describe the engineering of the pWV01 RCR origin to create pBAV1K-T5, a very broad-host range expression vector.
-
pWV01 is a cryptic plasmid originally purified from Streptococcus cremoris [7]. Its RCR origin has been used to create over 20 cloning vectors
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Copy numbers of the oriV region and gfp gene on the plasmid relative to a chromosomal gene were determined by qPCR. The chromosomal gene dapA was set up as the reference gene
-
Plasmids were isolated from saturated overnight cultures using the PureLink Plasmid DNA Miniprep Kit (Invitrogen)
Seems like there was not much difficulty in doing miniprep for this mob+ version of RSF1010. Does the strain of E. coli matter?
- BW25113 here vs MG1655 where minipreps were difficult?
-
IS186-mediated integration of the plasmid into the chromosome or deletion of these accessory genes from an evolved plasmid that remained capable of self-replication conferred greater fitness benefits than SP formation
Can we say this is because of the combined fitness benefit
- by avoiding maintenance of a plasmid and
- lower expression of proteins?
Especially considering that there is expression of the accessory genes (ex: GFP in fig.2e)-> so the protein level fitness burden still exists, albeit at a lower extent.
How much of this burden is attributed to keeping a plasmid around?, maybe this could be tested with a low copy pSC101 type plasmid or by deleting all the accessory genes and repeating the evolution experiment to specifically look for the integrants this time
- by avoiding maintenance of a plasmid and
-
reduce the copy number of full-length plasmids in a cell, SP evolution can rapidly alleviate much of the burden of newly acquired accessory genes
Would be interesting to look at the fate of an already very low copy plasmid (pSC101 like?) to see if SPs still form and are beneficial in the same timescale as the RSF1010 used in this paper
-
consistent with an insertion of an IS186 element into the pQGS plasmid repF gene were detected by day 6 (Fig. 2e, f). IS186 is one of the most active insertion sequences (ISs) in E. coli. It inserted into pQGS at a site matching its preferred target site of 5′-GGGG(N6/N7)CCCC
insertion sequence (IS) disrupts plasmid repF gene. And could also integrate the plasmid into chromosome!
-
Plasmid DNA isolated from cultures
I heard of difficulties in isolation of RSF1010 plasmids due to their abundant single stranded fraction
-
The deletions leading to SP formation were nearly always flanked by short, near-perfect sequence homologies with lengths of 7–15 base pairs (Supplementary Table 1), suggesting that SPs may form through RecA-independent processes
deletion in plasmid fragments evolution
-
serially transferred through 1:2000 daily dilutions
Serial transfer
-
RSF1010, R1162, and R300B plasmids isolated independently from Escherichia coli, Pseudomonas aeruginosa, and Salmonella enterica serovar Typhimurium, respectively, are the best-characterized members of this group
IncQ plasmid
-
-
microbialcellfactories.biomedcentral.com microbialcellfactories.biomedcentral.com
-
Designed probes were modified at the 5′ end with the fluorophore FAM for the reference gene cysG and HEX for the plasmid marker oriT, and furthermore modified at the 3′ end with the quencher BHQ-1
plasmid copy number qPCR assay.
Why cysG: Siroheme synthase gene?
-
-
www.frontiersin.org www.frontiersin.org
-
Among the fully sequenced BHR plasmids, most are classified as the well-known incompatibility groups, such as IncP-1 (41 plasmids), IncW (5 plasmids), and IncU (4 plasmids), based on the backbone genes
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
first fast sorting step
What is the difference between this and the next step?
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
broad-host-range plasmid RSF1010 is a member of the IncQ group of plasmids, which stably replicate in a wide variety of gram-negative and gram-positive bacteria, including E. coli and several strains of cyanobacteria
-
although RSF1010 is not self-transmissible, it harbors an origin of transfer and mobilization genes and can co-opt type IV secretion machinery of other self-transmissible plasmids such as RK2 and RP4
-
impairing the nicking activity of the RSF1010 MobA protein facilitates cloning manipulations, it significantly reduces conjugation efficiency. We addressed this problem by editing the plasmid and conjugation system to restore conjugation efficiency.
-
-
jb.asm.org jb.asm.org
-
S17-1 λpir, which is kanamycin sensitive and streptomycin/trimethoprim resistant
-
Conditionally replicating plasmids of the R6K family (IncX) are very often used to deliver gene-inactivating elements in enteric bacteria (11, 28, 38). The replication of these plasmids requires the pir-encoded Π protein, which is usually provided in trans in the donor strain
Tags
Annotators
URL
-
-
journals.asm.org journals.asm.org
-
expression is tightly regulated
cumate inducible
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
targeting the genome with a single CRISPR RNA (crRNA) and selecting only for survival after editing, PaeCas3c is a rapid, counter-selection-free approach to programmable large-scale genome engineering and genome minimization
So the size of the deletion is essentially random in this case?
-
Cas3 systems raises the possibility of its development as a tool for large genomic deletions, such as the targeted removal of entire genes, gene clusters, islands, prophages or plasmids
-
-
2018.igem.org 2018.igem.org
-
Orthogonal ribosomes created through association of the altered 16S rRNA with large ribosomal subunit selectively translate the reporter mRNA containing the orthogonal ribosome binding site
The pool of the [orthogonal ribosome] can be controlled by modulating the transcription rate of the o16s rRNA
-
-
pubs.acs.org pubs.acs.org
-
fluorescein isothiocyanate (Sigma-Aldrich, CAS: 3326-32-7) dissolved in PBS
-
calibrants for red fluorescence, such as TexasRed, are currently being investigated.
-
-
ubuntuforums.org ubuntuforums.org
-
Normally Ubuntu swaps files to disk frequently. Since the disk is a microSD card that's a bit slow and has limited write cycles, it's best to reduce swapping to only when needed.
Tags
Annotators
URL
-
-
indianexpress.com indianexpress.com
-
www.medrxiv.org www.medrxiv.org
-
SARS-CoV-2 viral load peaks prior to symptom onset
viral load in both lungs and gastro intestinal tract were looked at
-
-
www.bio-rad.com www.bio-rad.com
-
example of poor target accessibility, manifested by the significant number of mid-level amplitude droplets (that is, rain), which is resolved by performing a restriction digestion on the DNA before ddPCR
-
probe hydrolysis due to poor long-term storage
Another reason is due to probe/quencher reactivity with DTT in the ddPCR supermix
-
To detect foreign DNA in 5 ml of lake water, 15 ml of lake water must be screened.
Why is this multiplied by 3? Related to statistical error of subsampling - rule of three)
-
average of 5 copies/droplet (the upper end of the recommended loading range), we expect to see about 134 empty droplets in a total of 20,000 droplets
-
At the extreme ends of the concentration range (for example, fewer than ten copies of target in a well or more than 120,000 copies of target in a well), fewer droplets in a well will lead to slightly larger error bars.
-
- Oct 2020
-
stackoverflow.com stackoverflow.com
-
You need to get out of the habit of thinking using quotes is ugly. Not using them is ugly! Why? Because you've created a function that can only be used interactively - it's very difficult to program with it. – hadley
Does it seem like Hadley still stands by this statement after tidy evaluation from this article <Do you need tidyeval>
-
-
tidyeval.tidyverse.org tidyeval.tidyverse.org
-
In practice, functional programming is all about hiding for loops, which are abstracted away by the mapper functions that automate the iteration.
-
-
stackoverflow.com stackoverflow.com
-
If you're using ggplot, you can use scales::pseudo_log_trans() as your transformation object. This will replace your -inf with 0.
-
-
academic-oup-com.ezproxy.rice.edu academic-oup-com.ezproxy.rice.edu
-
SpyCatcher magnetic bead preparation
-
-
core-genomics.blogspot.com core-genomics.blogspot.com
-
-
Kits rock! But understanding what is going on at each stage of the protocol provided with the kit really helps with troubleshooting and modification.
-
-
www.sciencedirect.com www.sciencedirect.com
-
All figures were created using R Statistical Computing Software version 3.6.3 (R Core Team, 2020), relying primarily on the dplyr package (Wickham et al., 2015) for data manipulation and the ggplot2 package (Wickham 2016) for plotting. The code used to create each figure can be found at https://github.com/mkc9953/SARS-CoV-2-WW-EPI/tree/master.
-
-
tidyr.tidyverse.org tidyr.tidyverse.org
-
dplyr::coalesce() to replaces NAs with values from other vectors.
Tags
Annotators
URL
-
-
www.josiahzayner.com www.josiahzayner.com
-
While this seems reasonable it is unlikely that tried and true methods for DNA detection that use PCR will ever be significantly deplatformed
My guess is PCR will be deplatformed after the COVID pandemic, because there will be focus on democratized testing so isothermal diagnostics will boom a lot.
Could be LAMP, could be CRISPR...
-
-
www.bio-rad.com www.bio-rad.com
-
Repeated freezing and thawing of the supermix is not recommended. DTT should be aliquoted to multiple tubes and stored at –20°C to minimize freezing and thawing
-
- Sep 2020
-
feedback.photoshop.com feedback.photoshop.com
-
The next viable way is to use Adobe CC Cleaner tool - which is not publically advertised. If anyone reading this is facing the problem I have described above, download the CC Cleaner Tool here: https://helpx.adobe.com/creative-cloud/kb/cc-cleaner-tool-installation-problems.html
-
-
-
The next set was on saliva samples, directly on saliva samples
How significant is the RNA degradation known to be significant in saliva samples if a preservative solution is not used?
-
-
barricklab.org barricklab.org
-
Mu Free Donor (MFDpir) or B2155, which contain integrated rp4-based transfer machinery
-
-
www.nature.com www.nature.com
-
LOD was defined as <x>bi + ksbi, where <x>bi equals the mean of the no-template controls, sbi is s.d. of no-template controls and k = 2.479 (99% confidence interval)
ddPCR
Tags
Annotators
URL
-
-
-
combining:5.5 μL probe; 19.8 μL forward primer; 19.8 μL reverse primer; 64.9 μL dH2O(volumes can be scaled up). This 20× master mix can be frozen and used in subsequent experiments
Good idea to save time!
-
-
journals.plos.org journals.plos.org
-
Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)
Tags
Annotators
URL
-
-
microbiologyinfo.com microbiologyinfo.com
-
Nutrient Agar is a general purpose, nutrient medium used for the cultivation of microbes supporting growth of a wide range of non-fastidious organisms.
-
-
academic-oup-com.ezproxy.rice.edu academic-oup-com.ezproxy.rice.edu
-
Different nutrient media were used for selective cultivation of bacteria: kanamycin esculin azide (KAA, Merck Eurolab, Darmstadt, Germany) for enterococci, and Chromocult® agar (Merck) as a selective agent for Enterobacteriaceae. For the heterotrophic plate count the bacterial dilutions were plated on R2A agar
-
-
himedialabs.com himedialabs.com
-
R-2A Agar is formulated as per Reasoner and Geldreich (5). Stressed or injured organismsduring water treatment are unable to grow on high nutrient media, since the faster growing organisms outgrow the former(2). Therefore the use of a low nutrient medium like R-2A Agar incubated for longer incubation periods allows these stressedorganisms to grow well.
Tags
Annotators
URL
-
-
microbeonline.com microbeonline.com
-
MacConkey agar is selective for Gram-negative organisms and helps to differentiate lactose fermenting gram-negative rods from non-lactose fermenting gram-negative rods. It is primarily used for the detection and isolation of members of family enterobacteriaceae and Pseudomonas spp.
-
-
www-embopress-org.ezproxy.rice.edu www-embopress-org.ezproxy.rice.edu
-
genetic devices have been designed for suppressing leaky basal expression levels through the engineering of super‐repressors (Ruegg et al, 2018), exploitation of antisense RNAs (O'Connor & Timmis, 1987), or physical decoupling of regulatory elements along with conditional proteolysis
-
-
onlinelibrary-wiley-com.ezproxy.rice.edu onlinelibrary-wiley-com.ezproxy.rice.edu
-
The neighbour‐joining tree was prepared with the R package {Ape} (Paradis, Claude, & Strimmer, 2004) and visualized using the R package {ggtree} (Yu, Smith, Zhu, Guan, & Lam, 2017).
-
- Aug 2020
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
except for E. coli (which requires Eiken agar
E. coli K12, which lacks the surface O-antigen, swarms reluctantly in such conditions, preferring Eiken agar, which is more wettable than Bacto agar Link00825-0)
-
-
academic-oup-com.ezproxy.rice.edu academic-oup-com.ezproxy.rice.edu
-
enabling precise control over agronomically-relevant outputs such as flowering time, stress response, or the biosynthesis of added value metabolites.
-
-
www-ncbi-nlm-nih-gov.ezproxy.rice.edu www-ncbi-nlm-nih-gov.ezproxy.rice.edu
-
Despite the potency, curcumin has not yet been approved as a therapeutic antiviral agent.
Why?
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
In order to reduce false-negative results related to strain variation, TaqMan oligonucleotides were designed in a very conserved region of the M gene.
Is the sequence alignment available?
-
-
link.springer.com link.springer.com
-
The relationship between this diversity and the invasion of antibiotic resistance was investigated using a dilution-to-extinction approach coupled with high-capacity quantitative PCR
It seems likely that both diversity and invasion of antibiotic resistance is regulated by initial microbial density/abundance.
Relavant paper for - initial abundance and pervasiveness of antibiotic resistance is offered by this paper:Alexander, PNAS 2020 (Stochastic bacterial population dynamics restrict the establishment of antibiotic resistance from single cells)
It is not clear from the fig5 but seems like the paper only tested for microbial abundance at the measurement timepoint as a confounding variable, and not initial abundance.
-
our previous studydemonstrated that the manure-borne ARGs proliferated moreeasily ing-irradiated soil than natural soil, indicating thatindigenous soil microorganisms could prevent the dissemina-tion of ARGs from manure to soil
Dissemination makes unnecessary and unproven emphasis on horizontal gene transfer right?
Could say: soil microbes are preventing the survival and proliferation of foreign microbes or dissemination of ARGs from manure
-
Eachflask received 1.2 g of pig manure as the sourceof ARGs
Were there any controls without pig manure ?
-
Four concentrations of the soilsuspension were used as inocula to create a diversity gradient
Why is this serial dilution a diversity gradient?
-
showing the relationships of ARG abundance with OTU richness, diversity andevenness.
Is this combining all conditions and all days?
-
Bars represent averages of four replicates
Standard deviations were not reported?
-
Little is known, however, about the barriers that microbial diversity provides against microbial invasion
Not true. There are a lot of studies on colonization resistance in gut bacteria
-
-
dplyr.tidyverse.org dplyr.tidyverse.org
-
If that is too limited, you need to use a nested or split workflow
One issue is group_map removes the name of the group from the list output
When information of grouping variables are important, I prefer using tidyr::nest %>% purrr::map instead of groupmap. The document also recommends to use nest or split when functionalities of group* are too limited (?group_map). https://github.com/tidyverse/dplyr/issues/4531
-
-
www.bio-rad.com www.bio-rad.com
-
Designing Probes for a ddPCR Assay
-
-
stringr.tidyverse.org stringr.tidyverse.org
-
o perform multiple replacements in each element
This should be clarified better. It means swapping multiple different patterns with their corresponding replacements within each element
This can be taken to mean
- multiple replacements of a single pattern
-
-
www.independentsciencenews.org www.independentsciencenews.org
-
ultimate conclusion of the thesis reads “the unknown virus lead to severe pneumonia could be: The SARS-like-CoV from the Chinese rufous horseshoe bat.
Does the fact that the Crux of the thesis was not published in a peer reviewed paper suggest that the evidence was more strong enough for the conclusion or there were other reasons not to publish?
-
-
www.nature.com www.nature.com
-
However, we recommend that other qPCR targets, including the RdRp or envelope (E) genes are used for the routine detection of 2019-nCoV
What's the reason for this recommendation? Is it because the S gene could mutate further complicating detection efforts?
-
-
www.pnas.org www.pnas.org
-
we measured the relative abundance of dead cells in cultures of the resistant strain grown at sub-MICR concentrations of streptomycin
Have you measured the same for sensitive cells as well?
-
- Jul 2020
-
www-ncbi-nlm-nih-gov.ezproxy.rice.edu www-ncbi-nlm-nih-gov.ezproxy.rice.edu
-
LoD = LoB + 1.645(SD low concentration sample)
LoD is the lowest analyte concentration likely to be reliably distinguished from the LoB and at which detection is feasible. LoD is determined by utilising both the measured LoB and test replicates of a sample known to contain a low concentration of analyte.
LoB is the highest apparent analyte concentration expected to be found when replicates of a blank sample containing no analyte are tested.
LoB = meanblank + 1.645(SDblank)
-
-
www.bio-rad.com www.bio-rad.com
-
There is a simple mathematical relationship between the fraction of droplets that are unoccupied (black bar) and the concentration of target molecules.
-
Some droplets are lost in transfer steps and others are eliminated by the stringent metrics applied by QuantaSoft Software as the droplets pass through the Droplet Reader, resulting ultimately in data from 12,000–16,000 droplets being used in subsequent concentration calculations
-
-
journals.sagepub.com journals.sagepub.com
-
Mathematical Analysis of Copy Number Variation in a DNA Sample Using Digital PCR on a Nanofluidic Device.
-
An estimate of par-titioning error can be found based on the analysis of Dube et al.,39 which models the partitioning as a binomial process.
-
Digital assays have two sources of error: subsampling error and partitioning error
-
Partitioning the sample into small containers results in a statistical distribu-tion of targets
-
because it measures indi-vidual molecules rather than an ensemble concentration
-
purifying the target of interest from interfering compounds.
-
Subsampling error sets the lower detection limit at low concentrations and is independent of the instrument, while partitioning error domi-nates at high concentrations and may depend on the sampling and partitioning instrument
-
-
pubs.acs.org pubs.acs.org
-
The average number of droplets read for each ddPCR was 13,825 with a standard deviation of 1,892 droplets
-
NTCs showed a low-level background signal of approximately three positive droplets per NTC assay, which could possibly be attributed to low-level template contamination during the preparation of the reaction mixture
-
simple calibration procedure generated an instrument-specific color compensation matrix that was subsequently stored on the droplet reader and automatically applied to data to eliminate cross talk between FAM and VIC labeled probes.
Tags
Annotators
URL
-
-
www.bio-rad.com www.bio-rad.com
-
Poisson distribution can be used in place of other standard curves to determine template concentration, which means that data can be reliably obtained from the same samples across multiple instruments and laboratories.
-
-
magrittr.tidyverse.org magrittr.tidyverse.org
-
minimizing the need for local variables
This makes it harder to debug
-
- Jun 2020
-
www.researchgate.net www.researchgate.net
-
the lowest copy number sample points impacted faster and sronger, then you just need to stabilize by adding a neutral nucleic acid background in your standard curve. I usually use water containig 10ng/microl yeast tRNA to perform serial dilutions. This will first create a reaction background similar to your RTQPCR reaction, but also stabilize your DNA copies; I can freeze and thaw (min 20C) more than 50 times the same standard curve sample without any loss in Cts, from 10E6 to 10E2 copies. When I tested the same standard curve but diluted in water only, then the 10E2 started to be slightly affected after one freeze and thaw and then crashed further; then higher copy numbers samples were also affected after 2 to 3 freeze and thaw.
-
-
www.gene-quantification.de www.gene-quantification.deSections1
-
t is important that the threshold is set at a fixed level for all samples that are to be compared
-
-
www.researchgate.net www.researchgate.net
-
If you use an inter-plate calibrator for each different GOI and reference gene, then you would have the rationale to use a different threshold for each target and ref. gene on each different plate.
Best way to rule out possible variability between different qPCR experiments is to use a day to day control. Ideally a cell line cDNA that could also be used as a positive control for other target genes. You simply include this sample in each plate and set the treshold line so that you get identical CT values after each run. Korcan Ayata University of Basel
-
-
adv-r.had.co.nz adv-r.had.co.nz
-
In most programming languages, you can only access the values of a function’s arguments. In R, you can also access the code used to compute them. This makes it possible to evaluate code in non-standard ways: to use what is known as non-standard evaluation
Tags
Annotators
URL
-
-
search-proquest-com.ezproxy.rice.edu search-proquest-com.ezproxy.rice.edu
-
www.thermofisher.com www.thermofisher.com
-
a single TaqMan Fast Virus 1-Step Master Mix protocol has been developed to assay both types of nucleic acid, so you can perform RNA and DNA virus queries next to each other on the same plate using the same handling steps
All 1 step RT-qPCR can detect DNA right? What's special about this?
-
-
journals.plos.org journals.plos.org
-
The present study identifies the best assay for norovirus GI and GII to amplify norovirus genomes efficiently.
Why don't you summarize about the best study in the abstract?!
-
-
www.sciencedirect.com www.sciencedirect.com
-
A known copy (104/reaction) of Oncorhynchus keta (O. keta) was added in the DNAse and RNAse free water and the Cq value obtained acted as a reference point. If the Cq value of a wastewater sample increases compared to the reference Cq value, the sample is considered to have PCR inhibitors.
Was this RNA or DNA that was spiked in?
- O. Keta is a salmon fish
- The reference cited here (Haugland et al., 2005) uses a DNA standard of O.keta 16s rRNA gene
-
- May 2020
-
www.medrxiv.org www.medrxiv.org
-
adjusted for the time lag, the virus RNA concentrations were highly correlated with the COVID-19 epidemiological curve (R2=0.99) and local hospital admissions (R2=0.99)
The correlations are made with smoothed data - which is misleading
-
-
www.qiagen.com www.qiagen.com
-
The Rn value, or normalized reporter value, is the fluorescent signal from SYBR Green normalized to (divided by) the signal of the passive reference dye for a given reaction. The delta Rn value is the Rn value of an experimental reaction minus the Rn value of the baseline signal generated by the instrument. This parameter reliably calculates the magnitude of the specific signal generated from a given set of PCR conditions
-
-
www.sciencedirect.com www.sciencedirect.com
-
observed discrepancies among RT-qPCR N1, N2 and N3 assays for several water samples in agreement to a previous report (Medema et al., 2020)
Which is the most sensitive?
-
-
www.hindustantimes.com www.hindustantimes.com
-
But if we do not lift the lockdown with immediate effect, we shall be confronted with mass ruin and a breakdown of all our structures — social, economic and emotional.
Do we have measures in place to prevent the burst of infections expected to happen post lockdowns?
Or does it come down to choosing between the lesser of two evils?
-
-
www-nature-com.ezproxy.rice.edu www-nature-com.ezproxy.rice.edu
-
Rosario et al. recovered between 63 and 77% of spiked PMMoV in treated wastewater using centrifugal ultrafiltration
From seawater
-
-
biosearchassets.blob.core.windows.net biosearchassets.blob.core.windows.net
-
Although unnecessary for simple singleplex amplifications, spectral calibration is critical for multiplexed assays so that overlapping fluorescent signals can be resolved from one another.
-
-
sfamjournals.onlinelibrary.wiley.com sfamjournals.onlinelibrary.wiley.com
-
to concentrate the viruses, the 1‐l aliquot was acidified with 1 mol l−1 acetic acid to pH ~3·0 and then viruses were filtered onto a 47‐mm, 0·45‐μm HA negatively charged nitrocellulose filter
-
-
journals.plos.org journals.plos.org
-
PMMoV concentrations vary over space and time, 106 to 1010 gene copies per liter of domestic wastewater are consistently detected
-
By far, the most abundant RNA virus identified in the feces of healthy individuals was PMMoV [6], which has also been readily identified in untreated wastewater from numerous locations
Tags
Annotators
URL
-
-
pubs-acs-org.ezproxy.rice.edu pubs-acs-org.ezproxy.rice.edu
-
may be due to bacterial extracellular enzyme activity and protozoan or metazoan predation
Protozoa grazing on viruses - as a nutrient source?
Evidence- Grazing by marine nanoflagellates on viruses and virus-sized particles: ingestion and digestion (Marine ecology press, 1993
-
Samples were spiked to achieve final virus concentrations of 5 × 104 PFU mL–1 for MHV, and 6—8 × 105 PFU mL–1 for ϕ6, MS2, and T3—these were low enough to be feasible concentrations present in wastewater (<106 PFU mL–1)
Why is this different for the different viruses and how these concentrations were determined?
-
The spiked samples were stirred and then incubated at 4 °C; this temperature is at the low-end of mean municipal wastewater temperatures in the U.S.
Adsorption is lower at low temperatures - So the value here is the least adsorption possible?
-
Likewise, methods to concentrate and recover nonenveloped enteric viruses from wastewater and other environmental matrices may not be suitable for enveloped viruses.
This makes sense if the goal of the extraction is to get intact viral particles.
Does it make as much of a difference if only viral nucleic acids are detected?
- Other than partition into solid phase that might reduce enveloped virus in both detections
-
a SARS coronavirus outbreak in an apartment complex in Hong Kong was attributed to the transport of viruses in wastewater to the air ducts
transport of aerosolized virus from flushing the toilet
-
and some enveloped viruses were measured in wastewater biosolid residuals
only the genetic material of some enveloped viruses was detected in the paper cited here (10)
-
-
mgorange.ucanr.edu mgorange.ucanr.edu
-
Powdery mildew is a common disease which affects a wide variety of vegetable crops including eggplant, peppers and tomatoes, all in the nightshade family
Tags
Annotators
URL
-
-
jcm.asm.org jcm.asm.org
-
All assays 36testedwere found to be highlyspecific for SARS-CoV-2, with no cross-reactivity with other respiratory 37viruses observed in our analysesregardless of the primer/probe set or kit used.
This is a misleading statement considering the narrow range of other respiratory viruses tested. Corman et al's primers were designed to be broad enough to detect multiple bat CoVs and SARS-CoV1 in the sarbecovirus lineage
This collection includes samples positive for: rhinovirus (3 samples within the set), influenza B (2), influenza A (2), parainfluenza virus 1 (1), parainfluenza virus 3 (2), parainfluenza virus 4 (1), adenovirus (2), metapneumovirus (1), bocavirus (2), respiratory syncytial virus (2), and coronavirus (25). The coronaviruses included in the sample set are non-SARS-CoV-2 samples
-
Of the 217sevendifferent primer/probe sets and one testing kit that we evaluated, all were found to be highly 218specific withno false positive results observed when assays were run on samples positive for a number 219of other respiratory viruses.
E gene, annotated as sarbeco gene in the Corman et al was designed to detect the sarbeco family of viruses which includes SARS-CoV1 (since they did not have SARS-CoV2 samples to test with)
-
we evaluatedassays using sevendifferent primer/probe setsand one assay kit
We found that the most sensitive assays were those that used the E-gene primer/probe set described by Corman et al. [Eurosurveillance 25, 2020] (https://doi.org/10.2807/1560-7917.ES.2020.25.3.2000045) and the N2 set developed by the CDC
-
-
journals.asm.org journals.asm.org
-
ice nucleation activity of A. tumefaciens(pAHL-Ice) remained stable for up to 20 h when cells were incubated in the presence of oxo-C6-HSL
What sets the 20 h limit?
-
-
pubs-acs-org.ezproxy.rice.edu pubs-acs-org.ezproxy.rice.edu
-
Our results demonstrated that the predicted T90 (time for 90% inactivation) of Phi6 under the 12 evaluated conditions varied from 24 min to 117 days depending on temperature, biological activity, and aqueous media composition.
Persistence measured by counting invective viral plaque forming units
-
-
-
The period from the beginning of antibiotic treatment (50 to 60 years ago) to the emergence of bacteria expressing effective resistance mechanisms is too short to explain the development of resistance factors from other proteins by spontaneous mutation
Interesting thought - applicable for complex mechanisms of resistance involving a totally new function or involving multiple proteins
cooperative action of several proteins (e.g., vancomycin resistance) the de novo generation of such a resistance mechanism in the pathogen is very unlikely
Other simpler mutations - efflux pumps gaining affinity to the antibiotic, mutation of the target protein (rpsL ribosomal mutations) are more likely to occur on short timescales
-
-
www.nature.com www.nature.com
-
plasmid fitness benefits in multiple phylotypes
Is there experimental evidence suggesting fitness benefits here?
This statement should rather be lack of fitness burden maybe?
-
To persist, plasmids lacking stringent post-segregational killing systems thus depend on one or both of two mechanisms: fitness cost amelioration and horizontal transfer
Plasmids lacking stringent segregation regulation but having no fitness cost would persist in quite low fraction of the population?
-
-
link.springer.com link.springer.com
-
The harsh environmental conditions found on leaf surface require high metabolic performances of the bacteria in order to survive.
Why is it harsh?
-
-
bitesizebio.com bitesizebio.com
-
Remove secreted beta-lactamase from the starter cultures. This can be done by pelleting and re-suspending the starter culture in fresh, antibiotic-free medium before innoculating the main culture.
-
-
royalsocietypublishing.org royalsocietypublishing.org
-
These and other breakthroughs promoted a feeling of optimism that, with the tools of quantum mechanics, the secrets of life could finally be laid bare.
What is the connection between the microscope, X-ray mutagenesis, ultracentrifugation and quantum mechanics? It should be made more clear
-
-
www.edwardtufte.com www.edwardtufte.com
-
Scientist's Guide to Poster Presentations, by Peter J. Gosling; Preparing Scientific Illustrations: A Guide to Better Posters, Presentations, and Publications, by Mary Helen Briscoe; Displaying Your Findings: A Practical Guide for Presenting Figures, Posters, and Presentations, by Adelheid A. M. Nicol, et.al.
Tags
Annotators
URL
-
-
www-ncbi-nlm-nih-gov.ezproxy.rice.edu www-ncbi-nlm-nih-gov.ezproxy.rice.edu
-
Fourth, a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding, indicating that the SL-CoV S is largely compatible with SARS-CoV S protein both in structure and in function
193 amino acids in a 510 amino acid protein is by no means minimal. It constitutes 40% of the protein
- Also there seems to be a typo here. The paragraph below says 318 - 510 is the receptor binding domain
-
-
project-evidence.github.io project-evidence.github.io
-
a minimal insert region (amino acids 310 to 518)
193 amino acids in a 510 amino acid protein is by no means minimal. It constitutes 40% of the protein
-
It only takes a few changes ("exchange of a relatively small sequence segment") between two coronaviruses to result in a third coronavirus that can infect other animals ("host-switching")
This cannot be said based on the above paper since one of the recombining fragments was the human infecting SARS-CoV itself.
It should instead read as "it only takes a few changes to a coronavirus to result in a novel variant that can infect other animals"
-
The odds of this happening are pretty good!
There is no mention of the odds of such an even happening in the paper so this conclusion is misleading and not based on evidence
-
it is equally possible that the virus originated somewhere else entirely
If this is equally possible then why is the seafood market origin "unlikely" in the rest of this article?
-
While Mr. Fu here seems to believe the virus originated from the market, we know from the Lancet study that it is unlikely
It should not be struck down as unlikely, just because there is another possibility that is equally likely (stated 2 paragraphs above)
-
Because 34% of cases did not have exposure to the market yet were exposed to the virus, it is highly unlikely the market is the origin point of SARS-CoV-2
This claim is poorly made and not backed up by alternative explanations. It is quite plausible that the 66% who were exposed in the market transmitted to others through asymptomatic contacts who could not be epidemiologically traced
-
meaning that the first patient at the market was not responsible for spreading the virus to other cases
hasty generalization
-
-
pubs.rsc.org pubs.rsc.org
-
Research on enveloped virus presence and fate in water is hindered by the lack of proven detection methods. Detecting and quantifying viruses in environmental samples requires first concentrating the viruses in the sample into a smaller volume to improve detection limits
-
-
link-springer-com.ezproxy.rice.edu link-springer-com.ezproxy.rice.edu
-
virus-loaded filters were rinsed with an acidic solution to eliminate remaining cations before elution with NaOH or other alkaline buffers
Elution with alkaline buffer only works when using negatively charged membranes. ion exchange chromatography?
-
-
www-sciencedirect-com.ezproxy.rice.edu www-sciencedirect-com.ezproxy.rice.edu
-
The 1MDS-method and the HA-method did not provide as high recovery yields of the virions as the Mg-method.
The reason for this could be the beef extract used to elute the virions from both these membranes. The other two successful methods (Mg and Al) used H2SO4 for elution.
-
-
mbio-asm-org.ezproxy.rice.edu mbio-asm-org.ezproxy.rice.edu
-
low-pathogenic viruses often acquire multiple basic amino acids at the HA cleavage site, which is recognized by ubiquitous cellular proteases such as furin and PC6
Why the emphasis on basic amino acids, are they more prone to protease activity?
-
- Apr 2020
-
www.mdpi.com www.mdpi.com
-
. When E. coli metabolizes Collilert-18’s nutrient-indicator, MUG, the sample also fluoresces. It is reported that the method is able to detect a single viable coliform or E. coli per sample
Tags
Annotators
URL
-
-
pdf.sciencedirectassets.com pdf.sciencedirectassets.com
-
The daily flow rate of wastewater was calculated as a point estimate using the product of the at-home population in the catchmentofapproximately 600,000 persons(capita), andthe observed average per capita wastewater rate of 250 L/person/day
Isn't the daily flow rate of wastewater directly measurable in the treatment plant?
-
-
www-ncbi-nlm-nih-gov.ezproxy.rice.edu www-ncbi-nlm-nih-gov.ezproxy.rice.edu
-
a defined quantity of a nonhuman control virus (seal herpes virus [SHV], kindly provided by H. G. M. Niesters, University of Rotterdam, The Netherlands) was spiked into each sample prior to DNA and RNA extraction. Since constant DNA quantities of the control virus are coextracted even when RNA isolation kits are used (H. G. M. Niesters, personal communication; our own unpublished observations), the virus can also serve as a control in RNA virus detection assays.
-
-
blogs.rsc.org blogs.rsc.org
-
on the topic of working with sewage to detect viruses, there are new guidelines from the US CDC that require BSL-3 PPE.
-
-
jamanetwork-com.ezproxy.rice.edu jamanetwork-com.ezproxy.rice.edu
-
We investigated the biodistribution of SARS-CoV-2 among different tissues of inpatients with coronavirus disease 2019 (COVID-19)
It would have been good to include 2-3 negative control samples in the data
-
-
www-sciencemag-org.ezproxy.rice.edu www-sciencemag-org.ezproxy.rice.edu
-
scientists have found limited instances of infectious virus in fecal matter
Did people test in spit or nasal secretions which would also be inside wastewater?
-