Hypothesis

4,381 Matching Annotations

May 2021
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.09.442808

1
1. sciscore 13 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.09.442808: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AMBRA (antigen-specific memory B cell repertoire analysis) of IgG antibodies: Replicate cultures of total unfractionated PBMC from SARS-CoV-2 infected or vaccinated individuals were seeded in 96 U-bottom plates (Corning) in RPMI1640 supplemented with 10% Hyclone, sodium pyruvate, MEM non-essential amino acid, stable glutamine and PenicillinStreptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific memory B cell repertoire analysis) of IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody discovery and expression: Antigen specific IgG+ memory B cells were isolated and cloned from total PBMCs of convalescent individuals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen specific IgG+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry of antibody on S Protein expressing ExpiCHO-S cells: For Expi-CHO cell transient transfection, S plasmids (21, 58) were diluted in cold OptiPRO SFM, mixed with ExpiFectamine CHO Reagent (Life Technologies, A29130) and added to the cells seeded at 6×106 cells/ml in a volume of 5 ml in a 50 ml bioreactor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A29130</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twelve-point 3-fold serial dilutions of S2P6 were prepared in DMEM and OC43 S VSV pseudoviruses were added 1:1 (v/v) to each dilution in the presence of anti-VSV-G antibody from I1-mouse hybridoma supernatant diluted 50 times (final volume: 50 μl).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Cell lines used in this study were obtained from ATCC (HEK293T and Vero-E6) or ThermoFisher Scientific (ExpiCHO cells, FreeStyle™ 293-F cells and Expi293F™ cells).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293-F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a BSL3 facility, serial dilutions of mAbs (1:4) were incubated with 200 PFU (plaque forming units, corresponding to a multiplicity of infection of 0.01) of authentic SARS-CoV-2 (isolate USA-WA1/2020, passage 3, passaged in Vero-E6 cells) for 30 minutes at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform pseudotype neutralization assays, VeroE6-TMPRSS2 cells were used for VSV-SARS-CoV-2, VSV-SARS-CoV-1, and VSV-GD19 and Huh7 cells were used for VSV-MERS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S D614G, used for production of SARS-CoV-2 postfusion, contains a mu-phosphatase signal peptide beginning at 14Q, a mutated S1/S2 cleavage site (SGAR), and ends at residue K1211 followed by a TEV cleavage, foldon trimerization motif, and an 8X his tag in a pCMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV pseudotype virus production and neutralization: Sarbecovirus spike cassettes with a C-terminal deletion of 19 amino acids (D19) were synthesized and cloned into mammalian expression constructs (pcDNA3.1(+) or pTwist-CMV) for the following Sarbecoviruses: SARS-CoV-2 (Accession QOU99296.1), SARS-CoV-1 (Accession AAP13441.1), hCoV-19/pangolin/Guangdong/1/2019 (GD19, Accession QLR06867.1), and Middle East respiratory syndrome-related coronavirus (MERS, Accession YP_009047204).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTwist-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UCA sequences of the VH and VL were constructed using IMGT/V-QUEST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation analysis: Conservation analysis was performed as described previously (Pinto et al 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multiple sequences alignment was performed using MAFFT (https://mafft.cbrc.jp/alignment/software/) with the spike amino acid sequences as input.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were imaged with an automated microscope (Cytation5, Biotek), and nuclei and cells positive for the SARS-CoV-2 Nucleoprotein were quantified using the supplied Gen5 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent neutralization data were analyzed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several subsequent rounds of model building and refinement were performed using Coot (71), ISOLDE (72), Refmac5 (73), and MOE, to arrive at a final model for the complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two rounds of reference-free 2D classification were performed using cryoSPARC (76) to select well-defined particle images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.09.442808
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.10.443404

1
1. sciscore 13 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.10.443404: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells adapted to grow in suspension in Freestyle F-17 medium were transfected with the resulting genetic constructs, using linear polyethyleneimine as the transfection agent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles containing the gene of interest were produced and used for stable transduction of CHO-K1 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-K1</div><div>suggested: CLS Cat# 603480/p693_CHO-K1, RRID:CVCL_0214)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optimized nucleotide sequence was assembled and amplified by PCR using gene fragments synthesized by Eurofins and oligonucleotides synthesized at CIGB (Cuba), and cloned into pCMX/His vector through BssHII and NotI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMX/His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(RBD(319-541)-CHO)2 from transduced CHO-K1 cells: The whole expression cassette including the gene coding for RBD319-541 (from CMV promoter to His6 tag and stop codon) was amplified by PCR from pCMX/His (see the previous section) and re-cloned into the lentiviral vector pL6WBlast (CIGB, Cuba) with the restriction enzymes XhoI and EcoRV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pL6WBlast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amplicon, after digestion with these enzymes, was cloned in-frame into Nhe I/Sal I-digested pET28a+ (Novagen, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After digestion with these enzymes, the fragment was cloned in-frame with the S. cerevisiae alpha factor pre-pro peptide into EcoR I/Xba I-digested pPICK-αA (a pPICZ-αA derivative bearing a G418 resistant selection marker).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPICK-αA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pPICZ-αA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Argon was used as a collision gas and the mass spectra were processed by using MassLynx v4.1 (Micromass, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassLynx</div><div>suggested: (MassLynx , RRID:SCR_014271)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.10.443404
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.08.443267

1
1. sciscore 13 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.08.443267: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (Assurance number A3381-01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female BALB/c (catalog 000651) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from The Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed then sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 62 anti-S antibodies and HRP-conjugated goat anti-mouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-57</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>62</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isotype analysis was perfomed by incubating the immune complexes with secondary goat anti-mouse-PE antibody (IgG1 1070-09, IgG2a 1080-09S, IgG2b 1090-09S, IgG3 1100-09, IgM 1020-09, IgA 1040-09 Southern Biotech) for each isotype.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent neutrophil or cellular phagocytosis: Antibody-dependent neutrophil phagocytosis (ADNP) and cellular phagocytosis (ADCP) assays were conducted as described previously 66, 67, 68.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent neutrophil phagocytosis ( ADNP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: Vero E6 (CRL-1586, American Type Culture Collection (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-TMPRSS2 cells also were supplemented with 5 μg/mL of blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was passaged once in Vero CCL-81 cells and titrated by focus-forming assay (FFA) on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The rescued replication-incompetent ChAd-SARS-CoV-2-S and ChAd-Control vectors were scaled up in HEK293 cells and purified by CsCl density-gradient ultracentrifugation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixtures were added to Vero cell monolayers in 96-well plates and incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female BALB/c (catalog 000651) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_JAX:000651)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 mice were challenged on indicated days after immunization with 104 FFU of SARS-CoV-2 (WA1/2020, Wash-B.1.351, or Wash-B.1.1.28) via IN route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, prefusion-stabilized S 64 and RBD were cloned into a pCAGGS mammalian expression vector with a hexahistidine tag and transiently transfected into Expi293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated at room temperature for 1 h, washed thrice in PBST, and then 100 µL of 1-Step Ultra TMB-ELISA was added (ThermoFisher Cat. #34028).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was assigned when P values were < 0.05 using Prism Version 8 (GraphPad) or Jupyter Notebook 6.1.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Limitations of study: Although a single intranasal administration of ChAd-SARS-CoV-2-S durably protected against SARS-CoV-2 variant replication in the upper and lower respiratory tract even ∼9 months after immunization, we note several limitations in our study. (1) We performed challenge studies in BALB/c mice transduced with hACE2 or C57BL/6 mice expressing an hACE2 transgene. Durability and protection studies will need to be corroborated in hamsters, non-human primates, and ultimately in humans. (2) Although our studies suggest that the mucosal immunity induced by intranasal vaccination could limit SARS-CoV-2 transmission, the use of mice precluded formal respiratory transmission analysis, which is better studied in hamsters and ferrets 46. (3) We observed robust protection in vivo against viruses displaying B.1.351 and B.1.1.28 spike proteins likely due to the high serum neutralizing antibody titers. Even though neutralizing antibody levels were lower with the variant strains due to mutations at sites in the receptor binding motif, the high starting level against the historical SARS-CoV-2 likely provided a sufficient cushion to overcome this loss in potency. Studies in other animals or with even lower doses of vaccine where neutralizing titers might be lower are needed to determine if the protective phenotype against variants of concern is maintained. (4) Finally, we did not establish the correlate of protection in these studies, as passive antibody transfer or T cell depl...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04751682</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Intranasal SARS-CoV-2 Vaccin…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.08.443267
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.04.441029

1
1. sciscore 13 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.04.441029: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed with the approval of the Academia Sinica Institutional Animal Care and Utilization Committee (IACUC Protocol No. 12-08-391) and in strict accordance with its guidelines and those of the Council of Agriculture Guidebook for the Care and Use of Laboratory Animals.<br>Euthanasia Agents: Surviving mice after viral challenge were euthanized using carbon dioxide.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All recordings and analyses were conducted blind to the experiential conditions (i.e., HA tag or Spike protein expression).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and respective dilutions are as follows: hACE2 (Abcam ab108209, 1:2500); HA (Cell Signaling #3725, 1:1000); and HSP90 (provided by Dr. Chung Wang, 1:5000) [16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSP90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following commercial antibodies were used as primary antibodies for immunostaining: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); and rabbit anti-HA (Cell Signaling, 3742).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neuronal cultures were then fixed for immunofluorescence staining as described previously [18, 19] using the following primary antibodies: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); rabbit anti-HA (Cell Signaling, 3742); mouse anti-MAP2 (Sigma,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAP2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">M4403); mouse anti-GFAP (Millipore, MAB3402); and rabbit anti-GFP (Invitrogen, A6455).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Molecular Probes Cat# A-6455, RRID:AB_221570)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection: CAG-hACE2 transgenic or wild-type (WT) mice were anesthetized and intranasally challenged with SARS-CoV-2 TCDC#4 (hCoV-19/Taiwan/4/2020 obtained from Taiwan Centers of Disease Control; lot: IBMS20200819) in a volume of 100 μL of sterile PBS at the indicated plaque-forming units (PFU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 infection: CAG-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-ΔR8.91</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLAS2w.EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Puro and pcDNA3.1-nCoV-SΔ18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-nCoV-SΔ18</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting products were scanned on a QX200 Droplet Reader (Bio-Rad Laboratories), and the data was analyzed using QuantaSoft™ software (Bio-Rad Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div><div style="margin-bottom:8px"><div>QuantaSoft™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Photoshop (Adobe) with minimal adjustment of brightness or contrast applied to the entire images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were carried out in Excel or GraphPad Prism 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 20, 21 and 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.04.441029
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.10.443438

1
1. sciscore 13 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.10.443438: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization of mice and serum samples: Female CB6F1 mice (Charles River Laboratories, Montreal, QC, Canada) (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-SARS-CoV-2 Spike (RBD) antibody was commercially sourced (SinoBiological, Cat# 40592-T62).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-specific antibodies from mouse antisera were detected by a horseradish peroxidase-conjugated goat anti-mouse secondary antibody (1:10,000; Cedarlane Laboratories, Burlington, ON, Canada) and peroxidase substrate (KPL, Gaithersburg, Md, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed (3X) with PBS +0.05% Tween20 and bound FLAG-ACE-2 was detected with HRP-conjugated anti-FLAG antibody (1:20,000, Sigma cat# A8592) and peroxidase substrate (KPL, Gaithersburg, Md, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells and Vero E6 cells (ATCC CRL-1586) were propagated in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific) containing 10% heat-inactivated fetal bovine serum (Omega Scientific, Tarzana, CA), and Pen/Strep (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells overexpressing ACE-2 (293T ACE-2) were generously provided by Dr. Paul Bieniasz (The Rockefeller University) 31 and cultured in 293T cells media supplemented with 5ug/ml blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays, 293T ACE-2 cells were plated on poly-lysine-coated 96-well plates one day prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization of mice and serum samples: Female CB6F1 mice (Charles River Laboratories, Montreal, QC, Canada) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CB6F1</div><div>suggested: RRID:MGI:5649749)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">protease cleavable C-terminal human monomeric IgG1 Fc tag (mFc) was inserted into the SpeI/ XhoI site of the pTRIP lentiviral vector bearing an IRES-AcGFP reporter 32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTRIP</div><div>suggested: RRID:Addgene_127663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE-2 Expression and Purification: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthetic DNA fragment (Integrated DNA technologies Inc., Coralville, Iowa) containing corresponding mutations were used to replace the BamHI and AgeI fragment of pSARS-CoV-2Δ19 and confirmed by DNA sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSARS-CoV-2Δ19</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.10.443438
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.09.443331

1
1. sciscore 13 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.09.443331: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The research protocol was approved by the Institutional Animal Care and Use Committee of WRAIR.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each study group was composed of 10 hACE2 K18 Tg mice (5 males and 5 females).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were randomly assigned to experimental groups and were not pre-screened or selected based on size or other gross physical characteristics.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the antibodies, plasmids encoding heavy and light chains of antibodies (CR3022, and SR1-SR5) were co-transfected into Expi293F cells (ThermoFisher) according to the manufacturer’s instructions for expression of antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-COV-2 antibodies were immobilized onto AHC biosensors (FortéBio) for 100 seconds, followed by a brief baseline in assay buffer for 15 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody positive (anti-RBD mouse mAb; BEI resources) and negative controls were included on each plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies were HRP-conjugated AffiniPure Goat Anti-Mouse antibodies from Jackson ImmunoResearch specific for either Fcγ subclass 1, Fcγ subclass 2a, or Fcγ subclass 2c.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Fcγ subclass 1 , Fcγ subclass 2a , or Fcγ subclass 2c .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectivity and neutralization titers were determined using ACE2-expressing HEK293 target cells (Integral Molecular) in a semi-automated assay format using robotic liquid handling (Biomek NXp Beckman Coulter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was passaged once in Vero CCL81 cells (ATCC) and titrated by focus-forming assay on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum-virus mixtures were then added to Vero E6 cells in 96-well plates and incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c and C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the passive immunization study, on day −1, K18-hACE2 mice were injected intravenously with purified IgG from C57BL/6 vaccinated mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The His-tagged SARS-CoV-2 RBD molecule was generated by amplifying the RBD domain from the RBD-Ferritin plasmid while encoding the 3’ purification tag and subcloned into the CMVR vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-Ferritin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human Immunodeficiency Virus 1 (HIV-1) NL4-3 ΔEnv Vpr Luciferase Reporter Vector (pNL4-3.Luc.R-E-), ARP-3418, contributed by Dr. Nathaniel Landau and Aaron Diamond).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-domain ferritin nanoparticle fusions were modelled using Pymol and Coot (Emsley et al., 2010) and expanded using “phenix.apply_ncs” (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visual analysis and figure generation was conducted using ChimeraX and PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were imaged using a FEI T20 operating at 200 kV with an Eagle 4K CCD using SerialEM or using a Thermo Scientific Talos L120C operating at 120 kV with Thermo Scientific Ceta using EPU.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RELION 3.1.1, and/or cisTEM-1.0.0-beta.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CTF estimation was done with CTFFIND 4.1.13 and used for 2D classification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CTFFIND</div><div>suggested: (CTFFIND, RRID:SCR_016732)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified research grade nanoparticle immunogens were formulated in PBS with 5% glycerol at 1 mg/ml and subsequently diluted with dPBS (Quality Biological) to provide 10 μg or lower amount per 50 μl dose upon mixing with adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-Ferritin nanoparticle immunogens were formulated with ALFQ to contain 20 μg 3D-PHAD and 10 μg QS21 per 50 μl dose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ALFQ</div><div>suggested: (aLFQ, RRID:SCR_005925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay equivalency for SARS-CoV-2 was established by participation in the SARS-CoV-2 Neutralizing Assay Concordance Survey (SNACS) run by the Virology Quality Assurance Program and External Quality Assurance Program Oversite Laboratory (EQAPOL) at the Duke Human Vaccine Institute, sponsored through programs supported by the National Institute of Allergy and Infectious Diseases, Division of AIDS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Assurance Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Quality Assurance Program Oversite Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves were generated using Prism software (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03186781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Influenza HA Ferritin Vaccine, Alone or in Prime-Boost Regim…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03814720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579250</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04645147</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Epstein-Barr Virus (EBV) gp3…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04296279</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial For The Study of Falciparum Malaria Protein 014 Admi…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04784767</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SARS-COV-2-Spike-Ferritin-Nanoparticle (SpFN) Vaccine With A…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.09.443331
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.06.442911

1
1. sciscore 13 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.06.442911: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: (24) Animal Studies: All animal work was performed in accordance with protocols approved by the Lawrence Livermore National Laboratory Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-huFc, ACE2-rbFc, and VHH-huFc antibodies were produced by transient expression in CHO-S cells using the ExpiCHO expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VHH-huFc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A high diversity library was designed by incorporating the natural prevalence of amino acids at positions in CDR1 and CDR2 based off 670 functional VHH antibodies deposited on sdAb-DB (www.sdab-db.ca).(15) Amino acids cysteine and methionine were omitted from all CDR loops and full diversity was used for CDR3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CDR2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CDR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody, goat anti-human H+L IgG HRP (Thermo) was added for an additional hour before washing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human H+L IgG HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-2-NG, VSV-SARS-2-GFP, or VSV-SARS-1-GFP was added to the serially diluted VHH-huFc antibodies for a final multiplicity of infection (MOI) of 0.2 (RG 2) or 0.1 (RG 3) and allowed to incubate at 37°C for 30 minutes to 1 hour with shaking prior to transfer of virus-VHH-huFc mixture to cells seeded in 96 (RG 3) or 384 well plates (RG 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-SARS-2-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Expi293 cells were subsequently infected with VSV-DG-GFP, itself pseudotyped with VSV-G, at 72 h post-transfection using a multiplicity of infection (MOI) of 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH-huFc-virus complexes were incubated with Vero cells at 37°C with 5% CO2 for 12-16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 30-minute incubation of VHH-huFc-virus complexes with Vero E6 cells at 37°C with 5% CO2, overlays of 2 mL per well of 0.6% microcrystalline cellulose (MCC, Sigma 435244), in 8% FBS, 1% P/S complemented 2X MEM were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA Manipulation and Production of Proteins: pSF-CMV-SARS-2-S was constructed as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV-SARS-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pSF-SARS-2-RBD was produced by commercial production of double stranded DNA encoding a N-terminal Kozak, a signal peptide (MDWTWRFLFVVAAATGVQS), 319-577 of the SARS-2 S gene (GenBank:MN908947.3), a TEV site, and a C-terminal, decahistadine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-SARS-2-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All DNA fragments and pSF-CMV vector restriction digested with EcoRI and BamHI were assembled using NEBuilder HiFi DNA master.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pAce2-huFc was produced by subcloning the ectodomain on human ACE2 (Sino Biological) into pCR-Fc using the NotI and BamHI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce Ace2-rbFc (rabbit Fc domain), a gBlock (IDT) of this same region of Ace2 was subcloned into pFUSE rIgG-Fc2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUSE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The minimum region containing all 3 CDR domains, approximately 300 bps, was excised from the pADL20c backbone by two-step restriction digests, BglI followed by DdeI/BstEII double digests on the gel-purified small fragment from the BglI restriction reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pADL20c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diversity of the nanobody library was determined by both NGS and colony PCR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCL files were converted to FASTQ and demutiplexed using the bcl2fastq script from MyIllumina (https://my.illumina.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality filtering and adaptor trimming were performed using fastp (https://github.com/OpenGene/fastp) with following parameters, -q 30 -l 100 -x 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://github.com/OpenGene/fastp</div><div>suggested: (fastp, RRID:SCR_016962)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R2read was reformatted to be reverse complemented and merged with R1 read using BBTools (BBMap, https://sourceforge.net/projects/bbmap/).(17) Three CDR domains with correct sequence lengths were extracted, concatenated and translated and counted unique amino acid sequences using a custom python script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBMap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dose response curves and 50% effective inhibitory concentrations (EC50) were generated using Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered reads were mapped to Spike protein coding region of the SARS-2 Wuhan Hu-1 isolate (GenBank:MN908947.3) using Bowtie 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kaplan-Meier survival curves were generated based on two independent experiments and log rank tests were performed with Bonferroni multiple comparison correction applied (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  While vaccines have been great successes, therapeutic biologics are emerging as a critical tool in preventing progression to severe disease in those who do become infected.(31) Several therapeutic antibody candidates with efficacy against SARS-2 have been recently identified, including three with emergency use authorization, but there are a number of caveats associated with conventional antibodies as therapeutics such as time-consuming discovery, relying on immunized or patient sera, expensive and labor-intensive production, and the large doses required to achieve clinical efficacy. (9, 22, 32-34) High stability, solubility, and the ability to be multimerized, are just some of the many reasons why single-domain heavy chain-based antibody therapeutics (VHH-Fc) represent a highly promising method for treatment.(12) One VHH-based therapeutic is already approved by the FDA for treatment of a rare blood clotting disorder and many more are in late stage clinical trials.(12, 35) The small size of VHH antibodies and the wider distribution of CDR3 loop lengths compared to human IgGs expands the type of epitope which can be effectively targeted.(12) Finally, preliminary evidence suggests that VHH-Fc antibodies are transported more efficiently into the blood and lung parenchyma following intraperitoneal administration compared to conventional IgG1 antibodies.(36, 37) Several groups have recently used in vitro screening techniques to identify VHH domains with high affinity for the SARS-2...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.06.442911
www.poetryfoundation.org www.poetryfoundation.org

Shirt by Robert Pinsky | Poetry Foundation

2
1. lilyking1103 12 May 2021
  
  in Public
  
  Printed in black on neckband and tail. The shape,
  
  The brand name on the tag, ignoring the people who made these by hand
2. DylanKelly15 12 May 2021
  
  in Public
  
  Printed in black on neckband and tail. The shape,
  
  Is he talking about the name on the tag of the shirt?
Visit annotations in context

Annotators

DylanKelly15

lilyking1103

URL

poetryfoundation.org/poems/47696/shirt
www.metacritic.com www.metacritic.com

Mini Motor Racing X

1
1. TylerRick 12 May 2021
  
  in Public
  
  However, the novelty wears off quickly and the whole thing soon becomes a slog — the career mode could be cut in half and the experience would be better for it.
  
  less is more/better
  
  annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

Annotators

TylerRick

URL

metacritic.com/game/switch/mini-motor-racing-x
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.04.21256571

1
1. sciscore 11 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.04.21256571: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: SNBTS blood donors gave fully informed consent to virological testing, donation was made under the SNBTS Blood Establishment Authorisation and the study was approved by the SNBTS Research and Sample Governance Committee IRAS project number 18005.<br>IRB: Ethical approval was given by the South Central - Oxford C Research Ethics Committee in England (Ref: 13/SC/0149) and by the Scotland A Research Ethics Committee (Ref: 20/SS/0028).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Researchers working with the samples in the laboratory were blinded to the clinical outcomes of the ICU patients during testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay: SARS-CoV-2 spike, RBD as well as HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike IgG antibody responses were measured using ELISAs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-OC43 spike IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody rabbit anti-human whole IgG conjugated to alkaline phosphatase (Sigma, USA) was added at a dilution of 1:1000 in casein–PBS solution and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Secondary antibody rabbit anti-human whole IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human whole IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein sequences used in ELISAs: MSD V-PLEX assay: IgG antibody responses to SARS-CoV-2 spike, RBD, NTD and nucleocapsid and the spike proteins of SARS-CoV-1, HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 were assessed using the Meso Scale Diagnostics (MSD) Multi-Spot Assay System (MSD, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HCoV-HKU1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A 1x working concentration of the SULFO-TAG anti-human IgG Detection Antibody was prepared in Diluent 100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (RevMAb Biosciences Cat# 31-1019-MK, RRID:AB_2783627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MSD ACE2 competition assay: The ability of antibodies present in serum/plasma to inhibit the binding of angiotensin-converting enzyme 2 (ACE2) to the SARS-CoV full-length spike proteins and RBD domains was assessed using the COVID-19 ACE2 competition assay (MSD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay: SARS-CoV-2 spike, RBD as well as HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike IgG antibody responses were measured using ELISAs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike antigens were bought from Sino Biological, China.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-229E</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN51287266</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.04.21256571
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.05.04.21256472

1
1. sciscore 11 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.04.21256472: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This includes the immunoreceptor used in the assay which is SARS-CoV-2 Spike Glycoprotein (S1) terminally tagged with a predominantly monomeric Sheep Fc-Tag (produced in HEK293 cells) and subsequently conjugated with electrochemically active Horseradish Peroxidase (HRP); Antibodies for spiking experiments, namely the Human recombinant monoclonal IgM Anti-SARS-CoV-2 Spike (S1) Antibody and Human recombinant monoclonal IgG1 Anti-SARS-CoV-2 Spike (S1) Antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This includes the immunoreceptor used in the assay which is SARS-CoV-2 Spike Glycoprotein (S1) terminally tagged with a predominantly monomeric Sheep Fc-Tag (produced in HEK293 cells) and subsequently conjugated with electrochemically active Horseradish Peroxidase (HRP); Antibodies for spiking experiments, namely the Human recombinant monoclonal IgM Anti-SARS-CoV-2 Spike (S1) Antibody and Human recombinant monoclonal IgG1 Anti-SARS-CoV-2 Spike (S1) Antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The standard bare carbon screen printed electrodes were contract manufactured by GSI Technologies, USA as per the designs provided by PathShodh Healthcare Pvt. Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PathShodh Healthcare</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.05.04.21256472
www.biorxiv.org www.biorxiv.org

High-fidelity, efficient, and reversible labeling of endogenous proteins using CRISPR-based designer exon insertion

2
1. Public_Reviews 10 May 2021
  
  in eLife
  
  Author Response:
  
  Reviewer #1:
  
  In this manuscript the authors show that a designer exon containing a Fluorescent Protein insert can be used to edit vertebrate genes using an NHEJ based repair mechanism. The approach utilizes CRISPR to generate DSBs in intronic sequences of a target gene along with excision of a donor fragment from a co-transfected plasmid to initiate insertion of the exon cassette by ligation into the chromosome DSB.
  
  I like the idea here of inserting FP sequences (and other tags) into introns in this way. Focusing on the N- and C-termini for insertions has always seemed arbitrary to me. In practice these internal sites may even tolerate tag insertions better than the termini. However, this remains to be seen.
  
  My major reservation with this study is that the concepts here are not particularly novel. The approach is very similar to a concept already well established in gene-therapy circles of using introns as targets for inserting a super-exon preceded by a splice acceptor to correct inborn genetic lesions. The methodology employed is essentially HITI (https://www.nature.com/articles/nature20565).
  
  What is new is the finding that FP insertions are frequently expressed and at least partly functional as evidenced by their ability to localize to the expected intracellular structures. However, no actual functional data is provided in this study so it remains to be seen how frequently the insertion of FP exons is tolerated. It would help the study substantilly to have functional information for a few insertions.
  
  The value and utility of this study hinges on whether insertions of this type frequently retain function. The authors speculate that "labeling at an internal site of a gene is feasible as long as the insertion does not disrupt the function of the encoded protein. Many introns reside at the junctions of functional domains because introns have evolved in part to facilitate functional domain exchanges (Kaessmann et al., 2002; Patthy, 1999)." Thus an analysis of how often intron tags are tolerated as homozygotes would be helpful for users who will worry that a potentially "quick and dirty" CRISPIE insertion might not accurately report on the function and localization of their protein of interest.
  
  We thank the reviewer for appreciating our idea. CRISPIE is indeed improved HITI, with the notable difference that the insertion takes place at the intronic region and that a designer intron/exon module is used. This design has a significant benefit in that INDELs in both labeled and unlabeled alleles will be unlikely to cause mutations at the levels of mRNA and proteins. CRISPIE is also different from the super-exon, which is now cited (Bednarski et al, 2016). CRISPIE does not involve the 3’ UTR and the poly A signal. This makes the donor template more standardized and smaller. Transcriptional controls embedded in endogenous introns after the editing sites can be retained in CRISPIE, but not when super-exons are used. We also achieve much higher efficiency in vivo than previous editing methods, which we feel is an important advance.
  
  We now provide three different experiments to address the function of CRISPIEd β-actin and, in one experiment, the function of CRISPIEd α-tubulin 1B. One of the key functions of the cytoskeleton is to support growth. We now show that neither CRISPIE labeling of β-actin (hACTB), at two different intronic loci, and nor CRISPIE labeling of α-tubulin 1B (TUBA1B) affect the growth of U2OS cells (New Experiment #1; Figure 1H, and Figure 1-figure supplement 4), suggesting that labeled β-actin and α-tubulin are functional. In addition, as suggested, we now demonstrate that cells homozygous for CRISPIE insertions are viable and able to divide (New Experiment #2; Figure 4-figure supplement 1). We also show that two important neuronal functional parameters – the mEPSC frequency and amplitude – are not altered by CRISPIE labeling of hACTB in neurons in cultured hippocampal slices. (New Experiment #3; Figure 5– figure supplement 2).
  
  Having shown the above results, we also hope to emphasize that, although CRISPIE provides a way to perform FP tagging of endogenous protein with high efficiency and low error rates, it cannot ensure that FP-tagging itself is benign for all proteins. Numerous studies have overexpressed FP-tagged proteins, which is well documented to have side effects. The CRISPIE method empowers researchers by allowing them to tag endogenous proteins without overexpression. However, if the FP-tagging itself affects protein function, CRISPIE will not be helpful. Each FP-tagging project, whether it is based on CRISPIE or other methods, will requires its own systematic characterization. We have now made this clear in the discussion (pg. 17): “… although CRISPIE enables the tagging of endogenous proteins with low error rates, it does not ensure that the tagged protein functions the same as the wild-type protein. Not all tagging is benign, and rigorous characterizations will be needed for each tagging experiment.”
  
  Other comments:
  
  1) Were homozygotes identified and were they viable in each instance?
  
  We now provide data showing that cells homozygous for CRISPIE insertions are viable and able to divide (New Experiment #2; Figure 4-figure supplement 1).
  
  2) You say: "The CRISPIE method should be broadly applicable for use with different FPs or with other functional domains, different protein targets, and different animal species." I don't know if you optimized your FP to avoid potential reverse strand splice acceptors, but some discussion of this important point should be made so that those trying to apply the approach will make sure that strong acceptors are not included accidentally in reverse oriented inserts.
  
  Our RT-PCR does not detect reversed inserts at the mRNA level. We now add in the Discussion that donor design needs to eliminate unintended splicing sites in the reverse orientation. We write (pg. 17): “It should also be noted that, when designing the donor template, care should be given to not create unintended splicing acceptor sites in the inverted orientation. Otherwise, inverted insertion events can cause mutations at the mRNA and protein levels.”
  
  3) Would your mRNA sequencing methodologies detect defective transcripts where the splice acceptor and a portion of the upstream FP exon was inserted causing a frame shifted and mispliced mRNA? Such mRNAs would be unstable due to NMD and thus not detected readily in a PCR based approach. Thus disruption of the mRNA by partial insertion of your donor (or fragments of the other co-injected DNA) might be much more widespread than is measured here. This could be tested by recovering clones that partially inserted the donor in the forward orientation and carefully monitoring for defects in mRNA splicing of the inserted allele. Were such clones detected and how frequently?
  
  Our method should detect defective mRNAs, if they are not degraded. However, if defective mRNAs are quickly degraded, they are not measured in our current RT-PCR and NGS experiments, as described in Figure 2. While we cannot address this question directly, we now provide evidence that the cell growth and neuronal function after CRISPIE labeling of β-actin remain normal.
  
  We also thank the reviewer for suggesting the cloning approach. This proposed experiment, however, may potentially be affected if potential defective mRNAs can result in decreased cell survival/growth. Although this experiment will require time beyond the three-month revision period expected by eLife due to the length of time required to clone cells, we will keep this in mind in our future efforts.
  
  4) You note that in the case of vinculin the coding sequence of the last exon of hVCL was included in the insertion donor sequence, and a stop codon was introduced at the end of the mEGFP coding sequence. This is essentially the strategy for super-exon insertion into targets for gene therapy, instead of a splice donor on the C-terminus you include a stop codon. You should site these previous studies. Inclusion of a stop codon in frame would be expected to cause NMD, did you also include transcription termination signals?
  
  NMD will happen if the stop codon is further than about approximately 50 nucleotides upstream of any exon-junction complexes (Lewis et al, PNAS 2009). However, NMD won’t occur if it is within 50 nucleotides. For example, synaptophysin – a highly expressed neuronal protein – has its stop codon at its second to last exon within 50 nucleotides of the exon junction. The stop codon we used for labeling hVCL is also within 50 nucleotides (~20 nt) of the exon junction.
  
  We now cite Bernarski et al, 2016, which describes the use of super-exons in gene therapy. At the same time, we think that our approach is still different from the super-exon concept. After the stop codon, the 3’ UTR is not included. Instead, a splicing donor is included, allowing the exon to be spliced to the subsequent endogenous exon. This allows the insert to remain small for high insertion efficiency and makes it easy to produce the template (some 3’ UTRs can be several kilobase pairs in length), while utilizing the endogenous translational controls built into the native 3’ UTR.
  
  Reviewer #2:
  
  In-frame insertion of fluorescent protein tags into endogenous genes allows observation of protein localization at native expression levels, and is therefore an essential approach for quantitative cell biology. Once limited to unicellular model organisms such as yeast, endogenous gene tagging has become well-established in invertebrate model systems such as C. elegans and Drosophila since the advent of CRISPR technology in the last decade. However, a robust and widely accepted endogenous gene tagging strategy for mammalian cells has remained elusive. This is largely due to the fact that homologous recombination, the method used to create knock-ins in invertebrates, is inefficient (or sometimes doesn't work at all) in mammalian cells, especially those that do not divide rapidly.
  
  Several studies have attempted to bypass the need for homologous recombination by using a different method, non-homologous end joining (NHEJ) to insert GFP tags into vertebrate genomes (e.g. Auer et al. Genome Res 2014; Suzuki et al. Nature 2016; Artegiani et al. Nature Cell Biol. 2020). Such approaches can be orders of magnitude more efficient than homologous recombination, but the generated alleles require careful validation because of the error-prone nature of NHEJ.
  
  Here, Zhong and colleagues improve upon the existing NHEJ-based gene tagging approaches by designing synthetic exons (comprising a FP coding sequence with 5' and 3' splice sites) that can be inserted into native introns using NHEJ. The beauty of this approach is that any mutations (indels) created by the error-prone NHEJ repair mechanism are spliced out, and therefore do not affect the sequence of the encoded protein. A limitation is that tags must be inserted internally within a protein of interest and cannot be targeted to the extreme N- or C-terminus, but this limitation is clearly stated and discussed by the authors. Overall, this is a novel (to my knowledge) and powerful strategy that is likely to advance the field.
  
  We thank the reviewer for the very positive comments regarding our CRISPIE method.
  
  scietyType:AuthorResponse
2. Public_Reviews 10 May 2021
  
  in eLife
  
  Reviewer #1 (Public Review):
  
  In this manuscript the authors show that a designer exon containing a Fluorescent Protein insert can be used to edit vertebrate genes using an NHEJ based repair mechanism. The approach utilizes CRISPR to generate DSBs in intronic sequences of a target gene along with excision of a donor fragment from a co-transfected plasmid to initiate insertion of the exon cassette by ligation into the chromosome DSB.
  
  I like the idea here of inserting FP sequences (and other tags) into introns in this way. Focusing on the N- and C-termini for insertions has always seemed arbitrary to me. In practice these internal sites may even tolerate tag insertions better than the termini. However, this remains to be seen.
  
  My major reservation with this study is that the concepts here are not particularly novel. The approach is very similar to a concept already well established in gene-therapy circles of using introns as targets for inserting a super-exon preceded by a splice acceptor to correct inborn genetic lesions. The methodology employed is essentially HITI (https://www.nature.com/articles/nature20565).
  
  What is new is the finding that FP insertions are frequently expressed and at least partly functional as evidenced by their ability to localize to the expected intracellular structures. However, no actual functional data is provided in this study so it remains to be seen how frequently the insertion of FP exons is tolerated. It would help the study substantilly to have functional information for a few insertions.
  
  The value and utility of this study hinges on whether insertions of this type frequently retain function. The authors speculate that "labeling at an internal site of a gene is feasible as long as the insertion does not disrupt the function of the encoded protein. Many introns reside at the junctions of functional domains because introns have evolved in part to facilitate functional domain exchanges (Kaessmann et al., 2002; Patthy, 1999)." Thus an analysis of how often intron tags are tolerated as homozygotes would be helpful for users who will worry that a potentially "quick and dirty" CRISPIE insertion might not accurately report on the function and localization of their protein of interest.
  
  Other comments:
  
  1) Were homozygotes identified and were they viable in each instance?
  
  2) You say: "The CRISPIE method should be broadly applicable for use with different FPs or with other functional domains, different protein targets, and different animal species." I don't know if you optimized your FP to avoid potential reverse strand splice acceptors, but some discussion of this important point should be made so that those trying to apply the approach will make sure that strong acceptors are not included accidentally in reverse oriented inserts.
  
  3) Would your mRNA sequencing methodologies detect defective transcripts where the splice acceptor and a portion of the upstream FP exon was inserted causing a frame shifted and mispliced mRNA? Such mRNAs would be unstable due to NMD and thus not detected readily in a PCR based approach. Thus disruption of the mRNA by partial insertion of your donor (or fragments of the other co-injected DNA) might be much more widespread than is measured here. This could be tested by recovering clones that partially inserted the donor in the forward orientation and carefully monitoring for defects in mRNA splicing of the inserted allele. Were such clones detected and how frequently?
  
  4) You note that in the case of vinculin the coding sequence of the last exon of hVCL was included in the insertion donor sequence, and a stop codon was introduced at the end of the mEGFP coding sequence. This is essentially the strategy for super-exon insertion into targets for gene therapy, instead of a splice donor on the C-terminus you include a stop codon. You should site these previous studies. Inclusion of a stop codon in frame would be expected to cause NMD, did you also include transcription termination signals?
  
  scietyCreator:Reviewer 1 scietyType:PeerReview
Visit annotations in context

Tags

scietyType:AuthorResponse

scietyCreator:Reviewer 1

scietyType:PeerReview

Annotators

Public_Reviews

URL

biorxiv.org/content/10.1101/2020.12.03.409417v1
www.sciencedirect.com www.sciencedirect.com

Generation of Functional Organs Using a Cell-Competitive Niche in Intra- and Inter-species Rodent Chimeras

1
1. scibot 09 May 2021
  
  in Public
  
  RRID:IMSR_CRL:022
  
  DOI: 10.1016/j.stem.2020.11.019
  
  Resource: (IMSR Cat# CRL_022,RRID:IMSR_CRL:022)
  
  Curator: @scibot
  
  SciCrunch record: RRID:IMSR_CRL:022
  
  What is this?
  
  RRID:IMSR_CRL:022
Visit annotations in context

Tags

RRID:IMSR_CRL:022

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S193459092030583X
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.05.02.442326

1
1. sciscore 08 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.05.02.442326: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were approved by the Institutional Review Board of Vanderbilt University Medical Center.<br>IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We studied one patient (a 59-year-old male) who received Pfizer-BioNTech vaccine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Mycoplasma testing of cell lines was performed on monthly basis using a PCR-based mycoplasma detection kit (ATCC, 30-1012K), with negative results at each testing.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was detected with anti-IgG Alexa-Fluor-647-labelled secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG Alexa-Fluor-647-labelled secondary antibodies.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 binding was detected using HRP-conjugated anti-FLAG antibodies and developed with TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary J2 anti-dsRNA (Scicons #10010500) antibody solution at a 1:1,000 dilution was placed on the cells overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (SCICONS Cat# 10010200, RRID:AB_2651015)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed with 0.1% Tween-20/PBS (PBST) three times and plates were incubated with secondary goat anti-mouse Alexa-Fluor-546-labeled antibody at 1:1,000 dilution (Thermo Fisher Scientific) for 2 h at room temperature in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19-FITC</div><div>suggested: (Millipore Cat# FCMAB218F, RRID:AB_10919255)</div></div><div style="margin-bottom:8px"><div>anti-CD27-APC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700132, RRID:AB_10896618)</div></div><div style="margin-bottom:8px"><div>anti-CD38-PE</div><div>suggested: (Sigma-Aldrich Cat# P6722, RRID:AB_261136)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot assay: Direct enzyme-linked immunosorbent spot (ELISpot) assay was performed to enumerate plasmablasts present in the PBMC samples secreting IgG, IgM, or IgA antibodies reacting with either SARS-CoV-2-S6Pecto protein or influenza A/Darwin/42/2020 H1N1 hemagglutinin protein (as a negative control).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H1N1 hemagglutinin protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)</div></div><div style="margin-bottom:8px"><div>anti-human IgM-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech, catalog no. 2040-05), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech, catalog no. 2050-05), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech, catalog no. 2020-05) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA-HRP</div><div>suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Vero E6 (ATCC, CRL-1586) cells were maintained at 37°C in 5% CO2 in Dulbecco’s minimal essential medium (DMEM) containing 10% heat inactivated fetal bovine serum (FBS), 10 mM HEPES pH 73, 1 mM sodium pyruvate, 1× non-essential amino acids, and 100 U/mL of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (ATCC, HTB-55) cells were maintained at 37°C in 5% CO2 in DMEM with high glucose and L-glutamine (Gibco 11965092), containing 10% heat inactivated fetal bovine serum (FBS), and 100 U/mL of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious stocks were propagated by inoculating Vero CCL81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-surface antigen-display assay: Vero cell monolayers were monitored until 80% confluent and then inoculated with VSV-SARS-CoV-2 V (WA1/2020 strain) at an MOI of 0.5 in culture medium (DMEM with 2% FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding cDNA for each S protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heterozygous K18-hACE c57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE c57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heat map generation: All sequences that were identified to be public clonotypes were analyzed with PyIR66 to identify the V and J genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyIR66</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These frequency counts then were plotted onto the heatmap using Python Seaborn Library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expressed protein was incubated with BioLock (IBA Lifesciences) and then isolated by Strep-tag affinity chromatography on StrepTrap HP columns (GE Healthcare), followed by size-exclusion chromatography on TSKgel G4000SWXL (TOSOH) if needed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLock</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer:m GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACTGCCGCCTCTGCTC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Probe</div><div>suggested: (UniPROBE, RRID:SCR_005803)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed using the cryoSPARC software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicons were sequenced on an Illumina Novaseq 6000, and data were processed using the CellRanger software v3.1.0 (10X Genomics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellRanger</div><div>suggested: (SCIGA, RRID:SCR_021002)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Prism v8.4.3 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.05.02.442326
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.04.30.21256060

1
1. sciscore 07 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.30.21256060: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The number of replicates carried out for each experiment is described in the figure/table legends.<br>IRB: Sample acquisition from COVID-19 patients: The Ethics Committee of Huoshenshan Hospital approved the study (HSSLL036).<br>Consent: Given the urgency of the COVID-19 pandemic, the need for informed consent forms was waived by the ethics boards of the hospitals.<br>IACUC: All animal experiments were performed at the AMMS Animal Center (Beijing, China) and were approved by the Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">decompensated chronic renal insufficiency, or severe congestive heart failure), were pregnant or had malignancy (Table 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Fasting blood glucose and random blood glucose levels were measured weekly.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines tested for mycoplasma contamination were incubated in DMEM at 37°C in a humidified atmosphere with 5% CO2.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Anti-α-tubulin (T6074, 1:5,000 dilution) and anti-Flag (A8592, 1:5,000 dilution) antibodies were purchased from Sigma-Aldrich (Missouri, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-α-tubulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T6074</div><div>suggested: (Sigma-Aldrich Cat# T6074, RRID:AB_477582)</div></div><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div><div style="margin-bottom:8px"><div>A8592</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">dilution), anti-insulin (ab6995, 1:200 dilution), anti-CREB-phospho S133 (ab32096, 1:1000 dilution), and anti-CREB (ab32515, 1:1000 dilution) antibodies were purchased from Abcam (Illinois, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-insulin</div><div>suggested: (Abcam Cat# ab6995, RRID:AB_305690)</div></div><div style="margin-bottom:8px"><div>anti-CREB-phospho</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CREB</div><div>suggested: (Abcam Cat# ab32515, RRID:AB_2292301)</div></div><div style="margin-bottom:8px"><div>ab32515</div><div>suggested: (Abcam Cat# ab32515, RRID:AB_2292301)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-GP73 antibody (F-12, sc-393372, 1:200 dilution) was purchased from Santa Cruz (Texas, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sc-393372</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-His antibody (KM8001, 1:1000 dilution) was purchased from Taihua Lekang Biotechnology (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (LSBio (LifeSpan Cat# LS-C129774-1000, RRID:AB_10832018)</div></div><div style="margin-bottom:8px"><div>KM8001</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">dilution), anti-Akt (9272, 1:1000 dilution), anti-phospho-PKA-C-α (Thr197, 5661, 1:1000 dilution), anti-phospho-PKA substrate (RRXpS/T, 9624, 1:1000 dilution), and anti-PKA-C-α (5842, 1:1000 dilution) antibodies were purchased from Cell Signaling Technology (Danvers, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-phospho-PKA substrate ( RRXpS/T , 9624</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PKA-C-α ( 5842</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-rabbit HRP-IgG (ZB-2301, 1:5000 dilution) and anti-mouse HRP-IgG (ZB-2305, 1:5000 dilution) secondary antibodies were purchased from ZSGB-BIO (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-rabbit HRP-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ZB-2301</div><div>suggested: (ZSGB-Bio Cat# ZB-2301, RRID:AB_2747412)</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sandwich ELISA and Western blot analysis: For endogenous GP73 sandwich ELISA, two custom-made rat monoclonal anti-GP73 antibodies were used as the capture antibody and the detection antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GP73</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HepG2 (CRL-10741), Vero E6 (CRL-1568), HK-2 (CRL-2190), 293T (CRL-3216) and L6 (CRL-1658) cell lines were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To knock out human GP73 in Huh-7 cells, two small guide RNAs (sgRNAs) targeting GP73 were designed and inserted into the LentiCrispr v2 vector to construct transfer plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected with pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GP73 KO mice (T20200316-18[D25]) were generated by Southern Model Biotechnology (Shanghai, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GP73 KO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male C57 BLKS/J db/db and BKS control mice (8 weeks, 36-40 g) were purchased from GemPharma Tech Co. Ltd. (Jiangsu, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57 BLKS/J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STZ (40 mg/kg) in citric acid buffer (0.1 mol/L, pH 4.2) was administered to male C57BL/6N mice via intraperitoneal injection, and the same dose of STZ was injected 24 h later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and cell culture: Mammalian expression vectors encoding Flag-tagged human, mouse and rat GP73 were constructed by inserting the corresponding PCR-amplified fragments into pcDNA3 (Invitrogen, Massachusetts, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected with pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G, psPAX2 and the corresponding transfer plasmid to produce lentivirus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant GP73 protein purification: Human, mouse, and rat GP73 cDNAs, each with a six-amino-acid His tag on the N-terminus, were cloned into the pCDNA3.1 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">triglyceride (TG, 200224) and cholesterol (CHO, 200224) biochemical test kits were purchased from Ruierda Biological Technology (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ruierda Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The network was represented using Cytoscape ver 3.6.2 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">https://cytoscape.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://cytoscape.org/</div><div>suggested: (CluePedia Cytoscape plugin, RRID:SCR_015784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-protein interactions were retrieved from STRING App (v1.51) (https://string-db.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For KEGG and GO enrichment analysis, DAVID Bioinformatics Resources 6.8 (https://david.ncifcrf.gov/home.jsp) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The present study used GraphPad Prism 8.0 for statistical calculations and data plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.04.30.21256060
www.sciencedirect.com www.sciencedirect.com

A Membrane-Tethered Ubiquitination Pathway Regulates Hedgehog Signaling and Heart Development

1
1. scibot 07 May 2021
  
  in Public
  
  RRID:AB_256335
  
  DOI: 10.1016/j.devcel.2020.08.012
  
  Resource: (BioLegend Cat# 901513, RRID:AB_2565335)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_2565335
  
  Curator comments: Anti-HA.11 Epitope Tag antibody BioLegend Cat# 901513
  
  What is this?
  
  RRIDCUR:Unresolved RRIDCUR:Incorrect RRID:AB_2565335
Visit annotations in context

Tags

RRIDCUR:Incorrect

RRIDCUR:Unresolved

RRID:AB_2565335

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S1534580720306705
www.kickstarter.com www.kickstarter.com

Koi Garden - Harmonious gardening card game

1
1. TylerRick 07 May 2021
  
  in Public
  
  My name is Floyd Lu, I have been designing and publishing games since 2015 under B&B Games studio. In 2020 B&B Games studio dissolved. I took over a part of the business including this account. I am unable to change the name and URL of my Kickstarter account. I delivered and personally worked on each project that I did and I can't transfer all the followers, therefore, I am still launching new projects under this account.
  
  annotation meta: may need new tag name changes
Visit annotations in context

Tags

annotation meta: may need new tag

name changes

Annotators

TylerRick

URL

kickstarter.com/projects/bnbgames/koi-garden-harmonious-gardening-card-game
www.impressivewebs.com www.impressivewebs.com

A Call For Better Fragment Identifiers - Impressive Webs

2
1. TylerRick 07 May 2021
  
  in Public
  
  when HTML5 started, the feedback from the HTML5 guys was pretty clear: HTML5 is there to improve web apps (standards-based flash! yay!), and not to improve HTML as a hypermedia format. http://dret.typepad.com/dretblog/2008/05/xhtml-fragment.html was a very early attempt to raise the issue and was shot down promptly. with HTML5 now branching into so many micro-specs (https://github.com/dret/HTML5-overview), maybe there’s a good chance to simply create a “FragIDs in HTML5” spec and see if there’s any community uptake. it would be great to see this getting started, and maybe IETF with its more open process would be a better place than W3C.
  
  annotation meta: may need new tag
2. TylerRick 07 May 2021
  
  in Public
  
  The simple problem that I see with fragment identifiers is that their existence and functionality relies completely on the developer rather than the browser. Yes, the browser needs to read and interpret the identifier and identify the matching fragment. But if the developer doesn’t include any id attributes in the HTML of the page, then there will be no identifiable fragments. Do you see why this is a problem? Whether the developer has coded identifiers into the HTML has nothing to do with whether or not the page actually has fragments. Virtually every web page has fragments. In fact, sectioning content as defined in the HTML5 spec implies as much. Every element on the page that can contain content can theoretically be categorized as a “fragment”.
  
  at the mercy of author
  
  good point annotation meta: may need new tag HTML: fragment identifiers limitations unfortunate feature proposal
Visit annotations in context

Tags

good point

feature proposal

HTML: fragment identifiers

unfortunate

annotation meta: may need new tag

limitations

Annotators

TylerRick

URL

impressivewebs.com/better-fragment-identifiers/
simonstl.com simonstl.com

Using CSS Selectors as Fragment Identifiers

1
1. TylerRick 07 May 2021
  
  in Public
  
  Making effective use of this mechanism requires either control of the targeted document or generous creators of targeted documents who have liberally applied id attributes throughout a document.
  
  unlikely for anyone/most people to actually do that
  
  good point annotation meta: may need new tag
Visit annotations in context

Tags

good point

annotation meta: may need new tag

Annotators

TylerRick

URL

simonstl.com/articles/cssFragID.html
stackoverflow.com stackoverflow.com

Make elements overlap in cross-client HTML emails?

1
1. TylerRick 06 May 2021
  
  in Public
  
  confirmation or refutation would be appreciated
  
  annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

Annotators

TylerRick

URL

stackoverflow.com/questions/14337457/make-elements-overlap-in-cross-client-html-emails
www.sciencedirect.com www.sciencedirect.com

NPC1-mTORC1 Signaling Couples Cholesterol Sensing to Organelle Homeostasis and Is a Targetable Pathway in Niemann-Pick Type C

1
1. scibot 06 May 2021
  
  in Public
  
  Rabbit monoclonal anti-DYKDDDK Tag
  
  DOI: 10.1016/j.devcel.2020.11.016
  
  Resource: (Cell Signaling Technology Cat# 2368, RRID:AB_2217020)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_2217020
  
  What is this?
  
  RRID:AB_2217020 RRIDCUR:Missing
Visit annotations in context

Tags

RRIDCUR:Missing

RRID:AB_2217020

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S1534580720309254
hashnode.com hashnode.com

Why is there so much variation in email CSS support amongst different clients? - Hashnode

2
1. TylerRick 06 May 2021
  
  in Public
  
  But more so, external style cannot be applied to a subsection of a web page unless they force it into an iframe, which has all sorts of issues of it's own which is why external CSS is usually ignored. Inline CSS is often stripped by the tag strippers who don't want you turning things on or off... and media queries shouldn't even play into it since the layout should be controlled by the page it's being shown inside (for webmail) or the client itself, NOT your mail.
  
  difficult/hard problem email client HTML email whose responsibility is it? no control over who should control over _? HTML email: CSS HTML: tables: avoid using preventing CSS/styles from affecting outside of container (isolation) (global scope)
2. TylerRick 06 May 2021
  
  in Public
  
  That's something that has been bugging me too. I mean, it's fine if not everything is supported, but if everyone could agree on what is or should be supported then that would make a huge difference. But until then, it's going to be a struggle.
  
  good point +0.9 HTML email: support varies between different clients let's agree on some standard annotation meta: may need new tag I agree
Visit annotations in context

Tags

email client

difficult/hard problem

who should control over _?

I agree

HTML email

let's agree on some standard

no control over

whose responsibility is it?

HTML email: CSS

HTML: tables: avoid using

good point

+0.9

HTML email: support varies between different clients

annotation meta: may need new tag

preventing CSS/styles from affecting outside of container (isolation) (global scope)

Annotators

TylerRick

URL

hashnode.com/post/why-is-there-so-much-variation-in-email-css-support-amongst-different-clients-cimhhv8ew0077in530zz0oh4h
hashnode.com hashnode.com

Can we use CSS Flexbox in HTML Emails? - Hashnode

1
1. TylerRick 06 May 2021
  
  in Public
  
  Honestly, even without flexbox support, most of the layout problems would be solved with simple-basic CSS3 support that is standard in all clients.
  
  layout problems don't need ; all we need is simple-basic CSS3 support that is standard in all clients.
  
  HTML email: CSS annotation meta: may need new tag CSS: flex
Visit annotations in context

Tags

HTML email: CSS

annotation meta: may need new tag

CSS: flex

Annotators

TylerRick

URL

hashnode.com/post/can-we-use-css-flexbox-in-html-emails-cimofeksh00a0ao53uqeyht5i
www.litmus.com www.litmus.com

A Bulletproof Guide to Using HTML5 and CSS3 in Email - Litmus

1
1. TylerRick 06 May 2021
  
  in Public
  
  Approaching email development this way transitions more of the quality assurance (QA) process to the browser instead of the email client. It gives email designers more power, control, and confidence in developing an email that will render gracefully across all email clients.
  
  can mostly test with browser and have less need (but still not no need) to test with email client
  
  annotation meta: may need new tag QA (quality assurance) process feeling confident confidence
Visit annotations in context

Tags

annotation meta: may need new tag

QA (quality assurance) process

confidence

feeling confident

Annotators

TylerRick

URL

litmus.com/blog/a-bulletproof-guide-to-using-html5-and-css3-in-email/
www.gkogan.co www.gkogan.co

Don’t Design Your Emails

1
1. TylerRick 06 May 2021
  
  in Public
  
  They don't look like advertisements. The second the recipient interprets your email as an ad, promotion, or sales pitch—and it does take just a second—its chances of being read or acted upon plummet towards zero. A plain email leads people to start reading it before jumping to conclusions.
  
  forces you to read before deciding
  
  HTML email vs. text email first impressions good point annotation meta: may need new tag
Visit annotations in context

Tags

first impressions

HTML email vs. text email

good point

annotation meta: may need new tag

Annotators

TylerRick

URL

gkogan.co/blog/dont-design-emails/
www.newsweek.com www.newsweek.com

How To Raise Your Ecological Intelligence

3
1. galevine 05 May 2021
  
  in Public
  
  hidden price tag:
  
  so this means that the product may not be the best for our planet and yet we don't know about it and are continuing to buy these products.
2. maddieday01 05 May 2021
  
  in Public
  
  hidden price tag:
  
  a toll on the planet, everything we buy has some effect on the planet
3. mayajb2004 04 May 2021
  
  in Public
  
  price tag
  
  that's a good song by jessie j
Visit annotations in context

Annotators

mayajb2004

galevine

maddieday01

URL

newsweek.com/how-raise-your-ecological-intelligence-77503
canvas.uchicago.edu canvas.uchicago.edu

Georg Herwegh - Morgenruf (1841): GRMN 21303 1 (Spring 2021) Gedicht

1
1. esisco 04 May 2021
  
  in Public
  
  Tag, der Tag
  
  licht
Visit annotations in context

Annotators

esisco

URL

canvas.uchicago.edu/courses/35149/pages/georg-herwegh-morgenruf-1841
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.30.442182

1
1. sciscore 03 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.30.442182: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cells secreting target-specific antibodies were identified and isolated using three assay types (55): a multiplexed bead assay using multiple optically-encoded beads, each conjugated to the soluble pre-fusion stabilized S protein of either SARS-CoV-2 or WIV1 S with T4-foldon domain, 3C protease cleavage site, 6x His-tags, and twin-strep tags (34), the SARS-CoV-2 S1 subunit or negative controls (bovine serum albumin [BSA] His-tag and T4 FoldOn trimerization domain), and a live cell assay using passively dyed suspension-adapted Chinese hamster ovary (CHO) cells transiently transfected to surface-express full-length SARS-CoV-2 S protein (GenBank ID MN908947.3) with a green fluorescent protein (GFP) reporter, and non-transfected cells as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were recombinantly produced by transient transfection in either human-embryonic kidney (HEK293) or CHO cells as described in Supplemental Methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were prepared by mixing each antibody in 10-fold molar excess with antigen (1:1 freshly prepared mix of 400 nM antibody and 40 nM antigen, both diluted in 1X HBSTE + 0.05% BSA running buffer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen</div><div>suggested: (W. Sieghart, Center for Brain Research, Medical University of Vienna; Vienna; Austria Cat# Beta1 (375-400, RRID:AB_2827800)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test the antibodies’ ability to block ACE2, antibodies coupled to the HC-30M chip as described above were exposed to SARS-CoV-2 S protein:ACE2 complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multi-cycle kinetics on Biacore: The capture molecule, an anti-human IgG (Fc) antibody, was immobilized on a Biacore CM5 chip by direct coupling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO cells were washed, and binding was detected by using a fluorescently labeled anti-human secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human secondary antibody .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Median fluorescence intensity of each antibody was normalized over the median fluorescence intensity of the human isotype control for respective antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human isotype control for respective antigens .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious titers were determined for a subset of virus preparations by infection of VeroE6 cells (ATCC CRL-1586) with serially diluted virus followed by staining with an anti-luciferase antibody (Novus Cat # NB600-307PEATT594) and analysis by fluorescence-activated cell sorting using a Becton Dickinson LSRFortessaTM X-20</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-luciferase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NB600-307PEATT594</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cells were detected using a primary detection antibody recognizing SARS-CoV-2 nucleocapsid protein (Sino Biological) following staining with secondary detection antibody (goat α-rabbit) conjugated to AlexaFluor 488.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: (Bioss Cat# bsm-41414M, RRID:AB_2848129)</div></div><div style="margin-bottom:8px"><div>α-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extracellular domain (ECD, residues 18 to 618) of ACE2 was expressed in CHO cells as an Fc-fusion protein containing a TEV-protease recognition site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cells secreting target-specific antibodies were identified and isolated using three assay types (55): a multiplexed bead assay using multiple optically-encoded beads, each conjugated to the soluble pre-fusion stabilized S protein of either SARS-CoV-2 or WIV1 S with T4-foldon domain, 3C protease cleavage site, 6x His-tags, and twin-strep tags (34), the SARS-CoV-2 S1 subunit or negative controls (bovine serum albumin [BSA] His-tag and T4 FoldOn trimerization domain), and a live cell assay using passively dyed suspension-adapted Chinese hamster ovary (CHO) cells transiently transfected to surface-express full-length SARS-CoV-2 S protein (GenBank ID MN908947.3) with a green fluorescent protein (GFP) reporter, and non-transfected cells as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chinese hamster ovary ( CHO )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with individual mutant spike expression plasmids, and 16 to 20 hours later, transfected cells were infected with VSV-G-pseudotyped ΔGluciferase rVSV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious titers were determined for a subset of virus preparations by infection of VeroE6 cells (ATCC CRL-1586) with serially diluted virus followed by staining with an anti-luciferase antibody (Novus Cat # NB600-307PEATT594) and analysis by fluorescence-activated cell sorting using a Becton Dickinson LSRFortessaTM X-20</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assay serial dilutions (2 dilutions at 10 and 1 μg/ml for the initial screen assay or 8 dilutions for the full curve at 10-0.0006 μg/ml) of monoclonal antibodies were mixed with titrated pseudovirus, incubated for 45 minutes at 37 °C and added to pre-seeded 293T-ACE2 cells (provided by Dr. Michael Farzan) in triplicate in 96-well white/black Isoplates (Perkin Elmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-76 cells were inoculated with SARS-CoV-2 (GenBank MT020880.1) at a MOI = 0.01 and incubated at 37°C with 5% CO2 and 80% humidity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixture was applied to monolayers of Vero-E6 cells in a 96-well plate and incubated for 1 hour at 37°C in a humidified incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell sequencing, bioinformatic analysis, and cloning: Single cell polymerase chain reaction (PCR) and custom molecular biology protocols generated NGS sequencing libraries (MiSeq, Illumina) using automated workstations (Bravo, Agilent).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were verified by Sanger sequencing to confirm the original sequence previously identified by NGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization IC50, IC80 and IC90 titers were calculated using GraphPad Prism 8.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model building was performed with Coot (CCP4) and final structure validation with MolProbity (Chen et al., 2010) and CCP4 validation tools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, 2019.0101; Chemical Computing Group ULC), and detailed contact analysis with CCP4 CONTACT(Winn et al., 2011) and custom shell/Perl scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We aligned the genomes to the SARS-CoV-2 reference genome (Genbank file MN908947.3) using BWA-MEM (Danecek et al., 2021), and performed variant calling and annotation using SAMTools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div><div style="margin-bottom:8px"><div>SAMTools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All further analysis (i.e. slicing by time or geographic region) was performed using custom-written Python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.30.442182
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.04.29.21256002

1
1. sciscore 03 May 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.29.21256002: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Experimental Model and Subject Details Study Cohort: Blood samples were collected from COVID-19 patients (n = 25) in acute phase of infection (COVT1) hospitalized at the Hospital del Mar (Barcelona, Spain), with patient informed consent.<br>IRB: All procedures followed were approved by the Ethical Committee for Clinical Investigation of the Institut Hospital del Mar d’Investigacions Mèdiques (Number 2020/9189/I).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">52 % were males.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, plates were incubated with horseradish peroxidase (HRP)-conjugated anti-human Ig secondary antibodies diluted in PBS containing 0.05% Tween 20 1% BSA for 45 minutes at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Ig secondary</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess the distribution of the different IgG antibody subclasses, HRP-conjugated anti-human IgG1, IgG2, IgG3 and IgG4 (Southern Biotech) were used at a 1:3000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2, IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To quantitate the level of each viral antigen-specific antibody class or subclasses optical density (OD) values were calculated after subtraction of background (OD450 of serum dilutions on PBS-coated plates) and the area under the curve (AUC) derived from optical density measurements of six serial dilutions was determined using Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then resuspended in 2 mL of LIVE/DEAD Fixable Yellow Dead Cell Stain Kit (Thermo Fisher Scientific) 1:20000 in PBS, incubated for 30 min at RT and stained with two different fluorophore-conjugated antibody cocktails (Table S2 and S4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-CCR7 antibody was added first and incubated for 10 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-CCR7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, all other anti-chemokine receptor antibodies (CXCR3, CXCR4, CXCR5, CCR4 and CCR6 for MIX3, and CXCR3 and CXCR4 for MIX 1) were added to the corresponding tubes and incubated for 10 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-chemokine receptor</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCR4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCR6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MIX3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed and stained with the MIX 2 antibody cocktail for 10 min using anti-human IgA AmCyan instead of anti-human IgA FITC (Table S3) and DAPI fluorescent dye (Sigma Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis (PCA) was used to identify the most important features from 41 variables (including antibody titers and immune parameters; Data File S1) using COVT1 (n = 25), COVT2 (n = 20) and healthy controls (n = 16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVT1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>COVT2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pLVX-EF1alpha-nCoV2019-N-2xStrep-IRES-Puro construct, encoding for the full-length SARS-CoV-2 nucleocapsid protein (NP) fused to a double Strep-tag at the C-terminus was a gift from Dr Krogan (University of California, San Francisco USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-nCoV2019-N-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To quantitate the level of each viral antigen-specific antibody class or subclasses optical density (OD) values were calculated after subtraction of background (OD450 of serum dilutions on PBS-coated plates) and the area under the curve (AUC) derived from optical density measurements of six serial dilutions was determined using Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-dimensional data analysis of flow cytometry data: t-Distributed Stochastic Neighbor Embedding (tSNE) analyses were performed with Flowjo V10.6.2 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis and visualization: GraphPad Prism (version 8.0) and R (version 3.6.3, R Core Team (2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 36. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.04.29.21256002
Local file Local file

Buchdeckel - Gruppe 1

1
1. rgrinschgl 01 May 2021
  
  in Public
  
  aber jetzt noch nicht. Wann würde sie die Höchstgrenzung ihres Unglück erreichen? Sie wusste nicht, weil jeder Tag fast unerträglich war. Aber die Königreich sah weg von Olga undignorierte ihre ernstes und unfreundliches Betragen, wie ein beschämter Vater der sein Kind vor den Dorf Betrunkenen versteckt
  
  Dieses Zitat zeigt eine spezifische Reflexion der Ursprünge, aus denen die spezifischen Elemente der Geschichte bestehen. Es sind jedoch stilistische Elemente, die diese zum Tragen bringen. Hier sehen wir den Einfluss, den Elternschaft und Kindheit auf die Geschichte haben, insbesondere in Bezug auf die Erziehung von Kindern vom Vater. Eine Metapher wird verwendet, um Olga's Situation, eine der wichtigsten weiblichen Figuren, mit einer Situation zu vergleichen, die einem beschämten Vater ähnelt. Dies zeigt, wie die Autoren versuchen, sich den Geschlechterrollen zu widersetzen, insbesondere denen der patriarchalischen Herrschaft, was sich in ihrer anfänglichen Motivation widerspiegelte, eine Geschichte mit einer jungen Protagonistin zu schreiben und eine "Heldin" anstatt ein "Held".
  
  Deutung
Tags

Deutung

Annotators

rgrinschgl
www.makeuseof.com www.makeuseof.com

What Is Half-Duplex And Full-Duplex Operation, And How Does It Affect Your Router?

1
1. gyuri 01 May 2021
  
  in Public
  
  What Is Half-Duplex And Full-Duplex Operation, And How Does It Affect Your Router? By Phoon YS Published Sep 22, 2014 Share Share Tweet Email WiFi connections are running at half-duplex while the wired part of the LAN are on full-duplex. So it seems that by connecting through WiFi, something had to give. Were we shortchanged?
Visit annotations in context

Annotators

gyuri

URL

makeuseof.com/tag/what-is-half-duplex-and-full-duplex-operation-and-how-does-it-affect-your-router/
Apr 2021
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.28.441474

1
1. sciscore 30 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.28.441474: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All studies were performed in accordance with Wistar Institutional Animal Care and Use Committees under approved animal protocols.<br>Euthanasia Agents: For cellular responses, mice were euthanized under CO2 overdose.<br>Field Sample Permit: Serum samples were collected at indicated timepoints via saphenous vein blood collection throughout the experiment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Hartley guinea pigs (8 weeks old, Elm Hill Labs, Chelmsford MA) were housed at Acculab (San Diego CA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the lethal challenge study, Texas Biomed were blinded to identity of vaccination groups and weight loss cutoff for euthanasia was 20%.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blocking Buffer (LI-COR) for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS) Antibody Diluent (LI-COR) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag C-term</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then incubated in a 1:10000 IRDye 800CW goat anti-rabbit IgG (LI-COR Biosciences) in Intercept T20 (PBS) Antibody Diluent (LI-COR) at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Human IgG-Fc fragment cross-adsorbed antibody HRP conjugated (Bethyl Laboratories) secondary at a 1:10,000 dilution for 1 hour at ambient temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Goat anti-Human IgG-Fc fragment cross-adsorbed antibody HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For BL6, BALB/c, and K18 ACE2 mouse studies, goat anti-mouse IgG h+l HRP-tagged antibody (Bethyl Laboratories) diluted 1:20000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment Goat Anti-Rat IgM, μ chain specific (Jackson ImmunoResearch) at 1:10000, Goat anti-Human Kappa Light Chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:10000,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rat IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human Kappa Light Chain</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Human Lambda Light Chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:10000, and Goat anti-Mouse IgG-heavy and light chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:20000, and Goat anti-guinea pig IgG whole molecule (Sigma) at 1:10,000 were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human Lambda Light Chain</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG-heavy</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-guinea pig IgG whole molecule ( Sigma )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Hamster HRP antibody (Sigma) was diluted in diluent buffer 1:10,000 and were incubated for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Hamster HRP antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Hamster HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular cytokine staining and Flow cytometry: Splenocytes were processed as described in the previous section and stimulated with RBD peptides for 5 hours at 37°C with protein transport inhibitor (Invitrogen) and anti-mouse CD107a-FITC antibody (BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD107a-FITC</div><div>suggested: (SouthernBiotech Cat# 1920-02, RRID:AB_2795531)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse CD4-BV510, CD8-APC-Cy7, CD44-A700, and CD62L-BV711 antibodies were used for surface staining and CD3e-PE-Cy5, IFN-γ-APC, and TNF-α-BV605 (all from BioLegend) were used for intracellular staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse CD4-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8-APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD44-A700</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD62L-BV711</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3e-PE-Cy5 , IFN-γ-APC ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α-BV605</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ExpiF293 cells were transfected with the pVAX plasmid vector either carrying the nanoparticles or the His-Tagged monomer transgene with PEI/Opti-MEM and harvested 6-7 days post transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExpiF293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Neutralization Assay: HEK293T (CRL-3216) and CHO cells (CRL-12023: double check) were obtained from ATCC (Manassas, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO-ACE2 cells were seeded at 10,000 cells/well in 96-well plates and incubated for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To grow a stock of virus, 3 million Vero cells were seeded in a T-75 flask for overnight incubation (37⍰C, 5% CO2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For BL6, BALB/c, and K18 ACE2 mouse studies, goat anti-mouse IgG h+l HRP-tagged antibody (Bethyl Laboratories) diluted 1:20000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal Studies: C57BL/6, BALBc, and K18-hACE2 mice were obtained from Charles River Laboratories (Malvern, PA) and The Jackson Laboratory (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All animals were housed in the Wistar animal facility in ventilated cages and given free access to food and water.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar</div><div>suggested: RRID:MGI:5657554)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA encoding the variants were codon optimized for homo sapiens and cloned with a IgE secretion sequence into the pVAX vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVAX</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody production, heavy and light chains were encoded in pFUSEss-CHIg-hG1, and pFUSE2ss-CLIg-hk or pFUSEss-CLIg-hL2 respectively and were co-transfected in equal parts using ExpiFectamine™ 293 Transfection Kit(Gibco) according to manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUSEss-CHIg-hG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFUSE2ss-CLIg-hk</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFUSEss-CLIg-hL2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6μg S_IgE_deltaCterm19_plasmid (Genscript), and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Curves were analyzed in GraphPad Prism 8 with Sigmoidal, 4PL, X is concentration and AUC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For variant pseudoviruses, cells were similarly treated with GeneJammer and backbone with 6μg of S_SA_IgE_deltaCterm19, S_UK_IgE_deltaCterm19, or S_Brazil_IgE_deltaCterm19 plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneJammer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus titer (TCID50/ml) was calculated using the Reed-Munch method and the Microsoft Excel based calculator published by Lei et al[73] For neutralization assays, Vero cells were seeded in DMEM with 1% FBS at 20,000 cells/well in 96 well flat bottom plates for overnight incubation (37C, 5% CO2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing was performed in Relion v3.1.2[74]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were run on an 18-color LSRII flow cytometer (BD Biosciences) and analyzed by FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After being washed, the plates were further incubated at room temperature for 1 hour with goat-anti human IgG-Fc fragment cross-adsorbed Ab (A80-340P; Bethyl Laboratories) at a 1: 10,000 dilution, followed by addition of TMB substrates (ThermoFisher), and then quenched with 1M H2SO4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.28.441474
store.steampowered.com store.steampowered.com

Space Fat: To the Core on Steam

1
1. TylerRick 30 Apr 2021
  
  in Public
  
  NEGATIVESThe interface between the game and the Steam Client denies you the ability to take screenshots. I also could not capture play footage.
  
  unnecessarily restrictive unfortunate policies/laws annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

unfortunate policies/laws

unnecessarily restrictive

Annotators

TylerRick

URL

store.steampowered.com/app/1338920/Space_Fat_To_the_Core/
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.26.441517

1
1. sciscore 29 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.26.441517: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A correction nomogram for this ELISA is reproduced in Figure 1A. ELISA for Human IgG Antibodies Specific for the SARS-CoV-2 Spike Protein Receptor-Binding Domain (RBD): This is a sandwich ELISA in which a capture antibody, rabbit anti-mouse IgG, is adsorbed onto microtititer wells, followed by antigen capture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA Inhibition by RBD Variants: Human anti-SP IgG or ACE-2 Fc was mixed with recombinant SARS-CoV-2 spike RBD His tag (R&D Systems) or recombinant SARS-CoV-2 spike RBD (N501Y)-His tag (Sino Biological, Wayne, PA), both comprising R319-F541 (MW 26 kDa), to produce serial dilutions of 0-500 ng/ml of RBD in the presence of 25 ng/ml of antibody standard for primary incubation following the blocking step of the rSP ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SP IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>N501Y)-His tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values of inhibition curves were determined by exponential decay regression analysis using SigmaPlot 10 software, as (−0.693)/(-k), where k is the decay constant, expressed as molar concentration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SigmaPlot</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.26.441517
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.04.19.21255739

1
1. sciscore 29 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.19.21255739: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Populations: Two longitudinal COVID-19 cohort studies at Fred Hutchinson Cancer Research Center (Seattle, Washington) and Emory University (Atlanta, Georgia) began after receiving institutional review board approvals (IRB 10440, IRB 00001080 and IRB00022371).<br>Consent: Adults ≥18 years were enrolled who met eligibility criteria for SARS-CoV-2 infection and provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants undiagnosed with COVID-19 had a nasopharyngeal (NP) swab collected and tested for SARS-CoV-2 via an FDA-approved PCR test and blood was collected for SARS-CoV-2 antibody (Abbott) and study assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following a wash, plates were incubated with 50ul/well of Sulfo-Tag anti-human IgG, IgA, or IgM detection antibody and shaken at 700RPM at room temperature for 1 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixture was added to VeroE6 cell (C1008, ATCC,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C1008</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixture was added to VeroE6 cell (C1008, ATCC,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study Populations: Two longitudinal COVID-19 cohort studies at Fred Hutchinson Cancer Research Center (Seattle, Washington) and Emory University (Atlanta, Georgia) began after receiving institutional review board approvals (IRB 10440, IRB 00001080 and IRB00022371).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IRB 00001080</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants undiagnosed with COVID-19 had a nasopharyngeal (NP) swab collected and tested for SARS-CoV-2 via an FDA-approved PCR test and blood was collected for SARS-CoV-2 antibody (Abbott) and study assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The FRNT-mNG50 titers were interpolated using a 4-parameter nonlinear regression in GraphPad Prism 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed in Flow Jo version 9.9.4</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flow Jo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.04.19.21255739
www.sciencedirect.com www.sciencedirect.com

Obesity-Linked PPARγ S273 Phosphorylation Promotes Insulin Resistance through Growth Differentiation Factor 3

1
1. scibot 29 Apr 2021
  
  in Public
  
  rabbit anti-Myc-Tag
  
  DOI: 10.1016/j.cmet.2020.08.016
  
  Resource: (Cell Signaling Technology Cat# 2278, RRID:AB_490778)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_490778
  
  What is this?
  
  RRIDCUR:Missing RRID:AB_490778
Visit annotations in context

Tags

RRIDCUR:Missing

RRID:AB_490778

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S1550413120304769
stackoverflow.com stackoverflow.com

How can I keep my initializer configuration from being lost in development mode?

1
1. TylerRick 27 Apr 2021
  
  in Public
  
  There's nothing to stop you from doing initializer code in a file that lives in app/models. for example class MyClass def self.run_me_when_the_class_is_loaded end end MyClass.run_me_when_the_class_is_loaded MyClass.run_me... will run when the class is loaded .... which is what we want, right? Not sure if its the Rails way.... but its extremely straightforward, and does not depend on the shifting winds of Rails.
  
  does not depend on the shifting winds of Rails.
  
  prefer simpler option does not depend on official preferred convention / way to do something changed their mind/opinion annotation meta: may need new tag
Visit annotations in context

Tags

official preferred convention / way to do something

does not depend on

annotation meta: may need new tag

prefer simpler option

changed their mind/opinion

Annotators

TylerRick

URL

stackoverflow.com/questions/8895103/how-can-i-keep-my-initializer-configuration-from-being-lost-in-development-mode
www.sciencedirect.com www.sciencedirect.com

Identification of Small-Molecule Activators of the Ubiquitin Ligase E6AP/UBE3A and Angelman Syndrome-Derived E6AP/UBE3A Variants

1
1. scibot 27 Apr 2021
  
  in Public
  
  RRID:AB_282020
  
  DOI: 10.1016/j.chembiol.2020.08.017
  
  Resource: (BioLegend Cat# 901516, RRID:AB_2820200)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_2820200
  
  Curator comments: Anti-HA.11 Epitope Tag antibody BioLegend Cat# 901516
  
  What is this?
  
  RRID:AB_2820200 RRIDCUR:Unresolved RRIDCUR:Incorrect
Visit annotations in context

Tags

RRIDCUR:Incorrect

RRID:AB_2820200

RRIDCUR:Unresolved

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S2451945620303391
github.com github.com

bdurand/lumberjack

2
1. TylerRick 26 Apr 2021
  
  in Public
  
  # This will register formatters only on specific tag names logger.tag_formatter.add(:thread) { |thread| "Thread(#{thread.name})" } logger.tag_formatter.add(:current_user, Lumberjack::Formatter::IdFormatter.new)
  
  nice API
2. TylerRick 26 Apr 2021
  
  in Public
  
  Lumberjack 1.0 had a concept of a unit of work id that could be used to tie log messages together. This has been replaced by tags. There is still an implementation of Lumberjack.unit_of_work, but it is just a wrapper on the tag implementation.
  
  deprecated wrapper (software) newer/better ways of doing things logging
Visit annotations in context

Tags

logging

nice API

newer/better ways of doing things

wrapper (software)

deprecated

Annotators

TylerRick

URL

github.com/bdurand/lumberjack
gdprhub.eu gdprhub.eu

Datainspektionen - DI-2019-3839 - GDPRhub

1
1. mariakonsta 24 Apr 2021
  
  in Public
  
  does not have limited user permissions for accessing the medical record system TakeCare to what is needed only for the user to be able to carry out their duties
  
  lack of limited user permission; lack of restricted access to what is only needed for the carer's duty
  
  ADD TAG
Visit annotations in context

Annotators

mariakonsta

URL

gdprhub.eu/index.php
www.sciencedirect.com www.sciencedirect.com

Human T-bet Governs Innate and Innate-like Adaptive IFN-γ Immunity against Mycobacteria

1
1. scibot 24 Apr 2021
  
  in Public
  
  Anti-GFP tag Mouse Monoclonal Antibody
  
  DOI: 10.1016/j.cell.2020.10.046
  
  Resource: (Proteintech Cat# HRP-66002, RRID:AB_2883834)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_2883834
  
  What is this?
  
  RRID:AB_2883834 RRIDCUR:Missing
Visit annotations in context

Tags

RRIDCUR:Missing

RRID:AB_2883834

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S0092867420314537
www.sciencedirect.com www.sciencedirect.com

A Structural Model of the Endogenous Human BAF Complex Informs Disease Mechanisms

1
1. scibot 24 Apr 2021
  
  in Public
  
  Rabbit Anti-V5 tag (D3H8Q)
  
  DOI: 10.1016/j.cell.2020.09.051
  
  Resource: (Cell Signaling Technology Cat# 13202, RRID:AB_2687461)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_2687461
  
  What is this?
  
  RRID:AB_2687461 RRIDCUR:Missing
Visit annotations in context

Tags

RRIDCUR:Missing

RRID:AB_2687461

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S0092867420312484
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.20.440678

1
1. sciscore 24 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.20.440678: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All cells were maintained at 37°C with 5% CO2 Source of Primary Human T cells: Blood was obtained from Blood Centers of the Pacific (San Francisco, CA) as approved by the University Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Surface expressed proteins were assayed for using Alexa Fluor 647 Anti-Myc tag antibody (Cell Signaling Technologies #2233S)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Myc tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells expressing ACE2 and TMPRSS2, a generous gift of Hannah S Sperber and Dr. Satish Pillai, were cultured in DMEM High Glucose (Gibco #10569-010) supplemented with 10% FBS, 1% of Antibiotic-Antimycotic,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of Stable Cell Lines: Lenti-X 293T cells (Takara Bio #632180) were seeded at approximately 7e5 cells/well in a 6-well plate to yield ~80% confluency the following day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was changed after 24 hours, and at 48 hours the viral supernatant was filtered through a 0.45μm PVDF filter and added to Jurkat or K562 cells seeded at approximately 1e5 cells/well in a 12-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K562</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to the flow cytometry, cells were seeded at densities described below in a 96 well plates, using flat-bottom plates (Falcon #353072) for experiments involving BHK-21 cells and U bottom plates for all other experiments (Falcon #877217) and incubated for 24-72 hours as specified by the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day cells were transfected with 1.5μg of transfer vector containing the desired expression cassette, and the lentiviral packaging plasmids pMD2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G (170ng) and pCMV-dR8.91 (1.33μg) using 10μl of Lipofectamine 2000 (Invitrogen #11668-027) according to manufacturer protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dR8.91</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with plasmid DNA (340 ng of Spike vector, 1μg CMV-Gag-Pol (pCMV-dΔR8.91), 125 ng pAdvantage (Promega), 1 μg Luciferase reporter (per 6-well plate)) for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dΔR8.91</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For positive control, Spike vector was replaced with pMD2.G and for negative control this vector was omitted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2.G</div><div>suggested: RRID:Addgene_12259)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For LCB1 and LCB3, protein sequences were translated to human optimized coding sequences using Benchling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Benchling</div><div>suggested: (Benchling, RRID:SCR_013955)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were collected using FACSDiva (BD Biosciences) Flow Cytometry: Flow cytometry was performed using a LSR-Fortessa (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein concentration was estimated based on the protein absorbance at 280nm with a spectrophotometer (Nanodrop One, Thermo), flash frozen, and stored in −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data analysis was conducted using custom Python scripts, available on github (https://github.com/weinberz/sarsnotch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was conducted in Jupyter59 and relied on numpy60, matplotlib, seaborn, pandas, SciPy61, scikit-learn62 and fcsparser.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.20.440678
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.19.440481

1
1. sciscore 24 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.19.440481: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The original studies to obtain blood samples after written informed consent were previously described and had been approved by the Ethics Board of ChongQing Medical University24.<br>IRB: The original studies to obtain blood samples after written informed consent were previously described and had been approved by the Ethics Board of ChongQing Medical University24.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six-to eight-week-old female hACE2 mice were treated with 58G6 or 510A5 monoclonal antibody at a concentration of 10 mg/kg by intraperitoneal route, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAbs: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific mAbs: IMGT/V-QUEST ( http://www.imgt.org/IMGT_vquest/vquest )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A CM5 chip (GE Healthcare) was linked with anti-human IgG-Fc antibody to capture about 9000 response units of the neutralizing Abs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next days, the membranes were washed with TBST and incubated with HRP-conjugated Goat-anti-human Fc antibody (Abcam, ab99759, 1:10000) for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ab99759</div><div>suggested: (Abcam Cat# ab99759, RRID:AB_10673762)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ELISA plates were washed 4 times by blocking buffer and 50 μL Goat F(ab’)2 Anti-Human IgG (Fab’)2 secondary antibody conjugated with ALP (Abcam, ab98532, 1:2000) was incubated with the plate at RT for 30 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation, the mixtures were then transferred into 96-well plates, which were seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were grown to 80% confluency before transfection with VSV-G pseudotyped ΔG-luciferase, pWPXL and pSPAX2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 72 hrs, the luciferase activities of infected HEK293T/ACE2 cells were detected by the Bright-Luciferase Reporter Assay System (Promega, E2650)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells (Thermo Fisher Scientific, USA) cultured in Freestyle 293 Expression Medium (Thermo Fisher Scientific, USA) were maintained at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 and B.1.351 viruses and animal study: Authentic SARS-CoV-2 (WIV04) and B.1.351 (NPRC 2.062100001) viruses were propagated on the Vero-E6 cells and titrated by single layer plaque assay with standard procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudovirus bearing S protein: pVSVG expressing SARS-CoV-2 S protein was constructed as previously described29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSVG</div><div>suggested: RRID:Addgene_85140)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were grown to 80% confluency before transfection with VSV-G pseudotyped ΔG-luciferase, pWPXL and pSPAX2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: To express the prefusion S ectodomain, the gene encoding residues 1-1208 of SARS-CoV-2 S (GenBank: MN908947.3) with a C-terminal T4 fibritin trimerization motif, an HRV-3C protease cleavage site, a Twin-Strep-tag and an 8 × His-tag was synthesized, and cloned into the mammalian expression vector pcDNA3.1, which was a kind gift from L.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 and IC80 of the evaluated mAbs was and calculated by a four-parameter logistic regression using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAbs: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2605 micrographs were collected in a single session with a defocus range comprised between 1.0 and 2.8 μm using SerialEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM data processing: All dose-fractioned images were motion-corrected and dose-weighted by MotionCorr2 software32 and their contrast transfer functions were estimated by cryoSPARC patch CTF estimation33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCorr2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following 2D, 3D classifications, and refinements were all performed in cryoSPARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both of the 58G6 and 13G9 Fab models were first predicted using Phyre226 and then manually built in Coot 0.936 with the guidance of the cryo-EM electron density maps, and overall real-space refinements were performed using Phenix 1.1837.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.19.440481
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.20.440588

1
1. sciscore 24 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.20.440588: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were originally obtained from ATCC and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection Set, Takara)</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fixed cells were incubated with anti-T7e epitope mouse monoclonal antibodies (Novagen, 69522-4) and anti-HA rabbit polyclonal antibodies (Sigma Aldrich, H6908).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-T7e</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies Alexa 488 donkey anti-mouse IgG (Molecular Probes, A-21202) and Alexa 568 donkey anti-rabbit IgG (Molecular Probes, A-10042) were used for double staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Molecular Probes Cat# A-21202, RRID:AB_141607)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect intracellular RABV-P protein, cells were permeabilized with 0.2% Triton X-100 in PBS for 5 min at room temperature and incubated with anti-RABV-P rabbit polyclonal antibody (Tobiume et al., 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RABV-P</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies Alexa 488 donkey anti-mouse IgG and Alexa 568 donkey anti-rabbit IgG were used for staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate ubiquitination states, proteins immunoprecipitated with anti-ubiquitin mouse antibodies were subjected to Western blotting with anti-T7e rabbit antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ubiquitin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total cell lysate was also subjected to immunoblotting with anti-T7e rabbit antibodies and anti-HA rabbit polyclonal antibodies (Sigma Aldrich, H6908) to evaluate the expression levels of Env-T7es and HA-MARCH8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Sigma-Aldrich Cat# H6908, RRID:AB_260070)</div></div><div style="margin-bottom:8px"><div>HA-MARCH8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell maintenance: 293T, HeLa, NIH3T3, HOS, and M8166+MARCH8 (Tada et al., 2015) cells were maintained under standard conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine viral infectivity, 1 × 104 NIH3T3 cells or HeLa cells were incubated with 1 ng of p24 antigen of either arenavirus virus envelope (LCMV-GP)- or alphavirus E3-E2-6K-E1 envelope (derived from CHIKV or RRV)-pseudotyped HIV-1 luciferase reporter viruses, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIH3T3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA constructs: The envelope glycoprotein (Env)-deficient HiBiT-tagged HIV-1 proviral indicator construct pNL-Luc2-IN/HiBiT-E(-)Fin, the HIV-1 Gag-Pol expression plasmid pC-GagPol-RRE, the VSV-G expression plasmid pC-VSVg, the severe acute respiratory syndrome coronavirus (SARS-CoV) spike (S) protein expression plasmid pC-SARS-S, the SARS-CoV-2-S protein expression plasmid pC-SARS2-S, the HIV-1 Rev expression plasmid pCa-Rev, the MARCH8 expression plasmid pC-MARCH8, pC-HA-MARCH8, and the tyrosine motif-mutant pC-MARCH8-AxxL, the ACE2 expression plasmid pC-ACE2 and the TMPRSS2 expression plasmid pC-TMPRSS2, have previously been described elsewhere (Iwabu et al., 2009; Ozono et al., 2021; Ozono et al., 2020; Tada et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-GagPol-RRE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div><div style="margin-bottom:8px"><div>pCa-Rev</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-MARCH8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-MARCH8-AxxL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pC-LCMVgp expressing the viral envelope derived from lymphocytic choriomeningitis virus (LCMV) glycoprotein (gp) was created by inserting PCR-amplified and BsiWI/XhoI-digested LCMV-GP fragments (PCR-amplified from pCI-LCMV-GP (Reignier et al., 2006)) into the Acc65I/XhoI-digested pCAGGS mammalian expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCI-LCMV-GP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pC-CHIKVe expressing alphavirus E3-E2-6K-E1 polyprotein derived from Chikungunya virus (CHIKV) was created by inserting the PCR-amplified and Acc65I/XhoI-digested E3-E2-6K-E1 fragments (PCR-amplified from codon-optimized CHIKV’s C-E3-E2-6K-E1 plasmid (Kishishita et al., 2013)) into the corresponding site of pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-CHIKVe</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C-E3-E2-6K-E1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Another E3-E2-6K-E1 expression plasmid, pC-RRVe, derived from the Ross River virus (RRV) T48 strain, was created by inserting the PCR-amplified and EcoRV/NotI-digested E3-E2-6K-E1 fragments (PCR-amplified from pRRV-E2E1 (Sharkey et al., 2001)) into the corresponding site of pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRRV-E2E1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RABV-G or LCMV-GP mutant (pC-RABVg-CT3K/R, or pC-LCMVgp-CT6K/R), in which cytoplasmic lysine residues at positions 489/508/517 or 465/471/478/487/492/496 were mutated to arginine residues, was created by inserting overlapping PCR fragments into correspondingly digested pC-RABVg or pC-LCMVgp, respectively</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RABVg-CT3K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp-CT6K/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutants of SARS-CoV-S and SARS-CoV-2-S (pC-SARS-S-CT4K/R, or pC-SARS2-S-CT4K/R), in which cytoplasmic lysine residues at positions 1227/1237/1248/1251 and 1245/1255/1266/1269 were mutated to arginine residues, were created by inserting overlapping PCR fragments into correspondingly digested pC-SARS-S and pC-SARS2-S, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-SARS-S-CT4K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S-CT4K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CHIKV and RRV 6K mutants (pC-CHIKV-6K-2K/R and pC-RRV-6K-2K/R), in which the 6K region’s cytoplasmic lysine residues at positions 37/44 were mutated to arginine residues, were created by inserting overlapping PCR fragments into correspondingly digested pC-CHIKVe and pC-RRVe, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-CHIKV-6K-2K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRV-6K-2K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, the E2 mutants of CHIKV and RRV (pC-CHIKVe-E2-K/R or pC-RRVe-E2-K/R), in which E2’s C-terminal lysine residues at positions 422 and 394 were mutated to arginine residues, were created by inserting overlapping PCR fragments into correspondingly digested pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-CHIKVe-E2-K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-E2-K/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The C-terminally T7-epitope–tagged wild-type and its mutant expression plasmids of RABV-G (pC-RABVg-T7e and pC-RABVg-CT3K/R-T7e), LCMV-GP (pC-LCMVgp-T7e and pC-LCMVgp-CT6K/R-T7e), SARS-CoV-S (pC-SARS-S-T7e and pC-SARS-S-CT4K/R-T7e), SARS-CoV-2-S (pC-SARS2-S-T7e and pC-SARS2-S-CT4K/R-T7e), CHIKVe3-E2-6K-E1 (pC-CHIKVe-T7e, pC-CHIKVe-6K-2K/R-T7e, and pC-CHIKVe-E2-K/R-T7e), and RRVe3-E2-6K-E1 (pC-RRVe-T7e, pC-RRVe-6K-2K/R-T7e, and pC-RRVe-E2-K/R-T7e) were created by replacing the VSV-G gene of pC-VSVg-T7e (Zhang et al., 2020) with the corresponding PCR-amplified fragments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RABVg-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp-CT6K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS-S-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS-S-CT4K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S-CT4K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-6K-2K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-E2-K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-6K-2K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-E2-K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-VSVg-T7e</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect ubiquitinated CHIKV-E2 proteins by immunoprecipitation assays, WT or E2-K/R mutant plasmids expressing CHIKV E3-E2-6K-E1, in which the T7 epitope-tag is inserted immediately downstream of a furin-cleavage site between E3 and E2, were created by inserting overlapping PCR fragments that harbor a T7e sequence into correspondingly digested pCAGGS and were designated pC-CHIKVe-T7eE2, pC-CHIKVe-T7eE2-K/R, pC-RRVe-T7eE2, and pC-RRVe-T7eE2-K/R, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RRVe-T7eE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-T7eE2-K/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virion infectivity assays: To prepare various viral envelope-pseudotyped HIV-1 luciferase reporter viruses, 1.1 × 105 293T cells were cotransfected with increasing amounts of the MARCH8 expression plasmid, 20 ng of viral envelope expression plasmid (pC-VSVg, pC-RABVg, pC-LCMVgp, pC-SARS-S, pC-SARS2-S, pC-CHIKVe, pC-RRVe, and their mutants), 500 ng of pNL-Luc2-IN/HiBiT-E(-)Fin, and an empty vector up to 1 μg of total DNA using FuGENE 6 (Promega).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-VSVg</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RABVg</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL-Luc2-IN/HiBiT-E(-)Fin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, 2.2 × 104 293T cells transiently coexpressing ACE2 and TMPRSS2 (using pC-ACE2 and pC-TMPRSS2) were incubated with 1 ng of p24 antigen of either SARS-CoV-S- or SARS-CoV-2-S-pseudotyped luciferase reporter lentiviruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence microscopy: HOS cells were plated on 13-mm coverslips, cotransfected with 0.5 μg of pC-xx-T7e (xx: RABV-G, RABV-G-CT3K/R, LCMVgp, LCMVgp-CT6K/R, SARS-S, SARS-S-CT4K/R, SARS2-S, SARS2-S-CT4K/R, CHIKVe, CHIKVe-6K-2K/R, CHIKVe-E2-K/R, RRVe, RRVe-6K-2K/R, or RRVe-E2-K/R), 0.1 μg of pC-GagPol-RRE, 0.05 μg of pCa-Rev, and 0.3 μg of either the HA-MARCH8 expression plasmid or an empty control using FuGENE6, and cultured for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-xx-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HA-MARCH8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ubiquitination assays: 293T cells (5 × 105) were cotransfected with 0.8 μg of pC-RABVg-T7e, pC-RABVg-CT3K/R-T7e, pC-CHIKVe-T7eE2, or pC-CHIKVe-T7eE2-K/R; and 0.2 μg of pC-HA-MARCH8 or an empty control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RABVg-CT3K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-T7eE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-T7eE2-K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-HA-MARCH8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Column graphs that combine bars and individual data points were created with GraphPad Prism version 9.10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.20.440588
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.21.440833

1
1. sciscore 24 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.21.440833: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-acetyl lysine antibody was purchased from ImmuneChem.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-acetyl</div><div>suggested: (ImmuneChem Cat# ICP0380, RRID:AB_2801477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SUPT16H, anti-SSRP1, anti-TIP60, anti-IFI16, anti-MX1, anti-ISG15, anti-GAPDH and normal mouse IgG antibodies were purchased from Santa Cruz Biotechnology.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SUPT16H,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SUPT16H</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SSRP1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TIP60</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFI16</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MX1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ISG15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-BRD4 antibody was purchased from Bethyl Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-BRD4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-FLAG, anti-V5, and normal rabbit IgG antibodies were purchased from Invitrogen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-K48Ub, anti-histone H3, anti-mouse HRP-linked and anti-rabbit HRP-linked antibodies were purchased from Cell Signaling Technology.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-K48Ub, anti-histone</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-K48Ub, anti-histone H3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-histone</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit HRP-linked antibodies were purchased from Cell Signaling Technology.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-HDAC1 antibody was purchased from Novus Biologicals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-HDAC1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-H3K9me3, anti-H3K27me3, anti-H3ac (pan-acetyl), and anti-EZH2 antibodies were purchased from Active Motif.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-H3K9me3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-H3K27me3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-H3ac</div><div>suggested: (Millipore Cat# 06-599, RRID:AB_2115283)</div></div><div style="margin-bottom:8px"><div>anti-EZH2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PE/Cyanine7 anti-human CD107a (LAMP-1), PE anti-human IFNγ and anti-IL-6 antibodies were purchased from BioLegend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE/Cyanine7 anti-human CD107a</div><div>suggested: (BioLegend Cat# 328618, RRID:AB_11147955)</div></div><div style="margin-bottom:8px"><div>anti-human CD107a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IFNγ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IL-6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-flavivirus group antigen antibody that probes ZIKV E protein and anti-SARS-CoV-1/2 NP 1C7C7 antibody was purchased from Sigma-Aldrich.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-flavivirus group antigen</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-1/2 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-influenza A virus nucleoprotein (NP) antibody was obtained from BEI Resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-influenza A virus nucleoprotein (NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-IL-4, anti-IL-8, and FITC Mouse anti-rat IgG1 antibodies was purchased from BD Biosciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-IL-4,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-IL-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IL-8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rat IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine acetylation, ubiquitination, and other protein binders of the targeted proteins, cell lysates were incubated with the specific antibodies recognizing the targeted proteins or control IgG, followed by the incubation with protein A/G magnetic beads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>control IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and plasmids: HEK293T, HeLa, Vero E6, and TZM-bl cells were maintained in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div><div style="margin-bottom:8px"><div>TZM-bl</div><div>suggested: NIH-ARP Cat# 8129-442, RRID:CVCL_B478)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat cells were maintained in RPMI 1640 medium (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa or A549 cells were seeded at the density of 8,000 cells/well on 96-well culture plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, K562 target cells were pre-stained with the CellTrace™ CFSE Cell Proliferation Kit (Invitrogen) according to the manufacturer’s protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: NCI-DTP Cat# K-562, RRID:CVCL_0004)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 × 106 NK-92 cells were co-cultured with the same number of K562 cells (1 : 1 of effector : target [E : T] ratio) for 4 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NK-92</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, Vero E6 cells were seeded on 96-well plates with 1 × 104 cells/well at 24 h prior to viral infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four domains of SUPT16H, NTD, DD, MD and CTD, were cloned in pQCXIP (Clontech) with a N-terminal FLAG tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQCXIP</div><div>suggested: RRID:Addgene_15714)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Site-specific mutation of K674R was introduced in pQCXIP-FLAG-MD by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQCXIP-FLAG-MD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TIP60 shRNA (5’-TCG AAT TGT TTG GGC ACT GAT-3’) and firefly luciferase (FLuc) shRNA (5’-CAC AAA CGC TCT CAT CGA CAA G-3’) were cloned in a pAPM lentiviral vector as previously described (Huang et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAPM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">cis-reporting vectors of IFN activity, pISRE-Luc and pGAS-Luc, were purchased (Agilent Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pISRE-Luc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HDAC1 was cloned in pcDNA-DEST40 with a C-terminal V5 tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA-DEST40</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pLX317-EZH2-V5 expression vector was acquired from Sigma-Aldrich.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLX317-EZH2-V5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 72 h post-transfection, cells were further transfected with pISRE-Luc or pGAS-Luc vector along with pRL-TK by using the TurboFect™ Transfection Reagent (Thermo Scientific) for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGAS-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRL-TK</div><div>suggested: RRID:Addgene_11313)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The intensity of protein bands was quantified by using the ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentages of virus-infected cells was quantified by using the Gen5 Image+ software (BioTek).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5 Image+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression of genes was analyzed by DESeq2 (Love et al., 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R packages, pheatmap and clusterProfiler, were used for heatmap construction and pathway analysis, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MFI was calculated by using the FlowJo V10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were presented as either means ± standard deviation (SD) or means ± standard error of the mean (SEM), and graphed by using the GraphPad Prism 9.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.21.440833
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.18.440302

1
1. sciscore 24 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.18.440302: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Study approval: Animal experiments involving SARS-CoV-2 were conducted in a BSL3 facility and treatment of animals was in accordance with regulations outlined in the U.S. Department of Agriculture (USDA) Animal Welfare Act and the conditions specified in the Guide for Care and Use of Laboratory Animals (National Institute of Health, 2011).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Homozygous female outbred K18-hACE2 transgenic mice (2B6.Cg-Tg(K18-ACE2)2Prlmn/J, Stock No: 034860, Jackson laboratory) 6-8 weeks old were maintained at 20-22°C with relative humidity of 50 ± 10% on a 12hrs light/dark cycle.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were randomly assigned to experimental groups of 7-8 mice per group.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified anti-DYKDDDDK Tag Antibody (Cat#637302, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DYKDDDDK</div><div>suggested: (BioLegend Cat# 637302, RRID:AB_1134268)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following secondary antibodies were used: Alexa Fluor 647-conjugated Goat Anti-Rabbit IgG (Cat#111-606-144, Jackson ImmunoResearch Laboratories)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 111-606-144, RRID:AB_2338083)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards, cells were washed in FACS buffer and stained with Alexa Fluor 647-conjugated anti-human IgG secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed, and an Alexa Fluor 647 Anti-Mouse IgG secondary antibody was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of 293T-Spike cells: First, 293T cells were grown overnight in 6-well plates (2.2X105 cells/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 293T-ACE2 cells lysate was prepared and 10 ug of it was incubated with RBD-Ig according to the manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cell monolayers were washed once with DMEM and 200µl of each dilution of protein-virus mixture was added in triplicates for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera were diluted to 1:500, 1:1K, 1:5K, 1:10K per well and added to 50,000 293T-Parental cells or 293T-Spike cells in a 96-U-well plate for 1 hour at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-Parental</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blocking with mice sera: Sera from the various immunized mice groups was diluted to 1:100 per well and added to 50K 293T-Parental cells or 293T-Spike cells in a 96-U-well plate for 1 hour at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-Spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The flag-tagged ACE2 was cloned into the plasmid pHAGE-DsRED(-) GFP(+).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-DsRED(-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a control we performed the same co-transfection but with the VSV-G envelope plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis were performed using either Prism 8 (GraphPad) or Excel (Microsoft).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.18.440302
comicsandthecanon.wordpress.com comicsandthecanon.wordpress.com

Dwayne McDuffie – Comics and The Canon

78
1. DylanKelly15 23 Apr 2021
  
  in Public
  
  ideological dichotomy
  
  This is defined as a sharp division of things or ideas into two contradictory parts.
2. Mrivera 22 Apr 2021
  
  in Public
  
  “It’s a lot easier to pull yourself up by your bootstraps, Mr. Man, if you already know how to fly!”
  
  One can draw parallels to DuBois telling Washington that he would be considered privileged due to the fcat that he can be considered part of the "Top Tenth" because of his education and connections.
3. Mrivera 22 Apr 2021
  
  in Public
  
  When you can fly, there’s no burden you can’t bear. When you can fly, gravity can’t touch you. When you can fly, you can do anything”.
  
  This reminds me of the ongoing metaphor in "Jubilee" of the slaves being cage birds. So with Augustus him having education, him being a free man, it gives him the ability to fly like a bird. Much like the age old saying the "the skies the limit".
4. Mrivera 22 Apr 2021
  
  in Public
  
  It limits the complexity and the roundedness of the characters
  
  Like he said there is not room to build a character, to have a struggle to have redemption arcs, because they are just meant to be a symbol because of the limited representation
5. Mrivera 22 Apr 2021
  
  in Public
  
  the reverberations of the 1992 Los Angeles riots
  
  The 1992 LA riots were caused because the LAPD had used excessive force in the arrest and beating of Rodney King, because of media it spread like wildfire.
6. Mrivera 22 Apr 2021
  
  in Public
  
  Dr. Martin Luther King Jr. and Malcolm X, and Ta-Nehisi Coates and Cornel West, to Nas and Jay-Z and Cam Newton and Colin Kaepernick
  
  These are all prominent black men, from social activists, to philosophers, to rappers and athletes.
7. Mrivera 22 Apr 2021
  
  in Public
  
  ignorant and inexperienced
  
  Perhaps this could be because of the fact he was born into slavery which is why he tends to lean more on realism and not idealism much like DuBois
8. Mrivera 22 Apr 2021
  
  in Public
  
  the contamination and death of the worst.
  
  What did DuBois mean by this, what could be the contamination be? Maybe the struggle the rest of black Americans had to face in society
9. Mrivera 22 Apr 2021
  
  in Public
  
  “Talented Tenth.”
  
  Its name is talented tenth because it is referencing the able ten percent of black Americans that developed leadership capacity from higher education
10. Mrivera 22 Apr 2021
  
  in Public
  
  Du Bois was a proponent of liberal arts education and argued for full civil rights for Black people
  
  This is why DuBois had become one of Washington's biggest opponents because he did not believe in a "sitting duck" method, wanting to create change not waiting to be accepted.
11. Mrivera 22 Apr 2021
  
  in Public
  
  the South that the Negro is given a man’s chance in the commercial world
  
  This is reminding me after the emancipation proclamation and after the civil war when the south was in a time of reconstruction, they had given freed slaves the ability to have land in the Midwest and begin their agricultural journey. Could this be in reference?
12. Mrivera 22 Apr 2021
  
  in Public
  
  Washington contended that the rights and privileges of true citizenship for Black people could only be gained through gradual struggle and the development of marketable skills.
  
  I see Washington's philosophy as a form of assimilation and conformity to American society and to gradually comfort those with a negative view of black people.
13. Mrivera 22 Apr 2021
  
  in Public
  
  Educator Booker T. Washington was born into the institution of American chattel slavery.
  
  This plays a role in why Washington's philosophy is what it is
14. Mrivera 22 Apr 2021
  
  in Public
  
  The ideological dichotomy
  
  This just meaning the system of division of black and white Americans that many believed (and still do) believe in
15. Mrivera 22 Apr 2021
  
  in Public
  
  “The Negro Problem,”
  
  This being to fix the societal gap between black people and white people
16. VONGHIA 21 Apr 2021
  
  in Public
  
  “The Talented Tenth,”
  
  The Talented Tenth is a term that designated a leadership class of African descendant Americans in the early 20th century
17. VONGHIA 21 Apr 2021
  
  in Public
  
  Washington emphasizes the importance of achieving Black prosperity
  
  He urged blacks to accept discrimination for the time being and concentrate on elevating themselves through hard work and material prosperity
18. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  changing his identity to be the son, grandson, and great-grandson of Augustus Freeman I.
  
  Represents how racial injustice continued throughout several generations just taking on various forms and altercations as time passed.
19. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  a Black man who seeks to destroy the organization he once supported after he realizes their supposed Black outreach is actually a form of Black subjugation,
  
  Somewhat represents the idea of double-consciousness and even Washington, when he funded Jim Crow opposing organizations and Black newspapers.
20. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  Martin Luther King Jr. and Malcolm X
  
  2 other figures with differing views but within the civil rights movement period. MLK advocated for confrontational and peaceful protests such as marches, boycotts, and sit-ins, while Malcom X promoted more violent approaches such as riots.
21. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  While “The Atlanta Compromise” doesn’t directly critique Du Bois, Du Bois’s response deliberately excoriates Booker T. Washington’s stance.
  
  Just as the poem we had to annotate as well, Washington speaks his views first, and Du Bois follows with his rebuttal.
22. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  He deemed agitation and civil unrest for the sake of social equality to be “the extremest [sic] folly,”
  
  Since Washington was born a slave, it's easier to understand why he has such views. He was born into an oppressive system and may not see a light at the end of the tunnel that Du Bois saw in which protesting for reform would bring him closer to.
23. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  higher education
  
  One of the common grounds shared between Washington and Du Bois, both were highly-educated individuals.
24. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  a co-founder of the National Association for the Advancement of Colored People.
  
  My Harlem Renaissance figure, Ida B. Wells, was also a founder of the NAACP.
25. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  “The Atlanta Compromise,”
  
  Washington was tasked with the objective to publicly speak to a majority-white crowd upon race relations and justice.
26. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  Educator Booker T. Washington was born into the institution of American chattel slavery.
  
  Washington was born into slavery, which Du Bois was not. This differing factor could contribute to their differing views concerning the strive for racial equality.
27. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  The debate over the best sociopolitical direction for African Americans not only crosses over to different generations but also crosses over to different forms of media.
  
  Refers to the various approaches to obtain racial equality presented from 2 different advocates. This problem has spread over generations and media outlets upon national coverage.
28. MERCEDESZINN 21 Apr 2021
  
  in Public
  
  in doing so often found many of their solutions standing in stark contrast to the ideas of their fellow Black intellectuals and activists.
  
  Introduction to the differing ideologies between activists Washington and Du Bois
29. lilyking1103 21 Apr 2021
  
  in Public
  
  Freeman initially turns down Raquel’s request, and suggests that she and the other Black people of Dakota should pull themselves up by their own bootstraps, to which Raquel replies, “It’s a lot easier to pull yourself up by your bootstraps, Mr. Man, if you already know how to fly!”
  
  I personally think this is commentary on white privilege. Freeman doesn't see how difficult it is for Raquel, because he is born with a privilege that Raquel doesn't have.
30. lilyking1103 21 Apr 2021
  
  in Public
  
  Augustus ages far slower than humans, allowing him to have lived through many major moments in American history
  
  This gives the writer an opportunity to talk about different events that have effected the black community.
31. lilyking1103 21 Apr 2021
  
  in Public
  
  “Golden Age” of hip-hop combined with the reverberations of the 1992 Los Angeles riots to create an atmosphere of interracial conflict, cultural celebration, and sociopolitical tension
  
  Black culture became more and more a part of American culture. The social movements highly influenced American culture.
32. lilyking1103 21 Apr 2021
  
  in Public
  
  His belief in access to liberal arts higher education stemmed from a belief in the potential for the Black intellectual elite to lead the race to prosperity and equality.
  
  More education would mean more opportunities for black people to get involved in politics and law discussions.
33. lilyking1103 21 Apr 2021
  
  in Public
  
  “W.E.B.” Du Bois once supported Washington’s sociopolitical approach before becoming one of its, and his, strongest and loudest opponents
  
  This shows how as people do more research and look from different perspectives, their way of thinking can change.
34. lilyking1103 21 Apr 2021
  
  in Public
  
  rather than seek access and opportunity through protest and civil unrest:
  
  It has been shown in history time and time again that the only way to get equal opportunities and rights is through protest, unrest, and fighting back.
35. lilyking1103 21 Apr 2021
  
  in Public
  
  Washington contended that the rights and privileges of true citizenship for Black people could only be gained through gradual struggle and the development of marketable skills.
  
  He believed that in order for white people to get on the bandwagon of giving black people rights, they had to prove their effect on the economy.
36. lilyking1103 21 Apr 2021
  
  in Public
  
  sociopolitical ideology and set of educational aspirations are best for the collective African American population.
  
  He gave a new way of looking and thinking about this discourse.
37. lilyking1103 21 Apr 2021
  
  in Public
  
  most notable rendering of the debate between Booker T. Washington and W.E.B. Du Bois is in Milestone Media’s Icon written by Dwayne McDuffie and illustrated by MD Bright.
  
  Uses a different type of medium to confront the discourse between these two leaders.
38. lilyking1103 21 Apr 2021
  
  in Public
  
  Booker T. Washington and Du Bois respectively.
  
  They had very different ideas of how to solve the racial issues in America.
39. lilyking1103 21 Apr 2021
  
  in Public
  
  solutions standing in stark contrast to the ideas of their fellow Black intellectuals and activists.
  
  There were many ways Black Activists went about trying to fix this problem. Such as accommodating, fighting for equal rights, or just straight up leaving.
40. lilyking1103 21 Apr 2021
  
  in Public
  
  Generations of Black writers and thinkers have taken to the task of solving what was coined “The Negro Problem,”
  
  The Negro Problem refers to the separation of Black People from American Culture.
41. VONGHIA 20 Apr 2021
  
  in Public
  
  The Negro Race, like all races, is going to be saved by its exceptional men. The problem of education then, among Negroes, must first of all deal with the “Talented Tenth.”
  
  Educating the best minds of the race disseminates into the rest, allowing the general uplift of all.
42. VONGHIA 20 Apr 2021
  
  in Public
  
  The Negro Problem
  
  It covers law, education, disenfranchisement, and Black Americans' place in American society.
43. Brandem25 20 Apr 2021
  
  in Public
  
  Raquel’s youthful perspective most often wins over Augustus whose once-immutable opinions are made malleable after learning more about the current condition of Black people in Dakota.
  
  Just like in irl, Raquel just like Dubois wins over people when faced with the truth concerning the problems of always abiding and assimilating in society.
44. Brandem25 20 Apr 2021
  
  in Public
  
  Icon provides a take on the generations-old debate that incorporates a popular medium the blends prose with sequential art.
  
  It incorporates the debates between Booker and Dubois but to a more modern audience to interpret
45. Brandem25 20 Apr 2021
  
  in Public
  
  Raquel’s final words are enough to change Augustus’s mind, and he agrees to their becoming Icon and Rocket.
  
  This shows the shift in ideas as Dubois Ideas became the center part for a lot of other black activist that came after him, such as MLK and Malcolm X
46. Brandem25 20 Apr 2021
  
  in Public
  
  underground railroad during slavery, fights for the Union in the Civil War, graduates from Fisk University during Reconstruction, lives in Harlem during the Renaissance, becomes an expatriate in France in the 1930s, and fights with the Allies is WWII.
  
  This in context helps young black kids understand the history with African involvement in America
47. Brandem25 20 Apr 2021
  
  in Public
  
  . Unlike Superman, whose similar origin puts him in the present-day Kansas farm of two loving white parents, the Milestone alien crash lands on a southern plantation in 1839.
  
  Contrast both characters as Superman landed in a happy time without any conflict in Kansas, while In Milestone, Icon lands in a southern planation where the brutal reality of slavery is taking place and mistreatment of blacks is the norm.
48. Brandem25 20 Apr 2021
  
  in Public
  
  music, politics, and energy of its time and indefatigably dedicated to authentic depictions of Blackness.
  
  Show that young black people can relate to characters with their culture and be able to see themselves with what they might not always get with other super heroes.
49. Brandem25 20 Apr 2021
  
  in Public
  
  increasing authentic representation of people of color
  
  At the time many of the times most famous pronounced super heroes were all white. With Captain America, Superman, and Batman to name a few.
50. Brandem25 20 Apr 2021
  
  in Public
  
  It limits the complexity and the roundedness of the characters.
  
  That solely writing a character to depict blacks also does no justice to the character as it makes the character bland, so therefore why he creates characters with complexity and with the character being black, it helps the black community in the long run as it does not show stereotypes nor have a white washing effect.
51. Aaron03 20 Apr 2021
  
  in Public
  
  Hughes’s essay delivers a lesson
  
  To teach that the black community can do anything no matter there skin religion and or gender
52. Brandem25 20 Apr 2021
  
  in Public
  
  monolithic depiction of Black people and Black culture
  
  Monolithic meaning not open to new ideas and remaining with the same old stereotypes and depictions of blacks in the past.
53. Aaron03 20 Apr 2021
  
  in Public
  
  With a focus on increasing authentic representation of people of color, Milestone Media created a world of splash pages and panels that is both inextricably bound to the music, politics, and energy of its time—much like the Black Arts Movement
  
  This site is here to help the Black community get more involved in poetry and music and other jobs that we may think only white people run
54. Aaron03 20 Apr 2021
  
  in Public
  
  “My problem—and I’ll speak as a writer now—with writing a black character in either the Marvel or DC universe is that he is not a man. He is a symbol. Like Wonder Woman—if you write Wonder Woman, she is all women
  
  I agree with this not a lot of people go out and say my favorite hero is Wonder woman or my favorite hero is Black panther. I think we need more male black hero's
55. Aaron03 20 Apr 2021
  
  in Public
  
  felt the paucity of characters of color, queer characters, and women characters within American comics needed to be addressed
  
  We need more hero's that are of different origin's I know of a few hero's that are black (Black Panther, Storm, and cyborg just to name a few.
56. Brandem25 20 Apr 2021
  
  in Public
  
  characters of color, queer characters, and women characters within American comics needed to be addressed.
  
  All of these things being prevalent as there was still issues with women rights, gays being shamed , and blacks still being discriminated and stereotyped.
57. Aaron03 20 Apr 2021
  
  in Public
  
  Black artist downtown became more and more isolated from that so-called ‘mainstream’ by the growing need to fully express [their] soul and mind connection with Black struggle in [their] art and in the street”.
  
  Shows me that black artists are dying down which isn't a good thing
58. Brandem25 20 Apr 2021
  
  in Public
  
  Cam Newton and Colin Kaepernick
  
  Here I see Cam Newton abiding by the NFL therefore assimilating to the white audience, while I see Colin Kaepernick using his freedom of speech to voice his opinions on black lives
59. Brandem25 20 Apr 2021
  
  in Public
  
  Martin Luther King Jr. and Malcolm X
  
  MLK taking the civil approach with civil protest, and Malcom X taking the violent riot approach of demanding rights now
60. Aaron03 20 Apr 2021
  
  in Public
  
  If white people are pleased we are glad.
  
  To me you shouldn't do something just to please someone do it because you like to do it
61. Brandem25 20 Apr 2021
  
  in Public
  
  confines of society.
  
  What I don't get is that if he came from a child hood where he was a slave and saw the impossible happen being the freedom of slaves, why not continue the ambitions of the slaves but instead continue to fight for their right stop be actually equal instead of being free, but confined by white society.
62. Aaron03 20 Apr 2021
  
  in Public
  
  Be stereotyped, don’t go too far, don’t shatter our illusions about you, don’t amuse us too seriously. We will pay you,’ say the whites.”
  
  Shows me that the whites don't understand where this young poet is coming from and now yawl want to be nice to him just doesn't make sense
63. Brandem25 20 Apr 2021
  
  in Public
  
  lack race should be to obtain marketable skills within the current confines of society.
  
  I can see why Booker T says this because after all he was a slave, when coming from an upbringing like that, all anybody would want is to just live life like how society already is instead of giving in for hope for change that might never come.
64. Aaron03 20 Apr 2021
  
  in Public
  
  The Negro artist works against an undertow of sharp criticism and misunderstanding from his own group and unintentional bribes from the whites.
  
  People are gonna hate you for what you do and that's the truth I make music and not everyone likes it but I'm still standing tall
65. Brandem25 20 Apr 2021
  
  in Public
  
  higher education
  
  Ironic how Booker T was the first one to set up a school for high education, which eventually led to Dubois getting his education and being Booker T biggest opponents.
66. Aaron03 20 Apr 2021
  
  in Public
  
  no great poet has ever been afraid of being himself
  
  This is true through everything like being a song writer don't be someone your not just because a certain crowd doesn't follow you be yourself and your time will come
67. Aaron03 20 Apr 2021
  
  in Public
  
  the young poet tells Hughes that he wants to be “a poet—not a Negro poet,” which Hughes takes to mean that, at best, the young poet seeks to downplay his race
  
  This shows me that this young poet doesn't believe in his race it shows me he is less confident about his race.
68. Brandem25 20 Apr 2021
  
  in Public
  
  founded for the higher education of African Americans.
  
  He wants blacks to accommodate yet founded a school for high education for African Americans, that clearly goes against what many whites think of about black people. In my opinion contradicts his own statement.
69. Brandem25 20 Apr 2021
  
  in Public
  
  After emancipation
  
  The order that gave freedom to slaves in 10 states during the civil war.
70. Brandem25 20 Apr 2021
  
  in Public
  
  provided them rather than seek access and opportunity through protest and civil unrest:
  
  This is where I would disagree with him, as not seeking for opportunity in itself is already bad advice as given an opportunity one should take it.
71. Brandem25 20 Apr 2021
  
  in Public
  
  A proponent of vocational education for Blacks, Washington contended that the rights and privileges of true citizenship for Black people could only be gained through gradual struggle and the development of marketable skills.
  
  This proves how Booker T Washington was living a double consciences, by living his life out but also pertaining to his white counterparts.
72. Brandem25 20 Apr 2021
  
  in Public
  
  over-century-old discourse
  
  pre civil war and post civil war
73. Brandem25 20 Apr 2021
  
  in Public
  
  The debate over the best sociopolitical direction for African Americans not only crosses over to different generations but also crosses over to different forms of media.
  
  This pertains with the many different activist with all differing views from one another
74. Brandem25 20 Apr 2021
  
  in Public
  
  civil disobedience
  
  With Civil disobedience I think of Martin Luther King
75. Brandem25 20 Apr 2021
  
  in Public
  
  reactive aggression
  
  Malcolm X
76. Brandem25 20 Apr 2021
  
  in Public
  
  isolation
  
  This being Dubois
77. Brandem25 20 Apr 2021
  
  in Public
  
  assimilation
  
  This being Booker T. Washington idea
78. Brandem25 20 Apr 2021
  
  in Public
  
  in doing so often found many of their solutions standing in stark contrast to the ideas of their fellow Black intellectuals and activists.
  
  The disputes between ideologies, such as Dubois and Booker T, with Dubois arguing for having his rights and equality now VS Booker wanting to accommodate.
Visit annotations in context

Annotators

VONGHIA

Mrivera

DylanKelly15

lilyking1103

Brandem25

MERCEDESZINN

Aaron03

URL

comicsandthecanon.wordpress.com/tag/dwayne-mcduffie/
developer.mozilla.org developer.mozilla.org

HTML basics

1
1. BidenIsPresident 23 Apr 2021
  
  in Public
  
  Some elements have no content and are called empty elements
  
  Which elements won't have a closing tag ? A possible answer might be elements that dont have any content. for example, img.
Visit annotations in context

Annotators

BidenIsPresident

URL

developer.mozilla.org/en-US/docs/Learn/Getting_started_with_the_web/HTML_basics
twitter.com twitter.com

Twitter

2
1. NIKOLEAMORES_24 23 Apr 2021
  
  in Public
  
  The FBI said it has stopped using the "Black Identity Extremist" tag and acknowledged that white supremacist violence is the biggest terrorist threat this country faces.
  
  The way she looks at the audience to give the information is so powerful. The FBI took a big step to recognize what has been denied for years
  
  weblit LS121FA
2. janettt 22 Apr 2021
  
  in Public
  
  The FBI said it has stopped using the "Black Identity Extremist" tag and acknowledged that white supremacist violence is the biggest terrorist threat this country faces.
  
  I really love this because it seems very powerful just by the start
Visit annotations in context

Tags

weblit

LS121FA

Annotators

janettt

NIKOLEAMORES_24

URL

twitter.com/chribreuer
www.popsci.com www.popsci.com

The Real Cost Of NASA Missions

1
1. 27AnthonyK 21 Apr 2021
  
  in Public
  
  That money gets spread out over many different projects. So even though the Curiosity rover had an astounding $2.6 billion price tag, each citizen only paid about about $0.41 per year to put the SUV-sized robot on Mars.
  
  I don't think "each" civilian paid for this rover because there has to be at least a few hundred people who did not pay.
Visit annotations in context

Annotators

27AnthonyK

URL

popsci.com/real-cost-nasa-missions/
scalar.usc.edu scalar.usc.edu

Krystyna: Sbobet88 | Judi Bola | Agen Bola | Agen Sbobet | Situs Judi Online | Sbobet Online

1
1. kapolreskendari 20 Apr 2021
  
  in Public
  
  Kapolres Kendari Ciptakan Group Facebook untuk Jalin Silaturahmi
  
  Media sosial saat ini benar benar sudah menjadi dunia kedua bagi para penggunanya, dalam sebuah indicator beberapa platform sistem informasi , media sosial sudah menjadi sebuah barometer informasi dan juga sebagai ajang curhat bagi para penggunanya. Seperti halnya Facebook, Semua pengguna media sosial pasti mengenal nama Facebook walaupun tidak semuanya menyukai platform yang satu ini. Facebook dikenal sebagai platform media sosial yang paling banyak digunakan di indonesia dan sangat banyak sekali peminatnya, selain mudah dalam penggunaan , facebook juga dikenal sebagai paltform yang mempunyai banyak manfaat, salah satunya adalah Fanpage dan Facebook Group. Kapolres Kendari yang saat ini dijabat oleh AKBP Didik Erfianto S.IK , juga memanfaatkan Platform Facebook Group, berdasarkan pantauan Group Facebook yang mempunya nama POLISI KENDARI ini sudah mempunyai ribuan member , di dalam group tersebut antara anggota polisi polres kendari saling membagikan informasi berupa tautan link dari sebuah website atau juga sebuah video. sehingga warga kendari dan juga masyarakat wilayah sultra tidak perlu lagi bingung jika ingin mencari informasi seputar kinerja Kepolisian Resort Kendari, karena setiap hari seluruh anggota Polres Kendari selalu membagikan informasi informasi terbaru. Beberapa komentar masyarat pada group tersebut terlihat jelas, bahwa inovasi atau strategi sederhana ini juga bisa digunakan sebagai ajang silaturohmi antara Anggota Polisi Kendari dan Warga Kendari. sehingga bisa mempersempit Hoaks atau berita berita bohong yang ada di wilayah kendari.
  
  Tidak cukup Sampai disitu Saja , Kapolres Kendari AKBP Didik Erfianto S.IK juga membuat sebuah Fanpage atau Halaman Facebook dengan nama Kapolres Kendari, dimana fanpage tersebut digunakan sebagai Admin dari group Facebook Polisi Kendari. Berdasarkan pantauan Fanpage Kapolres Kendari sangat Aktif, bahkan sekali posting kadang bisa mencapai Ratusan Ribu Reach Views atau jangkauan postingan pada fanpage tersebut. Dengan Strategi sederhana ini Kapolres Kendari berharap media sosial ini bisa digunakan sebagai ajang silaturohmi dan juga sebagai Viralisasi berita berita positif Kinerja Polisi Kendari
  
  https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/<br> https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info
  
  https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/<br> https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/<br> https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/<br> https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://www.kompasiana.com/bacasaja2670/607e0e0cd541df747d61c082/kapolres-kendari-ciptakan-group-facebook-untuk-jalin-silaturohmi https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/04/20/barometer-informasi-kapolres-kendari-gaungkan-fanpage-dan-facebook-group/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.co.id/2021/02/24/kapolres-kendari-terapkan-polri-presisi-puluhan-anggota-siap-jalani-tes-urin/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://tanyajawab.idntimes.com/pakarseo-surabaya/JuYnfMKavhycH0I/MwUfS016SK3OX58 https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/<br> https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/rekam-jejak-kapolres-kendari-akbp-didik-erfianto/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://tribrata-news.kendari.sultra.polri.go.id/topik/kapolres-kendari/ https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://www.kompasiana.com/tag/kapolres-kendari https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://bacasaja.info/2021/04/19/kapolres-kendari-silaturahmi-kamtibmas-ke-mui/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/ https://halodunia.co.id/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/<br> https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://halodunia.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/2021/04/19/kapolres-kendari-beri-arahan-dan-motivasi-kepada-para-kasi-humas/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/tag/kapolres-kendari/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.net/2021/04/19/kapolres-kendari-laksanakan-operasi-yustisi-secara-rutin-untuk-menekan-angka-covid-19/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/tag/kapolres-kendari/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.co.id/2021/04/16/kapolres-kendari-tindak-tegas-pelaku-balap-liar/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/ https://bacasaja.info/tag/kapolres-kendari/<br> https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5 https://tanyajawab.idntimes.com/baca-saja/H8NbevyDnvQQUS5<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/<br> https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://tribrata-news.kendari.sultra.polri.go.id/kapolres-kendari-release-ungkap-kasus-sabu-seberat-1-kg/ https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://halodunia.network/forum/kapolres-kendari-82205 https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://didikerfianto.com https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://bacasaja.today https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info https://pakarseo.info
Visit annotations in context

Annotators

kapolreskendari

URL

scalar.usc.edu/works/krystyna/sbobet88--judi-bola--agen-bola--agen-sbobet--situs-judi-online--sbobet-online-1
store.steampowered.com store.steampowered.com

Save 51% on Runes on Steam

1
1. TylerRick 20 Apr 2021
  
  in Public
  
  Game Saves After completion of each level
  
  The things that are important / worth mentioning to different people. I agree with this one.
  
  annotation meta: may need new tag everyone has different needs I agree
Visit annotations in context

Tags

annotation meta: may need new tag

I agree

everyone has different needs

Annotators

TylerRick

URL

store.steampowered.com/app/548050/Runes/
steamcommunity.com steamcommunity.com

Steam Community :: RE1GN :: Review for Sos i Pie Sos

1
1. TylerRick 20 Apr 2021
  
  in Public
  
  Been seeing this comment copy/pasted everywhere it's pathetic what people will do for thumbs up/awards on reviews, be original and make your own review. If you guys need proof go and look at NVL reviews, I saw it on another game a few weeks ago too.
  
  annoying
  
  annotation meta: may need new tag I agree unfortunate
Visit annotations in context

Tags

unfortunate

annotation meta: may need new tag

I agree

Annotators

TylerRick

URL

steamcommunity.com/profiles/76561198319741057/recommended/776960/
store.steampowered.com store.steampowered.com

Save 90% on Feel-A-Maze on Steam

2
1. TylerRick 20 Apr 2021
  
  in Public
  
  Like a lot of reviews I write, I hope to come back to add on to this and embellish.
  
  never done; keeps wanting to continue edit/update
  
  annotation meta: may need new tag
2. TylerRick 20 Apr 2021
  
  in Public
  
  Right now it's a matter of getting brass tacks up front and hopefully helping Feel-A-Maze get noticed.
  
  helping it gain attention/publicity
  
  annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

Annotators

TylerRick

URL

store.steampowered.com/app/333870/FeelAMaze/
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.09.439147

1
1. sciscore 16 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.09.439147: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PVDF membranes were treated with 6xHis Tag Monoclonal Antibody (3D5) HRP (Invitorogen, USA) for 6xHis-tagged proteins, and ANTI-FLAG M2-peroxidase (HRP)-conjugated</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>M2-peroxidase</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, serial diluted recombinant ACE2 (from 1 μg/ml to 0.06 μg/mL) (ab151852, abcam), subsequent rabbit anti ACE2 antibody (HPA000288, Atlas Antibodies) and HRP conjugated anti rabbit IgG (7074S, Cell signaling) were incubated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>subsequent rabbit anti ACE2 antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect K-874A binding to immobilized S protein, serial diluted K-874A (1 μg/ml to 0.002 μg/ml) in 1%BSA/PBS was incubated, and K-874A which bound to S protein was detected by HRP-conjugated anti VHH antibody (#128-035-232, Jackson immuno Research).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti VHH</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 binding on and early replication in Vero/TMPRSS2 cells: 2.5×104 TCID50 (MOI=50) of SARS-CoV-2 was incubated with 150 μg/ml of VHHs for 2 hours at 37°C and then 24 hours at 4°C and inoculated to 5.0×104 VeroE6/TMPRSS2 cells for an hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw Illumina paired-end reads that passed through the Q30 filter were merged using PEAR software [21].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PEAR</div><div>suggested: (PEAR, RRID:SCR_003776)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VHHs-encoding sequences were translated based on standard genetic code using MEGA X software [22].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Equal numbers of ZsGreen-HiBiT-expressing cells and LgBiT-expressing cells were plated on a 96-well plate (1603101, ThermoFisher Science).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Science</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Individual movies were subjected to per-frame drift correction by MotionCor2 [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The contrast transfer function parameters of each micrograph were estimated using CTFFIND4 [27] and the flowing 2D and 3D classification, 3D refinement, and local resolution calculation were performed with RELION3.1 software [28].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION3.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extracted density was used to generate the mask using “Mask creation” in RELION 3.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The homology models of K-874A, RBD and NTD were rigid-body-fitted into the map using the COOT [31] and then refined using PHENIX [32].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.09.439147
stackoverflow.com stackoverflow.com

Image width/height as an attribute or in CSS?

2
1. TylerRick 16 Apr 2021
  
  in Public
  
  It should be defined inline. If you are using the img tag, that image should have semantic value to the content, which is why the alt attribute is required for validation. If the image is to be part of the layout or template, you should use a tag other than the img tag and assign the image as a CSS background to the element. In this case, the image has no semantic meaning and therefore doesn't require the alt attribute. I'm fairly certain that most screen readers would not even know that a CSS image exists.
  
  I believed this when I first read it, but changed my mind when I read this good rebuttal: https://hyp.is/f1ndKJ5eEeu_IBtubiLybA/stackoverflow.com/questions/640190/image-width-height-as-an-attribute-or-in-css
  
  distinction: good explanation/rule for distinguishing good explanation semantic meaning HTML: images (<img>) CSS: images
2. TylerRick 16 Apr 2021
  
  in Public
  
  Neither question nor answer appears to understand the notion of semantic HTML. Height and width are presentational attributes regardless of where you put them. For semantics we establish what the image means to content in the alt tag. I don't remember why it was so important to width/height in the HTML but I suspect it was in case you hit browsers without CSS rendering. It's not a semantics issue. If anything it thwarts separation of concerns to a degree.
  
  claim: that the OP's question and this answer are incorrect
  
  Could we say that this answer (that this comment replies to) missed the point?
  
  I actually believed and thought this answer was spot on ... until I read this comment, and then I reversed my opinion.
  
  missed the point they were mistaken confident claims I agree changed their mind/opinion
Visit annotations in context

Tags

they were mistaken

missed the point

HTML: images (<img>)

I agree

CSS: images

good explanation

semantic meaning

distinction: good explanation/rule for distinguishing

changed their mind/opinion

confident claims

Annotators

TylerRick

URL

stackoverflow.com/questions/640190/image-width-height-as-an-attribute-or-in-css
zettelkasten.de zettelkasten.de

Introduction to the Zettelkasten Method • Zettelkasten Method

1
1. choppa1890 16 Apr 2021
  
  in Public
  
  t is necessary to make the actual lookup possible.
  
  With notion i could do a tag, or entry classifier
Visit annotations in context

Annotators

choppa1890

URL

zettelkasten.de/introduction/
www.metacritic.com www.metacritic.com

SPITLINGS

1
1. TylerRick 15 Apr 2021
  
  in Public
  
  and even though there are plenty of additional characters to unlock, they’re ultimately only cosmetic, providing no real incentive to unlock them all
  
  only cosmetic
  
  annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

Annotators

TylerRick

URL

metacritic.com/game/switch/spitlings
stackoverflow.com stackoverflow.com

Detect if stdin is a terminal or pipe?

2
1. TylerRick 14 Apr 2021
  
  in Public
  
  What you want is not to detect if stdin is a pipe, but if stdin/stdout is a terminal.
  
  The OP wasn't wrong in exactly the way this comment implies: he didn't just ask how to detect whether stdin is a pipe. The OP actaully asked how to detect whether it is a terminal or a pipe. The only mistake he made, then, was in assuming those were the only two possible alternatives, when in fact there is (apparently) a 3rd one: that stdin is redirected from a file (not sure why the OS would need to treat that any differently from a pipe/stream but apparently it does).
  
  This omission is answered/corrected more clearly here:
  
  stdin can be a pipe or redirected from a file. Better to check if it is interactive than to check if it is not.
  
  better ways of doing things annotation meta: may need new tag standard/text streams
2. TylerRick 14 Apr 2021
  
  in Public
  
  stdin can be a pipe or redirected from a file. Better to check if it is interactive than to check if it is not.
  
  better ways of doing things annotation meta: may need new tag
Visit annotations in context

Tags

better ways of doing things

annotation meta: may need new tag

standard/text streams

Annotators

TylerRick

URL

stackoverflow.com/questions/1312922/detect-if-stdin-is-a-terminal-or-pipe
simplicable.com simplicable.com

What is Dry Humor?

1
1. TylerRick 14 Apr 2021
  
  in Public
  
  Humor is based on a sense of the unexpected, inexplicable, ridiculous and ironic. Dry humor can enhance these qualities to make things more humorous. For example, humor that is delivered as if it were not a joke may feel more surprising and odd.
  
  theory
  
  enhances these qualities
  
  humor annotation meta: may need new tag dry/deadpan humor
Visit annotations in context

Tags

annotation meta: may need new tag

dry/deadpan humor

humor

Annotators

TylerRick

URL

simplicable.com/new/dry-humor
hypothes.is hypothes.is

Hypothesis

1
1. mrcolbyrussell 14 Apr 2021
  
  in Public
  
  I'm using this tag fo keep notes about the changes that need to be made now that Writefreely exists in its own organization on GitHub. See https://discuss.write.as/t/moving-the-writefreely-repo-on-github/2568
  
  write.as topic 2568
Visit annotations in context

Tags

write.as topic 2568

Annotators

mrcolbyrussell

URL

hypothes.is/search
www.osnews.com www.osnews.com

Command-line interactive programs in UNIX shell-scripts – OSnews

1
1. TylerRick 14 Apr 2021
  
  in Public
  
  By the way, the README file of the expect says there is a libexpect library that can be used to write programs on C/C++ which allows to avoid the use of TCL itself. But I'm afraid, this subject is beyond this article. Besides authors of expect themselves seem to prefer expect-scripts to the library.
  
  possible but doesn't seem preferred
  
  looking at what the authors themselves use
  
  annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

Annotators

TylerRick

URL

osnews.com/story/10929/command-line-interactive-programs-in-unix-shell-scripts/
en.wikipedia.org en.wikipedia.org

STREAMS - Wikipedia

1
1. TylerRick 14 Apr 2021
  
  in Public
  
  In this framework, a stream is a chain of coroutines that pass messages between a program and a device driver (or between a pair of programs)
  
  coroutines message passing
  
  annotation meta: may need new tag scripting: communicating with interactive programs inter-process communication
Visit annotations in context

Tags

annotation meta: may need new tag

scripting: communicating with interactive programs

inter-process communication

Annotators

TylerRick

URL

en.wikipedia.org/wiki/STREAMS
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.04.08.21254348

1
1. sciscore 14 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.08.21254348: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient selection, samples and Institutional Review Board permits: Experiments were carried out following the ethical principles established in the Declaration of Helsinki. Patients (or their representatives) were informed about the study and gave a written informed consent.<br>IACUC: Implications for therapeutic decision-making” approved by La Princesa Health Research Institute Research Ethics Committee (register # 4070) were used; samples and data from patients with severe vs mild disease were provided by the Biobank Hospital Universitario Puerta de Hierro Majadahonda (HUPHM)/Instituto de Investigación Sanitaria Puerta de Hierro-Segovia de Arana (IDIPHISA) (PT17/0015/0020 in the Spanish National Biobanks Network), they were processed following standard operating procedures with the appropriate approval of the Ethics and Scientific Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were stratified and randomly spliced into a training and a test set.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beads were incubated with either rabbit anti-His-tag antibody (Proteintech Group) or plasma from patients or healthy donors in a final volume of 50 μl in 96-well-plates (Nunc™ MicroWell™ 96-Well, Thermo Fisher Scientific) using the dilutions indicated in each experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To visualize antibody bound to antigen-coated beads, either PE-conjugated anti-rabbit antibody (0.25 μg/ml, Southern Biotech)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE-conjugated anti-rabbit antibody ( 0.25 μg/ml , Southern Biotech)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, PE-conjugated anti-human IgG and IgM, or FITC-conjugated anti-human IgA antibody (Immunostep S.L.) were added (30 μL/well) and incubated for 20 minutes at room temperature under agitation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant cDNAs coding for soluble S (residues 1 to 1208) and RBD (332 to 534) proteins were cloned in the pcDNA3.1 vector for expression in HEK-293F cells using standard transfection methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: To assess the prediction capacity of the new methodology, an algorithm was built using Scikit-learn python package [11] (code available on request).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparison between severe and mild patients in each variable was performed by multiple t-tests followed by False Discovery Rate (1%) correction by two-stage step-up method in Graph Pad Prism 8 Software (GraphPad Software, USA, www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  In addition to an impact on early classification of patients, current limitations in the availability of vaccine doses suggest a novel possible application for sensitive multi-antigen assays for SARS-CoV-2 seropositivity. It has been shown that the antibody response to the first vaccine dose in individuals with pre-existing immunity is comparable or greater to that observed in naïve individuals who have been immunized twice [17]. Screening of the unvaccinated population with an assay sufficiently sensitive to identify individuals previously infected despite waning of antibody titres over time, would allow these individuals to be given the vaccine as a single booster, sparing them from possible suffering and complications after a second dose, and freeing up many urgently needed vaccine doses to be given to individuals with no protection. The test described here would also provide comprehensive information to support selection of convalescent sera or plasma for therapeutic use. Our data indicate the importance of this multi-antigen, multi-isotype analysis to detect potential SARS-CoV-2 reinfections in vaccinated individuals and suggest a possible use in establishing alternative vaccine administration routes that may elicit more potent IgA responses. This multi-antigen and multi-Ig assay can be easily modified for detection of antibodies in other fluids as saliva and breast milk. It is also highly tunable to different research needs, including detection of different immunoglobul...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.04.08.21254348
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.08.438924

1
1. sciscore 14 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.08.438924: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells were routinely checked to confirm the absence of mycoplasma contamination.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound proteins were eluted from the beads using the elute buffer [25 mM Tris pH 8.0, 150 mM NaCl, 0.1% (w/v) DDM, 0.01% (w/v) CHS, and 250 ng/mL Flag peptide], and analyzed by immunoblotting using antibodies for the Strep tag (HuaxingBio, HX1816) or His tag (TransGen, HT501)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HT501</div><div>suggested: (Transgen Biotech Cat# HT501, RRID:AB_2801417)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were analyzed by immunoblotting using antibodies for the Flag tag (SIGMA, SLCD6338).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flag tag (SIGMA, SLCD6338</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: The HEK293T cell line was from EdiGene Inc., and Huh 7.5 cell line was from S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRISPRa screening for SARS-CoV-2 entry factors: The HEK293T cells were engineered to stably express the CRISPRa system including lenti dCAS-VP64_Blast and lenti MS2-P65-HSF1_Hygro vectors, termed as HEK293T-CRISPRa cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-CRISPRa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Strep-tagged S6P spike protein was expressed in the HEK293F cells and purified as described previously (50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO enrichment and expression pattern analysis: The Gene Ontology (GO) enrichment analysis of identified host factors (RRA score < 0.001) was performed using Metascape Resource (32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis of all data apart from CRISPRa screening was performed using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 10 and 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.08.438924
en.wikipedia.org en.wikipedia.org

Pseudoterminal - Wikipedia

1
1. TylerRick 14 Apr 2021
  
  in Public
  
  TTY is right there in the name, but this article makes no attempt to clarify what exactly the relationship between a pseudoterminal and a TTY. I feel like a whole paragraph about the relation to TTY would be warranted, including a link to TTY article, of course, which does link [back] to and explain some of the relation to pseudoterminal:
  
  In many computing contexts, "TTY" has become the name for any text terminal, such as an external console device, a user dialing into the system on a modem on a serial port device, a printing or graphical computer terminal on a computer's serial port or the RS-232 port on a USB-to-RS-232 converter attached to a computer's USB port, or even a terminal emulator application in the window system using a pseudoterminal device.
  
  cross-linking missed opportunity annotation meta: may need new tag what is the relationship between? pseudoterminal TTY
Visit annotations in context

Tags

what is the relationship between?

missed opportunity

pseudoterminal

cross-linking

annotation meta: may need new tag

TTY

Annotators

TylerRick

URL

en.wikipedia.org/wiki/Pseudoterminal
store.steampowered.com store.steampowered.com

Save 51% on LX Patterns on Steam

1
1. TylerRick 14 Apr 2021
  
  in Public
  
  A charming little romp through a realm of lateral thinking.
  
  lateral thinking
  
  annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

Annotators

TylerRick

URL

store.steampowered.com/app/1522710/LX_Patterns/
hypothes.is hypothes.is

Hypothesis

1
1. alisonmyers 14 Apr 2021
  
  in Public
  
  A note.
  
  tag
Visit annotations in context

Tags

tag

Annotators

alisonmyers

URL

hypothes.is/welcome/c99b7750934a895c
linusakesson.net linusakesson.net

The TTY demystified

1
1. TylerRick 13 Apr 2021
  
  in Public
  
  If you want to run a full fletched linux OS on the ipad an option is to jailbreak the ipad and try to install linux. This is hard because Apple does not want you to and a failed installation might render the ipad useless. Also you will not be able to run any iOS apps anymore obviously.
  
  new tag?: jailbreaking a device
  
  annotation meta: may need new tag bypassing technical constraints
Visit annotations in context

Tags

bypassing technical constraints

annotation meta: may need new tag

Annotators

TylerRick

URL

linusakesson.net/programming/tty/index.php
unix.stackexchange.com unix.stackexchange.com

bash - replace space with new line

1
1. TylerRick 13 Apr 2021
  
  in Public
  
  Although echo "$@" prints the arguments with spaces in between, that's due to echo: it prints its arguments with spaces as separators.
  
  due to echo adding the spaces, not due to the spaces already being present
  
  Tag: not so much:
  
  whose responsibility is it? but more: what handles this / where does it come from? (how exactly should I word it?)
  
  whose responsibility is it? important distinction annotation meta: may need new tag easy to falsely assume just because _; doesn't mean _
Visit annotations in context

Tags

just because _; doesn't mean _

annotation meta: may need new tag

whose responsibility is it?

easy to falsely assume

important distinction

Annotators

TylerRick

URL

unix.stackexchange.com/questions/105569/bash-replace-space-with-new-line
bugzilla.samba.org bugzilla.samba.org

3653 – Reduce the need for the "vanished files" warning

1
1. TylerRick 13 Apr 2021
  
  in Public
  
  Interesting to see how a simple request is actually a rather intricate little problem in the bigger scheme of things.
  
  an intricate piece of a larger system / problem / schema
  
  annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

Annotators

TylerRick

URL

bugzilla.samba.org/show_bug.cgi
git.samba.org git.samba.org

git.samba.org - rsync.git/summary

1
1. TylerRick 13 Apr 2021
  
  in Public
  
  Was trying to figure out where the canonical repo even is. Hard to figure out. Could be made clearer (like a prominent notice on one saying this is an unofficial clone with a link to the canonical source).
  
  Ended up here via link from https://unix.stackexchange.com/questions/86879/suppress-rsync-warning-some-files-vanished-before-they-could-be-transferred to https://git.samba.org/?p=rsync.git;a=blob_plain;f=support/rsync-no-vanished;hb=HEAD
  
  But then found https://github.com/WayneD/rsync, which I now believe to be canonical based on:
  
  last change here is Mon, 15 Mar 2021 09:35:39 -0700 (09:35 -0700) but on https://github.com/WayneD/rsync it was April 3.
  
  https://rsync.samba.org/bug-tracking.html links to: create an issue on GitHub
  
  canonical website not canonical version/location: which one is canonical? annotation meta: may need new tag canonical version/location
Visit annotations in context

Tags

canonical version/location

not

canonical website

canonical version/location: which one is canonical?

annotation meta: may need new tag

Annotators

TylerRick

URL

git.samba.org/
boardgamegeek.com boardgamegeek.com

Europhile reviews: A disappointment. | BoardGameGeek

3
1. TylerRick 13 Apr 2021
  
  in Public
  
  Strange that a game published in 2005 that is derivative of a classic would essentially get fired by its predecessor. I fail to see why I would ever play this instead of Carcassonne.
  
  annotation meta: may need new tag comparison
2. TylerRick 13 Apr 2021
  
  in Public
  
  You can't avoid the comparisons to Carcassonne even though the scoring mechanic is very different. It just looks the same, and the tile placement phase feels close enough to be familiar. However, this familiarity starts to nag at you, only adding to the frustration when tile placement is clumsy and luck-driven unlike Carcassonne. The comparison is not favourable for Fjords.
  
  games: too much luck well-written comparison annotation meta: may need new tag
3. TylerRick 13 Apr 2021
  
  in Public
  
  There is a tendency in short luck-heavy games to require you to play multiple rounds in one sitting, to balance the scores. This is one such game. This multiple-rounds "mechanic" feels like an artificial fix for the problem of luck. Saboteur 1 and 2 advise the same thing because the different roles in the game are not balanced. ("Oh, well. I had the bad luck to draw the Profiteer character this time. Maybe I'll I'll draw a more useful character in round 2.") This doesn't change the fact that you are really playing a series of short unbalanced games. Scores will probably even out... statistically speaking. The Lost Cities card game tries to deal with the luck-problem in the same way.
  
  possibly rename: games: luck: managing/mitigating the luck to games: luck: dealing with/mitigating the luck problem
  
  games: luck: managing/mitigating the luck annotation meta: may need new tag artificial fix treating/address the symptom rather than the underlying problem
Visit annotations in context

Tags

games: luck: managing/mitigating the luck

well-written

treating/address the symptom rather than the underlying problem

comparison

annotation meta: may need new tag

games: too much luck

artificial fix

Annotators

TylerRick

URL

boardgamegeek.com/thread/878971/europhile-reviews-disappointment
lagen.nu lagen.nu

Lag (2015:953) om kollektivtrafikresenärers rättigheter | Lagen.nu

1
1. oojiop5U 13 Apr 2021
  
  in Public
  
  Lag (2015:953) om kollektivtrafikresenärers rättigheter
  
  Kollektivtrafikresenärers rättigheter
  
  Lagen om kollektivtrafikresenärers rättigheter innehåller delar om tillgänglighet för personer med funktionsnedsättning. Lagen om kollektivtrafikresenärers rättigheter innehåller bestämmelser om reseinformation, ersättning och prisavdrag vid förseningar. Den innehåller också delar om att kunna säga upp periodbiljett vid resor i kollektivtrafik med tåg, spårvagn, tunnelbanetåg, buss och personbil. Enligt lagen har transportören en skyldighet att tillhandahålla information om en försening eller annan störning i trafiken och dess orsak, varaktighet och konsekvenser, resenärens rättigheter som finns i lagen transportörens allmänna avtalsvillkor, biljettpriser, tidtabeller och linjesträckningar, tillgänglighet till fordon, stationer och hållplatser, möjligheten att medföra cyklar och villkor för detta, säkerhets- och trygghetsfrågor hur transportören kan kontaktas. Information ska ges i den eller de former som är mest lämpliga för att resenärerna ska kunna ta del av informationen. Vid bedömningen av lämplig form ska särskild vikt läggas vid behoven hos personer med funktionsnedsättning. Konsumentverket har rätt att utfärda föreskrifter enligt lagen och har dessutom tillsynsansvar. Lag (2015:953) om kollektivtrafikresenärers rättigheter på riksdagens webbplats Senast granskad: 19 februari 2020 https://www.mfd.se/verktyg/lagar-och-regler-om-tillganglighet/transporter/kollektivtrafikresenarers-rattigheter/
Visit annotations in context

Annotators

oojiop5U

URL

lagen.nu/2015:953
markdangerchen.net markdangerchen.net

upton.aestheticofplay.ch2+3.pdf

1
1. zhaowenzuo 12 Apr 2021
  
  in Public
  
  But other constraints in the horizon of intent have no external ana-logues. I may avoid doing certain things not because they aren't possible or because they are against the rules, but because I know that they are tacti-cally unwise. I could stand still in the batter's box after getting a hit in base-ball; however, I don't, because t hat would make it easier for an opposing player to tag me out. I could run straight into the maw of a boss during a boss battle; however, I don't, because I know that would get my character killed. My horizon of intent is defined not just by what I believe I can do, but also by what I believe I should do-my internal strategic constraints.
  
  The strategy in the game is not only what you want to do, but also what you should do. Because there are rules in the game, we should understand what we should do while having our own ideas.
Visit annotations in context

Annotators

zhaowenzuo

URL

markdangerchen.net/courses/236/upton aestheticofplay ch2and3.pdf
www.biorxiv.org www.biorxiv.org

Allosteric communication in DNA polymerase clamp loaders relies on a critical hydrogen-bonded junction

1
1. Public_Reviews 12 Apr 2021
  
  in eLife
  
  Author Response:
  
  We thank the editors and the reviewers for their positive assessment of our work.
  
  Reviewer #1 (Public Review):
  
  [...] One major concern is that the levels of protein expression and folding are not verified. This is concerning for the Gln118 mutation because lack of fitness could result trivially from misfolding or accelerated degradation that might result from increased flexibility and conformational stability. Moreover, the authors' finding that it was not possible to purify Gln118 mutant proteins for biochemical studies is consistent with this sort of trivial explanation for apparent lack of biological function.
  
  As described in the manuscript, the sidechain of Gln 118 makes hydrogen bonds with the backbone segment leading into an adjacent helix. We had omitted to point out in the original manuscript that Gln 118 is completely buried in thestructure (we now do so in the revised manuscript, on page 29). As shown by Worth and Blundell, buried polar sidechains that form backbone hydrogen bonds (as Gln 118 does) are highly conserved in proteins, and these polar sidechains are important for the stabilization of the protein architecture (Worth and Blundell BMC Evolutionary Biology 2010, 10:161). Thus, we do expect the mutation of Gln118 to destabilize the clamp loader structure. However, we do not find the identification of the importance of Gln118 to be a trivial finding, because the role of polar residues in maintaining structure is quite commonly linked to their functional role, making it difficult to separate the two effects. For example, the proximal histidine that links the F helix in hemoglobin to the iron atom is perhaps the most important residue for allosteric communication in hemoglobin. Mutation of the proximal histidine severely destabilizes hemoglobin, due to loss of heme binding and conversion to a molten globule state (see, for example, Brennan and Matthews, Hemoglobin, 21:393-403, 1997).
  
  It was an oversight for us to have not analyzed the effects of Q118 mutations on stability and function, and we have now rectified this. We now include the results of the following four experiments, in which we compare the expression of the mutant and wild-type forms of the clamp loader, their behavior on gel filtration analysis, and their activities in ATPase assays and DNA replication assays. These experiments demonstrate that the mutation most likely destabilizes the protein, and affects the nature of the assembled complex. These results further emphasize the crucial nature of the hydrogen-bonding interactions made by the Gln 118 sidechain.
  
  1) We created a clamp loader variant in which the ATPase subunit is C-terminally tagged with the fluorescent protein mCherry, allowing the expression levels of the proteins to be monitored by flow cytometry of E. coli cells. This experiment shows that introduction of the Q118N mutation leads to a very substantial reduction in protein expression (Figure 6 supplement 2 in the revised manuscript). An important point is that the proteins are expressed using a strong promoter (T7 RNA polymerase promoter), which was done so as to purify proteins for biochemical experimentation and also enable ready detection of the mCherry fluorescence. The natural T4 promoter that is used in the phage assay results in very low levels of protein expression (no detectable fluorescence signal when mCherry is fused to the ATPase subunit), and we do not know whether the expression defect that we see is also manifested under conditions where the protein expression is low. Nevertheless, the data do indicate that the Q118N mutation destabilizes the clamp loader complex.
  
  2) We purified mCherry tagged variants of the wild-type clamp-loader complex, the Q118N mutant complex, and the Q118N/I141L double mutant that has partial recovery of fitness in the phage propagation assay. SDS-PAGE analysis (not shown) confirms that all complexes have the ATPase and clasp subunits of the clamp loader in the proper 4:1 ratio. Gel filtration analysis shows that the wild-type complex corresponds to a single peak eluting at ~70 ml, which we assume corresponds to correctly assembled clamp loader (see Figure 9 supplement 1 in the revised manuscript). For both mutants, there is a peak at ~70 ml, corresponding to the properly assembled clamp loader, but also an additional peak that is close to the void volume of the column (~45 ml). For the Q118N mutant, the fraction of the protein corresponding to the properly assembled clamp loader is small. This fraction is substantially larger for the double mutant that has increased fitness (Q118N/I141L), indicating that one effect of the second mutation is to recover the ability of the clamp loader to assemble properly.
  
  3) We measured the rates of DNA-stimulated ATP hydrolysis for purified and mCherry-tagged wild-type clamp loader and the Q118N mutant, as we had described in the original manuscript for several other mutants (Figure 9 supplement 2 in the revised manuscript). Addition of the mCherry tag to the wild-type clamp loader results in a slight reduction of the ATPase activity. The Q118N mutation has a very low rate of DNA-stimulated ATPase activity (less than 10% of activity of the wild-type mCherry-tagged clamp loader). These data indicate that even in the fraction of Q118N mutant that can be purified as part of an intact clamp loader complex, the mutation compromises the ability to hydrolyze ATP. This is likely to be due to the failure to assemble into a competent conformation.
  
  4) We measured the extent of plasmid DNA replication by the T4 replisome, using wild-type and mutant clamp loaders, as described in the original manuscript (Figure 9 supplement 3 in the revised manuscript). As for the ATPase assay, addition of the mCherry tag to the wild-type clamp loader results in a slight reduction of replication efficiency. Introduction of the Q118N mutation leads to a near-total loss of replication efficiency, to a level comparable to that seen in the absence of the clamp loader.
  
  The main text of the manuscript now includes a description of these new results, and the new data are included as supplementary figures.
  
  Reviewer #2 (Public Review):
  
  [...] One potential weakness is that among all the questions posed at the beginning of the study not all received a definitive answer. In particular, the question "To what extent does the mutational sensitivity of the system in a particular organism, carrying out the essential function of DNA replication, reflect the sequence diversity seen across the spread of life?" is only partially addressed.
  
  We agree that we have not fully probed the issue of evolutionary sequence diversity versus mutational sensitivity. We find it exciting that the two sets of data show clear divergence in certain positions, pointing to epistasis. This will be an exciting direction for future exploration.
  
  The second question, "The clamp loader subunits respond cooperatively to the clamp, ATP and DNA. How do the mechanisms underlying this cooperativity impose constraints on the sequence?", has not been answered and goes beyond the scope of this study.
  
  Answering this question requires the analysis of second-order mutations. We have demonstrated the feasibility of using the phage propagation assay for such analysis, but we agree with the reviewer that this is beyond the scope of the present study.
  
  scietyType:AuthorResponse
Visit annotations in context

Tags

scietyType:AuthorResponse

Annotators

Public_Reviews

URL

biorxiv.org/content/10.1101/2020.12.31.424921v1
store.steampowered.com store.steampowered.com

Micro Machines World Series on Steam

1
1. TylerRick 12 Apr 2021
  
  in Public
  
  game that uses the Micro Machines license to try and sucker people in that remember the old games.
  
  using attractive/familiar brand/name to lure customers
  
  bait and switch annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

bait and switch

Annotators

TylerRick

URL

store.steampowered.com/app/535850/Micro_Machines_World_Series/
hypothes.is hypothes.is

Hypothesis

1
1. jacobfleming 12 Apr 2021
  
  in Public
  
  All set up and ready to go.
  
  welcome
  
  #welcometohypothesis
Visit annotations in context

Tags

#welcometohypothesis

Annotators

jacobfleming

URL

hypothes.is/groups/ermjdmPB/health-promotion-group-2
journals.plos.org journals.plos.org

Defrosting the Digital Library: Bibliographic Tools for the Next Generation Web

1
1. rafael.perez.dr 11 Apr 2021
  
  in Public
  
  Socializationallows users to share their personal collections and see who else isreading the same publications, including added information suchas related papers with the same keyword (or ‘‘tag’’) and what notesother people have written about a given publication.
  
  Compartir contenido de biblioteca digital, proceso de uso de información en la Web 2.0
  
  @infovestigacion @Kit_defrosting
Visit annotations in context

Tags

@Kit_defrosting

@infovestigacion

Annotators

rafael.perez.dr

URL

journals.plos.org/ploscompbiol/article
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.06.438709

1
1. sciscore 10 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.06.438709: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B-cell isolation and recombinant mAb production: Discovery and initial characterization of six antibodies in our panel was previously reported (S309 and S3044,17, S2X35, S2H13 and S2H1417, and S2E128), and six new antibodies are first described here (S2H97, S2X16, S2H58, S2D106, S2X58, S2X227).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2H1417</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2E128</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epitope classes shown in Fig. 1a are defined as in Piccoli et al.17 Briefly, the classification of these epitope classes results from Octet binning experiments using structurally characterized antibodies, structural insights to define the recognition of open-only RBD and ability of antibodies to interfere with RBD binding to ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed, and secondarily labeled with 1:200 PE-conjugated goat anti-human-IgG antibody (Jackson ImmunoResearch 109-115-098) to label for bound antibody, and 1:100 FITC-conjugated chicken anti-Myc-tag (Immunology Consultants Lab, CYMC-45F) to label for RBD surface expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We sorted approximately 7.5e6 RBD+ cells per library on a BD FACSAria II, collecting yeast cells from the antibody-escape sort bin (fractions of library falling into antibody escape bin given in Extended Data Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape sort bin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sorted cells were recovered overnight, plasmids were extracted from the pre-sort and antibody-escape populations, and variant-identifier barcode sequences were PCR amplified and sequenced on an Illumina HiSeq 25003,28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape populations ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As previously described3,23, sequencing counts pre- and post-selection were used to estimate the “escape fraction” for each library variant, which reflects the fraction of yeast expressing a variant that fall into the antibody-escape FACS bin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape FACS bin .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The interactive visualizations of antibody escape maps (https://jbloomlab.github.io/SARS-CoV-2-RBD_MAP_Vir_mAbs) were created using dms-view42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dms-view42</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Although we have various follow-up binding data illustrating reduced affinity binding for some “escaped” sarbecovirus RBDs, these follow-up experiments were not conducted systematically for all antibody/RBD combinations, and therefore would bias breadth estimates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody/RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These antibodies and their citations include: S2X259, accompanying paper Tortorici et al. 2021; LY-CoV55521; COV2-2196 and COV2-213033; REGN10933, REGN10987, and LY-CoV01623; and all other COV2 antibodies and CR30223.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR30223</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2c incorporate the authentic SARS-CoV-2 neutralization IC50s as reported in this study (Fig. 1a), together with the live SARS-CoV-2 neuralization IC50s for the COV2 antibodies reported by Zost et al.10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">goat anti-human IgG secondary antibody (Southern Biotech, 2040-04) was added and incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat anti-human IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2040-04, RRID:AB_2795643)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lenti-X 293T cells (Takara, 632180) were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were used for VSV-SARS-CoV-2, VSV-SARS-CoV-1, and VSV-GD-Pangolin-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BHK-21 cells stably expressing ACE2 were used for VSV-GX-Pangolin-CoV and VSV-WIV1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 HexaPro Spike protein for cryoEM analysis was produced in HEK293F cells grown in suspension using FreeStyle 293 expression medium (Life Technologies) at 37°C in a humidified 8% CO2 incubator rotating at 130 r.p.m.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Escape clones were plaque-purified on Vero cells in the presence of mAb, and plaques in agarose plugs were amplified on MA104 cells with the mAb present in the medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent neutralization data were analyzed and graphed using Prism (GraphPad, v9.0.1)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The geometric mean from at least two independent experiments was calculated using Excel (Microsoft, Version 16.45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene sequence phylogeny was inferred using RAxML version 8.2.1249, with the GTRGAMMA substitution model and a partition model with separate parameters for first, second, and third codon positions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 was performed using the Python scikit-learn package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3D refinements were carried out using non-uniform refinement64 along with per-particle defocus refinement in CryoSPARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutant RBD:S309 complexes were constructed from the fully glycosylated WT RBD:S309 complex using PyMOL 2.3.5 (Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The glycosylated proteins were parameterized with the Amber ff14SB74 and GLYCAM_06j-175 force fields.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amber</div><div>suggested: (AMBER, RRID:SCR_016151)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-bonded interactions were treated with the Particle Mesh Ewald method79 using a real-space cutoff of 1.0 nm and the OpenMM default relative error tolerance of 0.0005, with grid spacing selected automatically.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OpenMM</div><div>suggested: (OpenMM, RRID:SCR_000436)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.06.438709
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.06.438579

1
1. sciscore 10 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.06.438579: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Formaldehyde fixed cells were washed with phosphate buffered saline and permeabilized for immunofluorescence using 0.1% Triton X-100 in PBS with 1% bovine serum albumin (BSA) fraction V (www.emdmillipore.com) and stained for SARS-CoV-2 with a primary anti-Nucleocapsid antibody (www.genetex.com GTX135357) labeled with AlexaFluor 594.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: (GeneTex Cat# GTX135357, RRID:AB_2868464)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins in VLP and cell lysates were separated on 10% SDS-PAGE gels, transferred to PVDF membranes, and immunoblotted with the following antibodies (Fig 7A): mouse monoclonal anti-V5 tag (www.thermofisher.com, #R960-25), rabbit polyclonal anti-SARS M (generous gift of C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were detected using horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (www.bio-rad.com) or HRP-donkey anti-rabbit IgG (www.bio-rad.com) and Western Clarity detection reagent (www.bio-rad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antiviral test of amilorides: Vero E6 and Caco-2 were obtained from ATCC and grown in DMEM (www.corning.com) with 10% FBS, 10mM HEPES, and Penicillin-Streptomycin (www.thermofisher.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 isolate USA-WA1/2020 (www.beiresources.org) was propagated on Caco-2 cells and infectious units quantified by focus forming assay using Vero E6 (ATCC) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were cultured in complete Dulbecco’s modified Eagle medium containing 10% Fetal Bovine Serum and penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 and CC50 were determined using the nonlinear regression analysis in GraphPad Prism 9 with the bottom and top parameters constrained to 0 and 100, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chemiluminescence was detected using a Bio-Rad Chemi Doc imaging system and analyzed using Bio-Rad Image Lab v5.1 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Image</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.06.438579
www.selenium.dev www.selenium.dev

Selenium 1 (Selenium RC) :: Documentation for Selenium

1
1. attu 10 Apr 2021
  
  in Public
  
  The diagram shows the client libraries communicate with the Server passing each Selenium command for execution. Then the server passes the Selenium command to the browser using Selenium-Core JavaScript commands. The browser, using its JavaScript interpreter, executes the Selenium command. This runs the Selenese action or verification you specified in your test script.
  
  This is my annotation.
  
  add new tag
Visit annotations in context

Tags

new

tag

add

Annotators

attu

URL

selenium.dev/documentation/en/legacy_docs/selenium_rc/
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.06.438614

1
1. sciscore 09 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.06.438614: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, acetonitrile (ACN), ammonium bicarbonate (NH4HCO3), anti-FALG antibody, anti-FLAG M2 affinity gel, and neuraminidase were purchased from Sigma-Aldrich (St. Louis, MO, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FALG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>neuraminidase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S protein subunit 1 (His tag) expressed by HEK-293 cells were purchased from Sanyoubio (Shanghai,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The glycosites and glycoforms of S protein purified from HEK-293T cells were confirmed according to the mass spectrometry results of commercial S1 using a ‘match between runs’ analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometric data analysis: The LC-MS/MS raw data were analyzed manually for each glycopeptide using Xcalibur 3.0.63 (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the MD simulations were performed using the Amber14 package(Case et al., 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amber14</div><div>suggested: (Assisted Model Building with Energy Refinement (AMBER, RRID:SCR_014230)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 29. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.06.438614
www.biorxiv.org www.biorxiv.org

Towards deciphering the Nt17 code: How the sequence and conformation of the first 17 amino acids in Huntingtin regulate the aggregation, cellular properties, and neurotoxicity of mutant Httex1

3
1. EMBOpress 09 Apr 2021
  
  in Review Commons
  
  Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.
  
  Learn more at Review Commons
  
  Reply to the reviewers
  
  Response to Reviewers
  
  Title: "Towards deciphering the Nt17 code: How the sequence and conformation of the first 17 amino acids in Huntingtin regulate the aggregation, cellular properties, and neurotoxicity of mutant Httex1".
  
  Tracking #: RC-2021-00675 Authors: Vieweg et al.
  
  MAJOR COMMENTS from Referees #1, #2, and #3
  
  Referee #1
  
  General comments
  
  « The manuscript by Vieweg, Mahul-Mellier, Ruggeri et al., describes the role of the sequence and conformation of the extreme N-terminus of the Huntingtin protein in terms of aggregation and toxicity together with its relation to the polyglutamine length. The authors use some outstanding methods to ensure that the conclusions are based on good quality data. Overall, this is an excellent study.
  
  We thank the referee for the very positive feedback and for recognizing the quality of our work and his/her appreciation of our systematic approach to dissect the role of the Nt17 domain in regulating the aggregation, cellular properties, and neurotoxicity of mutant Httex1.
  
  “The manuscript is generally well written although it might benefit from reducing the length of the discussion section ».
  
  We thank the referee for his/her valuable comment. We have reduced by 10% the discussion as per requested.
  
  Major comments
  
  1) “For their in vitro data, the authors do not go beyond 42 polyglutamines. Is there any particular reason for that? The authors see a clear difference between 36Q and 42Q, but although not critical, it would have been useful to use longer repeats. In my view, the authors should at least discuss the rationale for this, particularly as in cellular models they do use 72Q constructs.”
  
  We thank the referee for raising this point.
  
  Most HD patients have a polyQ repeat stretch of 40-45 glutamines (1-4).
  
  In vitro, the use of Httex1 constructs consisting of 42 polyglutamine residues is sufficient to induce mutant Httex1 aggregation and fibril formation. Mutant Httex1 proteins with polyQ repeats of 72Q or higher are highly aggregation-prone and difficult to purify, handle, or disaggregates. This is why all of the in vitro aggregation studies are based on mutant Htt proteins with polyQ ranging from 23Q-53Q (5-14). We have reviewed the literature carefully and were unable to identify any in vitro studies with recombinant Htt proteins containing polyQ repeats of 72 or greater.
  
  In cells, induction of mature Htt inclusions requires much longer polyQ repeats. This is clearly reflected by the fact that most cellular studies use mutant Htt with polyQ repeats above 64Q and up to 160Q to induce the formation of cellular aggregates (10, 15-30).
  
  We have recently conducted a systematic study on the effect of the polyQ repeat length on Htt inclusion formation in cells https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21). Characterization of the inclusions by EM revealed that the polyQ tract length dramatically influences the ultrastructure properties and the architecture of the Httex1 inclusions in cells. The dark shell structure that delimitated the core from the periphery of the Httex1 72Q inclusions was absent in the Httex1 39Q inclusions. Also, the Httex1 39Q inclusions appeared less dense compared to that of the Httex1 72Q. Finally, no significant cell death was observed in HEK cells overexpressing 39Q constructs while overexpression of Httex1 72Q was toxic. For these reasons, we and others select to use Httex1 with polyQ repeat of 75 or higher.
  
  2) « The role of the N-terminus 17 aminoacids of huntingtin (Nt17) is addressed by comparing peptides with and without the Nt17 and their relation to the adjacent polyglutamine tract. Using this approach, the peptide without the Nt17 is composed of pure polyglutamines in its N-terminus, followed by the rest of exon 1 in its C-terminus. This is clearly the key comparison to address the role of the Nt17 in the context of an exon1 containing polyQ. »
  
  Yes. In fact, we did perform this experiment and assessed if the addition of the Nt17 would be sufficient to inhibit mutant Httex1 aggregation or make ΔNt17-Httex1 aggregate similar to Httex1. This data is included in the original version of the manuscript as Figure S5 in supporting material. We observed that that __the presence of the Nt17 peptide during the aggregation of ΔNt17-exon1 fibrils did not interfere with the aggregation kinetic of mutant Httex1 or alter the fibril morphology of ΔNt17-exon1,__ indicating that intramolecular interactions between the Nt17 domain and the adjacent polyQ tract are key determinants of mutant HTtex1 fibrillization and fibril morphology.
  
  Referee #2
  
  General comments
  
  This article describes the results from studies into mechanisms of the aggregation and toxicity of Htt Exon1 protein. The authors investigated the role of N17, polyQ length, M9C mutation, and phosphorylation. Multiple approaches were used that included biochemical protein design, biophysical measurements, and cell biological experiments with cultured mammalian cells. The authors demonstrate the effects of protein context on aggregation. Furthermore, the authors were able to visualize the aggregates in mammalian cells and in neurons using multiple methods. These are interesting data.
  
  We greatly appreciate the positive feedbacks on our data and our systematic and integrative approaches.
  
  There are several major weaknesses in the study. First problem is that most of the results related to aggregation mechanisms and toxicity are not original and incremental when compared to many previously published articles.
  
  We respectfully disagree with this assessment and suggestion that our studies are not original and represent only incremental advances.
  
  Originality
  
  Our study provides novel mechanistic insights into the role of not only the sequence but also the conformational properties of the Nt17 domain in regulating the dynamics of Httex1 fibrillization, the kinetic fibril growth, the structure and morphology of Httex1 fibrils. Besides, we also addressed for the first time how the Nt17 domain and phosphorylation at different residues within this domain regulate the cellular uptake, subcellular localization (phosphorylated proteins) and toxicity of extracellular monomeric and fibrillar forms of mutant Httex1 in primary neurons. We are not aware of previous reports that have conducted similar studies addressing these questions and using multiple methods. Also, some of our findings using native Httex1 sequences are not in agreement with previous reports using Httex1 proteins fused to peptide/protein tags, thus underscoring the limitations of previous studies.
  
  1) We demonstrated that the Nt17 domain plays an important role in shaping the surface properties of mutant Httex1 fibrils and regulate their lateral association and cellular uptake. Our findings are not in agreement with previous findings published in eLife by Shen et al. __(10)__, where they reported that removal of the Nt17 domain has the opposite effect of what we observed in our study, i.e., ∆Nt17 promotes the formation of fibrils that exhibit a low tendency to laterally associated and form a “bundled” architecture (10). Careful examination of their constructs revealed that all the proteins they used contained a highly charged 15-mer peptide tag (S-tag: Lys-Glu-Thr-Ala-Ala-Ala-Lys-Phe-Glu-Arg-Gln-His-Met-Asp-Ser) at the C-terminus of Httex1, which we believe would strongly influence the aggregation properties of the mainly uncharged ∆Nt17-Httex1 and Httex1 protein, thus possibly explaining the discrepancy between our findings and those of Shen et al (10). In fact, a previous study has shown that adding short peptide tags such as the HA or the LUM tag to mutant Htt171 changed the toxicity dramatically. In addition, we show that the subcellular localization of Htt171 expressed in cells (e.g: expression of Htt171 carrying the LUM tag was more toxic than untagged Htt171 and induced the formation of nuclear aggregates rather than the classical cytoplasmic aggregates) (31). The reference to this paper is now included and discussed in the main manuscript (page 11).
  
  Our observations __highlight__ the critical importance of using tag-free proteins to investigate the sequence and structural determinants of Httex1 aggregation and structure.
  
  2) Our study is the first to demonstrate that the Nt17 domain influences the relationship between fibril length and polyQ repeat length. This correlation disappears when the Nt17 is removed. This aspect of our work was not explored by Shen et al. (10), who limited their in vitro aggregation study to Httex1 wild-type and mutants (∆Nt17 or ∆PRD for Polyn Rich Domain).
  
  3) This is also the first study to assess the effect of modulating the helicity of Nt17 on fibrils growth and morphology and Httex1 cellular properties.
  
  a) Using the helix and membrane-binding disrupting mutation (M8P), we showed that disrupting the Nt17 helix (M8P mutation) slows the aggregation propensity of Httex1 in vitro but does not alter the morphology of the fibrils. In contrast, removing the Nt17 domain leads to a strong lateral association of the fibrillar aggregates with ribbon-like morphology. This demonstrated that the __Nt17 sequence, but not its helical structure, is the key determinant of the quaternary packing of Httex1 fibrils. Shen et al. (10) did not investigate the effect of modulating the helicity of Nt17 on fibrils growth and morphology using M8P mutant__.
  
  b) Our cellular studies comparing the membrane association and uptake of extracellularly added Httex1 43Q and M8P Httex1 43Q fibrils in primary rat striatal neurons showed that disrupting the Nt17 helix promotes the internalization of M8P Httex1 while Httex1 stays bound to the plasma membrane. These findings suggest that the Nt17 helical conformation persists in the fibrillar state or that the Nt17 domain regains its helical structure upon interaction with the plasma membrane resulting in the sequestration of Httex1 fibrils at the membrane and impeding their uptake. This aspect of our study has never been explored in previous studies.
  
  c) Using the site-specific bona fide phosphorylation on T3, S13, SS16, and both S13/S16, this is the first study that shows that modulation of the overall helicity of Httex1 through site-specific phosphorylation of the Nt17 domain (pT3 stabilizes the alpha-helical conformation of Nt17 while pS13 and/or pS16 disrupts it (9)) enhance the rapid uptake of extracellular Httex1 monomeric species into neurons and their nuclear accumulation. Previous studies relied on phosphomimetic mutations (32), which we have shown do not reproduce the effect of phosphorylation at these residues on the structure of Nt17 (8, 9). Shen et al. __(10) did not investigate the effect of modulating the helicity of Nt17 on fibrils growth and morphology using site-specific __phosphorylation of the Nt17 domain. 4) Our overexpression model in HEK cells showed that removing the Nt17 domain or disrupting its helical structure (M8P mutation) was sufficient to prevent the cell death induced by Httex1 72Q overexpression and reduce the number of cells with inclusions drastically. Our data indicate that the cell death level correlates with the number of cells that contain inclusions or the number of inclusions formed in the cells or/and their subcellular localization. In contrast to our results, Shen et al.,__(10)__ demonstrated that the overexpression of ΔN17-Httex1 induced toxicity at a similar level as the full-length Httex1 in striatal-derived neurons or neurons from cortical rat brain slices culture, although ΔN17-Httex1 led to a significant reduction of punctate structures in these cells. The discrepancy between these studies and our Httex1 overexpression model in HEK cells may be due to the fact that in neurons, Httex1 lacking the Nt17 domain accumulates in the nucleus. In contrast, in HEK, it stayed mostly cytosolic. In line with this hypothesis, it has been recently shown that cytosolic inclusions (Httex1 200Q) and nuclear aggregates (Httex1 90Q) contribute – to various extents – to the onset and the progression of the disease in a transgenic HD mice model (33). Thus, the difference in cellular localization but also the cell type (HEK vs. neurons) could influence the toxic response of the cells to the overexpression of ∆Nt17-Httex1, with toxicity triggered only by the nuclear ∆Nt17-Httex1 species.
  
  5) This is also the first study to investigate the role of the Nt17 domain and Nt17 PTMs in influencing the uptake, the subcellular localization, and the toxicity of extracellular Httex1 species (monomers and fibrils) in primary neurons. We showed that the helical propensity of Nt17 strongly influences the uptake of Httex1 fibrils into primary striatal neurons. At the same time, phosphorylation (at T3 or S13/S16) or removal of the Nt17 domain increased the uptake and accumulation of Httex1 fibrils into the nucleus and induced neuronal cell death. Our findings suggest that the Nt17 domain is exposed in the fibrillar state and is sufficiently dynamic to mediate fibril-membrane interactions and internalization.
  
  Altogether our results, combined with previous findings from our groups and others demonstrating the role of Nt17 in regulating Htt degradation (34-36), suggest that this domain serves as one of the key master regulators of Htt aggregation subcellular localization of the pathological aggregates, and their toxicity. They further demonstrate that targeting Nt17 represents a viable strategy for developing disease-modifying therapies to treat HD.
  
  Limitations of previous studies:
  
  Although the effects of the Nt17 domain in regulating Httex1 aggregation and cellular properties have been studied and reported on by other groups, we would like to stress that most of the published studies had major limitations and used protein constructs that do not share the sequence of native Httex1 and exhibit biophysical and cellular properties that differ from those of native Httex1 sequences.
  
  1) Many of the studies used Httex1-like model peptides (13, 37), which do not contain the complete sequence of Httex1 (e.g., Nt17 peptide (37)), contain additional solubilizing amino acids such as lysine residues(38-43) or are fused to large proteins (e.g., GST, YFP) (37).
  
  2) Other studies relied on artificial fusion constructs whereby the polyQ domain (44-46) or Httex1 itself (12, 47-61) are fused to large solubilizing protein tags, such as glutathione-S-transferase (GST), maltose-binding protein (MBP) or thioredoxin (TRX) or C-terminal S-tag (10, 62, 63) or fluorescent proteins (e.g., GFP or YFP) (10, 15, 49, 64, 65) for the cellular studies.
  
  One of the major limitations of using fusion constructs as precursors for the generation of Httex1 (12, 47-61) is the requirement to cleave the fusion protein in situ by adding a protease to release and initiate the aggregation of Httex1. Enzyme-mediated cleavage of Httex1-fusion proteins often results in the incorporation of additional amino acids at the N- or C-terminus of the protein. This could alter the biophysical and biochemical properties of Httex1 because of the important role of the Nt17 domain and the proline-rich domain in regulating the conformational and aggregation properties of the protein (38, 40, 43, 65, 66). Moreover, it has been shown that commonly used enzymes such as trypsin and thrombin may lead to cleavages within the Nt17 domain and result in the generation of undesired Httex1 fragments (7, 42, 60). The net effect of incomplete and/or unspecific enzymatic cleavage of Httex1 fusion proteins is the generation of heterogeneous protein mixtures, which precludes accurate interpretation and comparison of aggregation and structural data across different laboratories.
  
  Moreover, several studies have shown that the fusion of small peptide tags or large fusion protein alters the aggregation of mutant Httex1 in vitro and in cells.
  
  We have previously shown that the presence of such tags (e.g., GST) alters the ultrastructural and biochemical properties of Httex1 as well as its aggregation properties in vitro (11).
  
  We have also recently completed a comprehensive assessment of the GFP tag's impact on the aggregation, inclusion formation, and cellular properties of Httex1 (preprint paper available in BioRxiv https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21)). In this paper, we show that inclusions produced by mutant Httex1 72Q-GFP exhibit striking differences in terms of organization, ultrastructural properties, composition, and their impact on mitochondria functions as compared to the inclusions formed by the tag-free mutant Httex1 72Q. These findings highlight the critical importance of developing new tools that minimize the impact of large fluorescent proteins and/or label-free imaging methods and monitoring Htt aggregation in inclusion formation in cells.
  
  From Riguet et al., __(21)__. Influence of GFP on the ultrastructural properties of Httex1 cellular inclusions by Correlative light electron microscopy (CLEM). CLEM of Httex1 72Q (+/-GFP) transfected in HEK 293 cells after 48h. Confocal images of A. Httex1 72Q and. B Httex1 72Q GFP, 48h after transfection. Httex1 expression (red) was detected using a specific primary antibody against the N-terminal part of Htt (amino acids 50-64) and the nucleus was stained with DAPI (blue). Electron micrographs of C. Httex1 72Q and D. Httex1 72Q GFP inclusions corresponding to confocal images panel A, and B (white square), respectively. Add-in binary images generated from electron micrographs by median filtering and Otsu intensity threshold. E. **Schematic depictions and original electron micrographs of cytoplasmic inclusions formed by native (tag-free) mutant Huntington exon1 proteins (Httex1 72Q, left) and the corresponding GFP fusion protein (Httex1 72Q-GFP).
  
  A recent study by Chongtham et al. (31) also supports our findings and shows that adding short peptide tags such as the HA or the LUM tag to mutant Htt171 changed dramatically the toxic properties of Htt171 as well as its subcellular localization and the compactness of the aggregates formed in cells (e.g.: expression of Htt171 carrying the LUM tag was more toxic than untagged Htt171 and induce the formation of nuclear aggregates rather than the classical cytoplasmic aggregates, See Figure 4).
  
  Figure 4 from Chongtham et al., __(31)__. The influence of peptide modifications on HTT171 fragment behavior. (A) When expressed ubiquitously with da>Gal4, the HTT171-120Q fragment exhibits little or no lethality, but appending either an HA ( ... YPYDVPDYA∗)oraLUMtag ( ... GCCPGCCGG∗) to the C-terminus dramatically increases the toxicity of the fragment. (B) Surviving adult flies expressing an HA-tagged HTT171 transgene exhibit about half the life span of those expressing untagged 171. Flies expressingLUM-tagged HTT171 do not survive to adulthood. (C) Flies expressing HA- or LUM-tagged 171 in tracheal cells show only modest increases in lethality that do not rise to the level of significance (P=0.12; 0.09), but the inclusion of tags changes the subcellular behavior significantly. (D) In contrast, in the prothoracic gland, expression of LUM-tagged 171 shows a significant increase in toxicity compared to 171 alone, while the HA-tagged 171 borders on significance (P=0.051). (E) In trachea, pure 171 forms cytoplasmic aggregates, while the inclusion of HA causes some HTT to become nuclear diffuse, and inclusion of the LUM tag causes the bulk of the HTT to appear as diffuse nuclear material with some cytoplasmic aggregates remaining when expressed with btl>Gal4 at 29◦C. (F) In the prothoracic gland, addition of the LUM tag causes aggregated- **cytoplasmic HTT to become weakly staining diffuse-cytoplasmic material while HTT171HA remains as extensive aggregates in the cytoplasm with a haze of diffuse staining as well. Scale bars are 10 μm
  
  Therefore, in this study, we aimed to investigate for the first time the role of the sequence and the conformational properties of the Nt17 domain in regulating the dynamics of Httex1 fibrillization, the structure and morphology of Httex1 fibrils using a tag-free Httex1 constructs. In our studies, we used multiple methods to examine the structural and cellular properties of these proteins under the same conditions and in the same cellular systems, thus making it possible to correlate the sequence, structural and cellular properties of the different Httex1 proteins (monomers and fibrils). We are happy to see that this was nicely recognized and appreciated by the referee.
  
  Referee #1 “The authors use some outstanding methods to ensure that the conclusions are based on good quality data. Overall, this is an excellent study.” Referee #3 “Their findings provided the precise information for the role of tag-free Nt17. The paper advanced our knowledge of Nt17, especially in the Huntington disease field.”
  
  Major comments
  
  Referee #2 raised the following concerns:
  
  1) « The main hypothesis of this study solely depends on the ability of N17 domain to enhance aggregation (Fig 1 and Fig 2). According to the method for the protein solubilization 1mM TCEP was added to ∆Htt-Ex1, but not to Htt-Ex1 proteins. It is necessary to rule out the potential effects of TCEP on aggregation assay. »
  
  We thank the referee for raising this important point. Indeed, we were also concerned about the potential effect of TCEP and conducted experiments to address this point. Our data show that TCEP does not affect our aggregation assay. This new panel is now included in supporting information as Figure S2A-B and mentioned in the corresponding section of the Material and method (page 29).
  
  2) « The author needs to provide biophysical data of the mutation and phosphorylated proteins with/without Tag. »
  
  All the proteins used in this study have been extensively characterized in recent publications from our lab __(9, 11, 21)__. All these papers are cited throughout our manuscript as well as in the material and method section.
  
  The expression, purification and characterization of native tag-free Httex1 with polyQ repeats ranging from 7 to 49Q has been fully described in Vieweg et al., 2016 __(11)__. In this paper, the aggregation properties of tag-free Httex1 and Httex1 fused to GST or MBP tags were compared by sedimentation assay, while the morphology and length of the resulting fibrils were compared by EM.
  
  The semisynthesis, purification, and characterization of Httex1 42Q phosphorylated at Ser-13 and/or Ser-16 or at T3 was described respectively in Deguire et al., 2018 __(9) and Chiki et al., 2017 (8)__. These studies include kinetics of aggregation and morphological assessment (i.e: heights and lengths) by EM and AFM of the fibrils formed by phosphorylated or unphosphorylated mutants Httex1.
  
  The Httex1 mutants carrying the GFP tag were not used in the in vitro studies but were studied in our overexpression-based cellular model. The direct comparison characterization of inclusion formation by tag-free and GFP-tagged mutant Httex1 and their impact on cellular homeostasis are fully described in a preprint paper available in BioRxiv https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21). In this paper, we show that inclusions produced by mutant Httex1 72Q-GFP exhibit striking differences in terms of organization, ultrastructural properties, composition, and their impact on mitochondria functions as compared to the inclusions formed by the tag-free mutant Httex1 72Q. These findings highlight the critical importance of developing new tools that minimize the impact of large fluorescent proteins and/or label-free imaging methods and monitoring Htt aggregation in inclusion formation in cells.
  
  Referee #3
  
  General comments
  
  “Their findings provided the precise information for the role of tag-free Nt17.__ The paper advanced our knowledge of Nt17, especially in the Huntington disease field.”__
  
  We thank referee #3 for the very positive feedback and for recognizing the quality, depth and significance of our work and its potential impact in the field of Huntingtin disease.
  
  “However, the conceptual advance is limited.”
  
  We respectfully disagree with this assessment that the conceptual advance of our study is limited.
  
  Please see our detailed response to Referee #2 regarding our work's originality and novelty (pages 3-8, in our referees' letter).
  
  Major comments
  
  Referee #3 raised the following concerns:
  
  1) Finding of lateral association (bundling) of __Δ__Nt17-Httex1 fibrils is interesting.
  
  We agree and thank the referee for further highlighting this point.
  
  However, pathological significance is not clear
  
  We agree that the significance for delta 17 is not clear as we do not know whether this cleavage occurs in vivo or not. This is why we decided to extend our studies beyond the removal of Nt17 and investigated the effect of natural PTMs that are known to alter the sequence of Nt17 and modulate its helicity. One additional distinguishing feature of our work is that we used proteins (monomers and fibrils) that bear site-specific bona fide phosphorylation on T3, S13, SS16, and both S13/S16.
  
  a) Does even non-truncated form also increase this kind of bundling when polyQ is expanded? We have addressed this specific question in a previous study (11) in which we have compared the morphology and length of fibrils formed from Httex1 with polyQ tract from 23Q to 43Q. The increased lateral association was not observed for the fibrils generated from Httex1 43Q or Httex1 23Q, 29Q, or 37Q (Figure 5F) (11). Besides, in this paper, we were the first to show an inverse correlation between the polyQ-length and fibril length, which suggests structural differences between Httex1 proteins with different polyQ repeat lengths. Others have investigated Httex1 with different polyQ repeat, but not using tag-free Httex1 proteins, and they did not observe this inverse relationship between polyQ lenth and fibril length, as we did here and in our previous studies (11).
  
  b) When fibrils are added to striatal neurons like in Fig.5, is this structural feature preserved on the membrane or inside of the cells? We agree with the referee that this is an important point to address. However, deciphering the structural properties of the membrane-bound and internalized fibrils is not trivial, especially given the limited amount of unlabelled fibrils that are taken up by the cells. This would require extensive optimization of the CLEM technique or the use of an alternative approach such as tomography. Due to the resources and time required to address this important question, this part of the project will be included as part of future projects aimed at investigating the mechanisms of Htt seeding and propagation. We are not aware of any reports by other groups that monitor the structural changes of exogenous fibril after internalization into cells.
  
  c) When Httex1 fibrils species are expressed, is this bundling also observed? In fact, we have recently completed a comprehensive analysis of the comparison of the inclusions formed by mutant Httex1-72Q and ΔNt17 Httex1.
  
  In this study, we have shown that the expression of Httex1 72Q and the truncated form ΔNt17 Httex1 72Q form cytosolic inclusions of similar size and shape in HEK 293 (Figure 4). We have further characterized the architecture and organization of these inclusions at the ultrastructural level in the context of another project. Our findings are now available online (see Riguet et al., 2021, BioRxiv (21)).
  
  Using correlative light electron microscopy, we showed that the inclusions formed by Httex1 full length or lacking the Nt17 domain exhibited similar architecture and a ring-like organization. Interestingly, we showed the inclusions are composed of highly organized fibrillar network at the core and periphery of the inclusions. In cells inclusion formation is a multiphasic process driven by different phases of polyQ dependent aggregation processes and complex interactions with lipids, proteins and organelles (ER).
  
  Although CLEM approach in neurons provides very good contrast of cytosolic or nuclear inclusions, the resolution of this method is not sufficient to allow imaging at the level of individual fibrils and assessing their morphology. Differences between CLEM and EM resolution can be explained as the slices of the cellular objects are much thicker (~ 50 nm) than the fibrils prepared in vitro and directly deposited on the EM grids (the height of Httex1 pre-formed fibrils is between 5 and 7 nm). To improve the imaging and get a stronger contrast of de novo fibrils in our CLEM samples, we used a double-contrast method based on uranyl acetate and lead citrate stains. Nevertheless, the complex cellular environment and the presence of various cellular objects (e.g: organelles and proteins) surrounding the de novo fibrils might prevent the optimal stain penetration from allowing imaging at the level of individual fibrils. Finally, the preparation of the neuronal samples for CLEM imaging includes ethanol and detergents incubation and resin embedding. These steps can limit the ultrastructure detection of the de novo fibrils at the level of individual fibrils and therefore does not allow to determine their organization and their lateral association.
  
  d) What function (cell death, membrane integrity or others) is most correlated with this structural feature? In our extracellular model, we have shown that the conformation and sequence properties of the Nt17 domain are key determinants of the internalization and the subcellular localization of Httex1 fibrils in primary striatal neurons. Httex1 43Q fibrils mostly accumulate at the outer side of the neuronal plasma membrane, Httex1-ΔNt17 43Q fibrils were detected primarily in the nucleus and the M8P-Httex1 43Q fibrils were equally distributed in the cytosol and nucleus.
  
  Despite exhibiting completely different subcellular distribution and internalization levels, the 3 types of fibrils induced neuronal cell death with the highest toxicity observed for ∆Nt17-Httex1 (Figure 7).
  
  Our data suggest that the neurotoxic response is primarily dependent on the subcellular localization of the Httex1 species: 1) accumulation of the Httex1 43Q fibrils on the plasma membrane is likely to induce loss of membrane integrity, based on previous observation with aSyn fibrils; 2) the nuclear accumulation of ∆Nt17-Httex1 aggregates has been previously shown to be highly toxic in several cellular and animal models (10, 67, 68).
  
  Nevertheless, we could not rule out that the high toxicity of ΔNt17-Httex1 fibrils could also be due to their distinct biophysical and structural properties. ΔNt17-Httex1 forms broad fibrils characterized by lateral association, which could provide a surface for the sequestration of intracellular proteins.
  
  2) The authors claimed, “we investigated for the first time, the role of the Nt17 sequence, PTMs and conformation in regulating the internalization and cell-to-cell propagation of monomeric and fibrillar forms of mutant Httex1”. However, so far this reviewer understands that the authors studied the internalization but not cell-to-cell propagation.
  
  We agree and apologize for this mistake as we indeed only limited our study to the uptake, subcellular localization, and toxicity of extracellular Httex1 species in our primary neuronal model. The text has been amended, and cell-to-cell propagation has been removed from the abstract as well as in pages 2, 4, 12, and 17.
  
  Minor points for Referees #1, #2 and #3
  
  Referee #1
  
  « On page 6, the data on how the Nt17 domain affects Httex1 aggregation, the information on which figure it is referring to is missing. Done. The information regarding the Figure related to this data has now been added page 6.
  
  In Figure 1A, it is difficult to compare the data on Nt17 and DNt17, particularly for 36Q and 42Q, as the time axis are different. I understand that the kinetics are different, but particularly for the 42Q peptides (Nt17 and DNt17) as their kinetics are not that different, it may be useful to show them in the same panel. »
  
  Done. The new panel that combined the data on Nt17 and DNt17 has now been added as Figure S1B.
  
  Referee #2
  
  1) “Fig 8 the color codes for PolyQ and PolyP need to be corrected. »
  
  Done.
  
  2) “It is a challenging technical problem to produce proteins which are rich in Pro and Gln content. But there is not enough experimental details provided in the methods. Please add detailed procedures for expression and purification of these proteins. »
  
  We thank referee #2 for recognizing the technical challenges to express and produce Httex1 proteins and mutants. The expression, purification and characterization methods of all the proteins used in this manuscript have been extensively detailed in our previous studies (8, 9, 11, 69-71). We have now added the relevant references in the method section (page 29).
  
  Referee #3
  
  1) « Fig.3B arrowhead could not be seen. »
  
  Done. Arrowheads are now added to Fig. 3B.
  
  2) « Fig.4A: what do arrows mean? No scale bars? »
  
  The arrows indicate the aggregates formed in HEK cells overexpressing Httex1 39Q and 72Q. This now added to the legend section of the Figure 4.
  
  The scale bars are already present in both the main and the insets images.
  
  3) « Fig.5A:no scale bars? »
  
  Done. Scale bars were added in the 4 images where they were missing.
  
  4) « Fig.S3. Height and length seem to be wrong. »
  
  The measurement of height and length are performed as in literature (72), and are consistent with previous studies (8, 9, 11).
  
  5) « Fig.S6C: hard to compare. D: What is Htt2-90? Also in Fig.S13. »
  
  We thank the referee for bringing this to our attention and apologize for the lack of consistency in the names used for the proteins studied in Figures S6 and S13. We realized that in Figures S6 and S13 the names of the proteins have been either mislabelled due to the dash that was misplaced or the same proteins have been named in different ways. We agree that this makes it difficult to compare the data between the different panels. We have now corrected our mistakes and Figures S6B and S13 have been updated accordingly.
  
  The name Htt2-90 corresponds to Httex1 expressed from amino acid 2 to amino acid 90, with the first N-terminal methionine removed.
  
  6) « There are many abbreviations difficult to understand in supplement. » Fig.S1 Htt18-90(Q18C) etc.
  
  His6-Intein Ssp stands for the Intein tagged with Histidine amino acid (6 units)
  
  Htt18-90(Q18C) means Httex1 expressed from amino acid 18 to amino acid 90 with the Glutamine (Q) in position 18 mutated in a Cysteine (C).
  
  Htt2-17 means Httex1 synthesized from amino acid 2 to amino acid 17, with the first N-terminal methionine removed.
  
  Htt18-90(Q18A) corresponds to Httex1 expressed from amino acid 18 to amino acid 90 with the Q in position 18 mutated in an Alanine (A).
  
  References
  
  M. E. MacDonald, S. Gines, J. F. Gusella, V. C. Wheeler, Huntington’s Disease. NeuroMolecular Medicine 4, 7-20 (2003).
  
  S. E. Andrew et al., The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington's disease. Nature genetics 4, 398-403 (1993).
  
  J. F. Gusella, M. E. MacDonald, Huntington's disease: the case for genetic modifiers. Genome Med 1, 80 (2009).
  
  J. M. Andresen et al., The relationship between CAG repeat length and age of onset differs for Huntington's disease patients with juvenile onset or adult onset. Ann Hum Genet 71, 295-301 (2007).
  
  A. S. Wagner et al., Self-assembly of Mutant Huntingtin Exon-1 Fragments into Large Complex Fibrillar Structures Involves Nucleated Branching. Journal of molecular biology 430, 1725-1744 (2018).
  
  Y. Sun, A. Savanenin, P. H. Reddy, Y. F. Liu, Polyglutamine-expanded Huntingtin Promotes Sensitization of N-Methyl-D-aspartate Receptors via Post-synaptic Density 95. Journal of Biological Chemistry 276, 24713-24718 (2001).
  
  A. Ansaloni et al., One-pot semisynthesis of exon 1 of the Huntingtin protein: new tools for elucidating the role of posttranslational modifications in the pathogenesis of Huntington's disease. Angewandte Chemie (International ed. in English) 53, 1928-1933 (2014).
  
  A. Chiki et al., Mutant Exon1 Huntingtin Aggregation is Regulated by T3 Phosphorylation-Induced Structural Changes and Crosstalk between T3 Phosphorylation and Acetylation at K6. Angewandte Chemie International Edition 10.1002/anie.201611750, 1-6 (2017).
  
  S. M. DeGuire et al., N-terminal Huntingtin (Htt) phosphorylation is a molecular switch regulating Htt aggregation, helical conformation, internalization, and nuclear targeting. Journal of Biological Chemistry 293, 18540-18558 (2018).
  
  K. Shen et al., Control of the structural landscape and neuronal proteotoxicity of mutant Huntingtin by domains flanking the polyQ tract. eLife 5, 1-29 (2016).
  
  S. Vieweg, A. Ansaloni, Z. M. Wang, J. B. Warner, H. A. Lashuel, An intein-based strategy for the production of tag-free huntingtin exon 1 proteins enables new insights into the polyglutamine dependence of Httex1 aggregation and fibril formation. Journal of Biological Chemistry 291, 12074-12086 (2016).
  
  J. Legleiter et al., Mutant huntingtin fragments form oligomers in a polyglutamine length-dependent manner in Vitro and in Vivo. Journal of Biological Chemistry 285, 14777-14790 (2010).
  
  B. Sahoo, D. Singer, R. Kodali, T. Zuchner, R. Wetzel, Aggregation behavior of chemically synthesized, full-length huntingtin exon1. Biochemistry 53, 3897-3907 (2014).
  
  J. C. Boatz et al., Protofilament structure and supramolecular polymorphism of aggregated mutant huntingtin exon 1. Journal of molecular biology 10.1016/j.matdes.2019.108334 (2020).
  
  F. J. B. Bäuerlein et al., In Situ Architecture and Cellular Interactions of PolyQ Inclusions. Cell 171, 179-187.e110 (2017).
  
  A. Iwata, B. E. Riley, J. A. Johnston, R. R. Kopito, HDAC6 and microtubules are required for autophagic degradation of aggregated Huntingtin. Journal of Biological Chemistry 280, 40282-40292 (2005).
  
  M. Kim et al., Mutant Huntingtin Expression in Clonal Striatal Cells : Dissociation of Inclusion Formation and Neuronal Survival by Caspase Inhibition. The Journal of neuroscience : the official journal of the Society for Neuroscience 19, 964-973 (1999).
  
  Y. E. Kim et al., Soluble Oligomers of PolyQ-Expanded Huntingtin Target a Multiplicity of Key Cellular Factors. Molecular cell 63, 950-964 (2016).
  
  H. Luo et al., Herp Promotes Degradation of Mutant Huntingtin: Involvement of the Proteasome and Molecular Chaperones. Molecular neurobiology 10.1007/s12035-018-0900-8 (2018).
  
  T. R. Peskett et al., A Liquid to Solid Phase Transition Underlying Pathological Huntingtin Exon1 Aggregation. Molecular cell 10.1016/j.molcel.2018.04.007, 1-14 (2018).
  
  N. Riguet et al., Disentangling the sequence, cellular and ultrastructural determinants of Huntingtin nuclear and cytoplasmic inclusion formation. bioRxiv 10.1101/2020.07.29.226977, 2020.2007.2029.226977 (2020).
  
  K. Tagawa et al., Distinct aggregation and cell death patterns among different types of primary neurons induced by mutant huntingtin protein. Journal of Neurochemistry 89, 974-987 (2004).
  
  Z. Zheng, A. Li, B. B. Holmes, J. C. Marasa, M. I. Diamond, An N-terminal nuclear export signal regulates trafficking and aggregation of huntingtin (Htt) protein exon 1. Journal of Biological Chemistry 288, 6063-6071 (2013).
  
  S. W. Davies et al., Formation of Neuronal Intranuclear Inclusions Underlies the Neurological Dysfunction in Mice Transgenic for the HD Mutation. Cell 90, 537-548 (1997).
  
  L. Mangiarini et al., Exon I of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87, 493-506 (1996).
  
  D. Martindale et al., Length of huntingtin and its polyglutamine tract influences localization and frequency of intracellular aggregates. Nature genetics 18, 150-154 (1998).
  
  J. Ochaba et al., PIAS1 Regulates Mutant Huntingtin Accumulation and Huntington's Disease-Associated Phenotypes In Vivo. Neuron 90, 507-520 (2016).
  
  G. Schilling et al., Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Human Molecular Genetics 8, 397-407 (1999).
  
  G. Matsumoto, S. Kim, R. I. Morimoto, Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Molecular Properties in Human Cells. The Journal of biological chemistry 281, 4477-4485 (2006).
  
  S. Waelter et al., Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Molecular biology of the cell 12, 1393-1407 (2001).
  
  A. Chongtham et al., Effects of flanking sequences and cellular context on subcellular behavior and pathology of mutant HTT. Human molecular genetics 29, 674-688 (2020).
  
  T. Maiuri, T. Woloshansky, J. Xia, R. Truant, The huntingtin N17 domain is a multifunctional CRM1 and ran-dependent nuclear and cilial export signal. Human Molecular Genetics 22, 1383-1394 (2013).
  
  C. Landles et al., Subcellular Localization And Formation Of Huntingtin Aggregates Correlates With Symptom Onset And Progression In A Huntington’S Disease Model. Brain Communications 2 (2020).
  
  C. Cariulo et al., Phosphorylation of huntingtin at residue T3 is decreased in Huntington’s disease and modulates mutant huntingtin protein conformation. Proceedings of the National Academy of Sciences 10.1073/pnas.1705372114, 201705372-201705372 (2017).
  
  R. N. Hegde et al., TBK1 phosphorylates mutant Huntingtin and suppresses its aggregation and toxicity in Huntington's disease models. The EMBO journal 10.15252/embj.2020104671, e104671 (2020).
  
  L. M. Thompson et al., IKK phosphorylates Huntingtin and targets it for degradation by the proteasome and lysosome. Journal of Cell Biology 187, 1083-1099 (2009).
  
  R. S. Atwal et al., Kinase inhibitors modulate huntingtin cell localization and toxicity. Nature chemical biology 7, 453-460 (2011).
  
  A. Bhattacharyya et al., Oligoproline effects on polyglutamine conformation and aggregation. Journal of molecular biology 355, 524-535 (2006).
  
  S. Chen, V. Berthelier, W. Yang, R. Wetzel, Polyglutamine aggregation behavior in vitro supports a recruitment mechanism of cytotoxicity. Journal of molecular biology 311, 173-182 (2001).
  
  S. L. Crick, K. M. Ruff, K. Garai, C. Frieden, R. V. Pappu, Unmasking the roles of N- and C-terminal flanking sequences from exon 1 of huntingtin as modulators of polyglutamine aggregation. Proceedings of the National Academy of Sciences 110, 20075-20080 (2013).
  
  K. Kar, M. Jayaraman, B. Sahoo, R. Kodali, R. Wetzel, Critical nucleus size for disease-related polyglutamine aggregation is repeat-length dependent. Nature Structural and Molecular Biology 18, 328-336 (2011).
  
  R. Mishra et al., Serine phosphorylation suppresses huntingtin amyloid accumulation by altering protein aggregation properties. Journal of molecular biology 424, 1-14 (2012).
  
  A. K. Thakur et al., Polyglutamine disruption of the huntingtin exon1 N-terminus triggers a complex aggregation mechanism Ashwani. Nat Struct Mol Biol 16, 380-389 (2009).
  
  D. Bulone, L. Masino, D. J. Thomas, P. L. San Biagio, A. Pastore, The interplay between PolyQ and protein context delays aggregation by forming a reservoir of protofibrils. PloS one 1, e111 (2006).
  
  L. Masino, G. Kelly, K. Leonard, Y. Trottier, A. Pastore, Solution structure of polyglutamine tracts in GST-polyglutamine fusion proteins. FEBS Letters 513, 267-272 (2002).
  
  Y. Nagai et al., A toxic monomeric conformer of the polyglutamine protein. Nature Structural and Molecular Biology 14, 332-340 (2007).
  
  E. J. Bennett, N. F. Bence, R. Jayakumar, R. R. Kopito, Global Impairment of the Ubiquitin-Proteasome System by Nuclear or Cytoplasmic Protein Aggregates Precedes Inclusion Body Formation. Molecular cell 17, 351-365 (2005).
  
  C. W. Bugg, J. M. Isas, T. Fischer, P. H. Patterson, R. Langen, Structural features and domain organization of huntingtin fibrils. Journal of Biological Chemistry 287, 31739-31746 (2012).
  
  P. R. Dahlgren et al., Atomic force microscopy analysis of the Huntington protein nanofibril formation. Nanomedicine: Nanotechnology, Biology, and Medicine 1, 52-57 (2005).
  
  W. C. Duim, Y. Jiang, K. Shen, J. Frydman, W. E. Moerner, Super-resolution fluorescence of huntingtin reveals growth of globular species into short fibers and coexistence of distinct aggregates. ACS Chemical Biology 9, 2767-2778 (2014).
  
  J. M. Isas, R. Langen, A. B. Siemer, Solid-State Nuclear Magnetic Resonance on the Static and Dynamic Domains of Huntingtin Exon-1 Fibrils. Biochemistry 54, 3942-3949 (2015).
  
  J. Legleiter et al., Monoclonal antibodies recognize distinct conformational epitopes formed by polyglutamine in a mutant huntingtin fragment. Journal of Biological Chemistry 284, 21647-21658 (2009).
  
  E. Monsellier, V. Redeker, G. Ruiz-Arlandis, L. Bousset, R. Melki, Molecular interaction between the chaperone Hsc70 and the N-terminal flank of huntingtin exon 1 modulates aggregation. Journal of Biological Chemistry 290, 2560-2576 (2015).
  
  P. J. Muchowski et al., Hsp70 and Hsp40 chaperones can inhibit self-assembly of polyglutamine proteins into amyloid-like fibrils. Proceedings of the National Academy of Sciences 97, 7841-7846 (2000).
  
  Y. Nekooki-machida et al., Distinct conformations of in vitro and in vivo amyloids of huntingtin-exon1 show different cytotoxicity. Proceedings of the National Academy of Sciences 106, 9679-9684 (2009).
  
  L. G. Nucifora et al., Identification of novel potentially toxic oligomers formed in vitro from mammalian-derived expanded huntingtin exon-1 protein. Journal of Biological Chemistry 287, 16017-16028 (2012).
  
  L. Pieri, K. Madiona, L. Bousset, R. Melki, Fibrillar α-synuclein and huntingtin exon 1 assemblies are toxic to the cells. Biophysical Journal 102, 2894-2905 (2012).
  
  M. A. Poirier et al., Huntingtin spheroids and protofibrils as precursors in polyglutamine fibrilization. Journal of Biological Chemistry 277, 41032-41037 (2002).
  
  E. Scherzinger et al., Huntingtin encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell 90, 549-558 (1997).
  
  E. Scherzinger et al., Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: implications for Huntington's disease pathology. Proceedings of the National Academy of Sciences of the United States of America 96, 4604-4609 (1999).
  
  J. L. Wacker, M. H. Zareie, H. Fong, M. Sarikaya, P. J. Muchowski, Hsp70 and Hsp40 attenuate formation of spherical and annular polyglutamine oligomers by partitioning monomer. Nature Structural and Molecular Biology 11, 1215-1222 (2004).
  
  M. Jayaraman et al., Kinetically competing huntingtin aggregation pathways control amyloid polymorphism and properties. Biochemistry 51, 2706-2716 (2012).
  
  A. K. Thakur, W. Yang, R. Wetzel, Inhibition of polyglutamine aggregate cytotoxicity by a structure-based elongation inhibitor. FASEB J 18, 923-925 (2004).
  
  D. W. Colby et al., Potent inhibition of huntingtin aggregation and cytotoxicity by a disulfide bond-free single-domain intracellular antibody. Proceedings of the National Academy of Sciences of the United States of America 101, 17616-17621 (2004).
  
  S. Tam, R. Geller, C. Spiess, J. Frydman, The chaperonin TRiC controls polyglutamine aggregation and toxicity through subunit-specific interactions. Nature Cell Biology 8, 1155-1162 (2006).
  
  R. S. Atwal et al., Huntingtin has a membrane association signal that can modulate huntingtin aggregation, nuclear entry and toxicity. Human Molecular Genetics 16, 2600-2615 (2007).
  
  X. Gu et al., N17 Modifies Mutant Huntingtin Nuclear Pathogenesis and Severity of Disease in HD BAC Transgenic Mice. Neuron 85, 726-741 (2015).
  
  M. B. Veldman et al., The N17 domain mitigates nuclear toxicity in a novel zebrafish Huntington's disease model. Molecular neurodegeneration 10, 67 (2015).
  
  M. s. Anass Chiki et al., One -pot Semi synthesis Of Exon1 Of The Mutant Huntingtin Protein : An Important Advance Towards Elucidating The Molecular And Structural Determinants Of Huntingtin's. Health and Biomedical, 1047-1047 (2014).
  
  A. Chiki et al., Site-specific phosphorylation of Huntingtin exon 1 recombinant proteins enabled by the discovery of novel kinases. Chembiochem : a European journal of chemical biology 10.1002/cbic.202000508 (2020).
  
  A. Reif, A. Chiki, J. Ricci, H. A. Lashuel, Generation of native, untagged huntingtin Exon1 monomer and fibrils using a SUMO fusion strategy. Journal of Visualized Experiments 2018, 1-9 (2018).
  
  F. S. Ruggeri, T. Šneideris, M. Vendruscolo, T. P. J. Knowles, Atomic force microscopy for single molecule characterisation of protein aggregation. Arch Biochem Biophys 664, 134-148 (2019).
  
  PeerReviewed
2. EMBOpress 09 Apr 2021
  
  in Review Commons
  
  Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.
  
  Learn more at Review Commons
  
  Referee #3
  
  Evidence, reproducibility and clarity
  
  The authors investigated the structural feature of N-terminal amino acid (Nt17) of Huntingtin, the gene product of Huntington disease. Nt17 was reported to play roles in modulating Huntingtin's aggregation, its life cycle, membrane binding and toxicity, however, those reports used tagged Nt17 and the authors thought the tags have the potential influence to the aggregation process and others and used tag-free Nt17-huntingtin exon1(Httex1) protein. Using Nt17 deleted Httex1 and mutant which disrupt helix conformation such as M8P, and phosphorylated Nt17, they found Nt17 sequence but not its helical conformation determined the morphology and growth of Httex1 fibrils in vitro. In cells, Nt17 sequence and its helical conformation influenced on aggregation propensity and toxic properties. Furthermore, the uptake o Httex1 into primary striatal neurons is influenced by the helical propensity of Nt17. They concluded Nt17 domain serves as the master regulator of Htt aggregation and toxicity. Their findings provided the precise information for the role of tag-free Nt17.
  
  Major concerns:
  
  1) Finding of lateral association(bundling) of ΔNt17-Httex1 fibrils is interesting. However, pathological significance is not clear. a) Does even non-truncated form also increase this kind of bundling when polyQ is expanded? b) When fibrils are added to striatal neurons like in Fig.5, is this structural feature preserved on the membrane or inside of the cells? c) When Httex1 fibrils species are expressed, is this bundling also observed? d) What function (cell death, membrane integrity or others) is most correlated with this structural feature?
  
  2) The authors claimed < we investigated for the first time, the role of the Nt17 sequence, PTMs and conformation in regulating the internalization and cell-to-cell propagation of monomeric and fibrillar forms of mutant Httex1.>. However, so far this reviewer understand, the authors studied the internalization but not cell-to-cell propagation.
  
  Minor points
  
  1) Fig.3B arrowhead could not be seen.
  
  2) Fig.4A: what do arrows mean? The insets are hard to identify. No scale bars?
  
  3) Fig.5A:no scale bars?
  
  4) Fig.S3. Height and length seem to be wrong.
  
  5) Fig.S6C: hard to compare. D:What is Htt2-90? Also in Fig.S13.
  
  6) There are many abbreviations difficult to understand in supplement. Fig.S1 Htt18-90(Q18C) etc.
  
  Significance
  
  The paper advanced our knowledge of Nt17, especially in the Huntington disease field. However, the conceptual advance is limited.
  
  PeerReviewed
3. EMBOpress 09 Apr 2021
  
  in Review Commons
  
  Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.
  
  Learn more at Review Commons
  
  Referee #2
  
  Evidence, reproducibility and clarity
  
  This article describes the results from studies into mechanisms of the aggregation and toxicity of Htt Exon1 protein. The authors investigated role of N17, polyQ length, M9C mutation, and phosphorylation. Multiple approaches were used that included biochemical protein design, biophysical measurements, and cell biological experiments with cultured mammalian cells. The authors demonstrates effects of protein context on aggregation. Furthermore, the authors were able to visualize the aggregates in mammalian cells and in neurons using multiple methods. These are interesting data, but there are several major weaknesses in the study. First problem is that most of the results related to aggregation mechanisms and toxicity are not original and incremental when compared to many previously published articles. Moreover, there are several problems in interpretation of obtained data and in making conclusions. Some of the most critical problems are listed below.
  
  The main hypothesis of this study solely depends on the ability of N17 domain to enhance aggregation (Fig 1 and Fig 2). According to the method for the protein solubilization 1mM TCEP was added to ∆Htt-Ex1, but not to Htt-Ex1 proteins. It is necessary to rule out potential effects of TCEP on aggregation assay.
  
  The author needs to provide biophysical data of the mutation and phosphorylated proteins with/without Tag. As stated by the authors, even the slight change in a protein context could lead to unexpected changes in structural behavior of a protein. Thus, importance of Tag needs to be evaluated.
  
  It is a challenging technical problem to produce proteins which are rich in Pro and Gln content. But there is not enough experimental details provided in the methods. Please add detailed procedures for expression and purification of these proteins.
  
  Fig 8 the color codes for PolyQ and PolyP need to be corrected.
  
  Significance
  
  This article describes the results from studies into mechanisms of the aggregation and toxicity of Htt Exon1 protein. The authors investigated role of N17, polyQ length, M9C mutation, and phosphorylation. Multiple approaches were used that included biochemical protein design, biophysical measurements, and cell biological experiments with cultured mammalian cells. The authors demonstrates effects of protein context on aggregation. Furthermore, the authors were able to visualize the aggregates in mammalian cells and in neurons using multiple methods. These are interesting data, but there are several major weaknesses in the study. First problem is that most of the results related to aggregation mechanisms and toxicity are not original and incremental when compared to many previously published articles. Moreover, there are several problems in interpretation of obtained data and in making conclusions. Some of the most critical problems are listed below.
  
  The main hypothesis of this study solely depends on the ability of N17 domain to enhance aggregation (Fig 1 and Fig 2). According to the method for the protein solubilization 1mM TCEP was added to ∆Htt-Ex1, but not to Htt-Ex1 proteins. It is necessary to rule out potential effects of TCEP on aggregation assay.
  
  The author needs to provide biophysical data of the mutation and phosphorylated proteins with/without Tag. As stated by the authors, even the slight change in a protein context could lead to unexpected changes in structural behavior of a protein. Thus, importance of Tag needs to be evaluated.
  
  It is a challenging technical problem to produce proteins which are rich in Pro and Gln content. But there is not enough experimental details provided in the methods. Please add detailed procedures for expression and purification of these proteins.
  
  Fig 8 the color codes for PolyQ and PolyP need to be corrected.
  
  PeerReviewed
Visit annotations in context

Tags

PeerReviewed

Annotators

EMBOpress

URL

biorxiv.org/content/10.1101/2021.02.15.431207v1
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.06.438630

1
1. sciscore 08 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.06.438630: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Use of healthy volunteer PBMC for this project, including those from WBS, was ethically approved by the Cardiff University School of Medicine Research Ethics Committee (SMREC) nos. 20/55 and 20/101.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used were against HLA-ABC (W632; AbD Serotec), NCR3LG1/B7-H6 (MAB7144, Biotechne R&D Systems), Nectin 1 (R1.302; Biolegend), MICA (AMO1-100; BAMOMAB), MICB (BMO2-100; BAMOMAB), ULBP2 (BUMO1; BAMOMAB), Spike (1A9; Insight), Nucleocapsid (1C7; Stratech), anti-mouse IgG AF647 (Thermofisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HLA-ABC</div><div>suggested: (Leica Biosystems Cat# NCL-HLA-ABC, RRID:AB_563879)</div></div><div style="margin-bottom:8px"><div>MAB7144</div><div>suggested: (R and D Systems Cat# MAB7144, RRID:AB_2636810)</div></div><div style="margin-bottom:8px"><div>BMO2-100</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BAMOMAB</div><div>suggested: (BAMoMAB Cat# BM02-100, RRID:AB_2636812)</div></div><div style="margin-bottom:8px"><div>ULBP2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (SouthernBiotech Cat# 1030-31, RRID:AB_2794301)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cells were harvested using TrypLE Express (Gibco), preincubated for 30 min with the relevant antibody or serum preparations, then mixed with PBMCs at an effector:target (E:T) ratio of 10:1 in the presence of GolgiStop (0.7 μl/ml, BD Biosciences), Brefeldin-A (1:1000, Biolegend) and anti-CD107a–FITC (clone H4A3, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Brefeldin-A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD107a–FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody (anti-nucleocapsid 1C7, Stratech, 1:500 dilution) was added in PBST containing 1% non-fast milk and incubated for 1h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing in PBST, secondary antibody (anti-mouse IgG-HRP, Pierce, 1:3,000 dilution) was added in PBST containing 1% non-fat milk and incubated for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody depletions: Anti-spike antibody was depleted from sera using magnetic bead conjugated spike trimer protein (Acrobiosystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: A549 were transduced with lentiviruses expressing human ACE2, and TMPRSS2 (AAT cells), as previously described 27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The England2 strain of SARS-CoV2 was obtained from Public Health England (PHE), grown on VeroE6 cells, and titrated by plaque assay on both VeroE6 and AAT, as previously described27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were midiprepped (Nucleobond Xtra Midi; Machery-Nagel), and transfected into 293T cells using GeneJuice (Merck) according to manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were loaded onto a trapping column (300μm x 5mm PepMap cartridge trap (Thermo Fisher)) at 10μL/min for 5 minutes at 60 degrees.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PepMap</div><div>suggested: (BioWorks, RRID:SCR_014594)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During the gradient elution, mass spectra were acquired with the parameters detailed in Fig S4 using Tune v3.3 and Xcalibur v4.3 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository74 with the dataset identifier PXD025000 and 10.6019/PXD025000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional Annotation Clustering: Assessment of enriched gene annotation terms in temporal cluster one was carried out using the Functional Annotation Clustering tool at DAVID (david.ncifcrf.gov) v6.875, using the default clustering settings for medium stringency and the following libraries: Uniprot UP_Keyword, GOTERM:MF_ALL, BIOCARTA,, KEGG_PATHWAY and REACTOME_PATHWAY.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAVID</div><div>suggested: (DAVID, RRID:SCR_001881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and transfections: Lentivirus plasmids encoding each SARS-CoV2 ORF individually, with a C-terminal twin-strep tag, were obtained from Addgene76.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Addgene76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cells were harvested using TrypLE Express (Gibco), preincubated for 30 min with the relevant antibody or serum preparations, then mixed with PBMCs at an effector:target (E:T) ratio of 10:1 in the presence of GolgiStop (0.7 μl/ml, BD Biosciences), Brefeldin-A (1:1000, Biolegend) and anti-CD107a–FITC (clone H4A3, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired using an AttuneNxT (Thermo Fisher) and analyzed with Attune NxT software or FlowJo software version 10 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where sera were tested at a range of dilutions, the area under the curve (AUC) was calculated using Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.06.438630
www.jneurosci.org www.jneurosci.org

NOX1/NADPH oxidase promotes synaptic facilitation induced by repeated D2 receptor stimulation; involvement in behavioral repetition

1
1. scibot 08 Apr 2021
  
  in Public
  
  rabbit anti-DYKDDDDK tag
  
  DOI: 10.1523/JNEUROSCI.2121-20.2021
  
  Resource: (Cell Signaling Technology Cat# 2368, RRID:AB_2217020)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_2217020
  
  What is this?
  
  RRID:AB_2217020 RRIDCUR:Missing
Visit annotations in context

Tags

RRIDCUR:Missing

RRID:AB_2217020

Annotators

scibot

URL

jneurosci.org/content/41/12/2780
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.04.02.437747

1
1. sciscore 07 Apr 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.04.02.437747: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intermediate R&D preparations of swine glyco-humanized polyclonal antibody against SARS-CoV-2 have been prepared, presenting variable anti-SARS-CoV-2 binding activities 17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 binding activities 17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike/ACE-2 neutralization assay: An assay was developed to assess the properties of anti-SARS-CoV-2 spike antibodies to inhibit binding of ACE-2 to immobilized spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike RBD antibodies diluted in PBS-Tween-0.05%-1% skimmed milk (dilution range between 50 and 0.39 µg/mL) were then added and incubated for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1h incubation at room temperature and 3 washes, the mouse Fc tag was revealed with a specific HRP-conjugated anti-mouse IgG secondary antibody (diluted in in PBS-Tween-0.05%-1% skimmed milk powder at 1:1000, incubated 1h at RT and washed 3 times).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stocks were generated using one passage of isolates on Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CPE reduction assay was performed as follows: Vero E6 cells were seeded in 96-well clusters at a density of 5,000 cells/well 2 days before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 were analyzed by nonlinear regression using a four-parameter dosage-response variable slope model with the GraphPad Prism 8.0.2 software (GraphPad Software, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04453384</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Safety and Efficacy of XAV-19 in Patie…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04469179</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Pharmacokinetics of SAB-185 in Amb…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.04.02.437747
www.metacritic.com www.metacritic.com

Incredible Mandy

1
1. TylerRick 07 Apr 2021
  
  in Public
  
  nothing about the game is really offensive, but there’s just no hook that managed to keep me invested up to the end.
  
  annotation meta: may need new tag neutral not great/excellent/amazing
Visit annotations in context

Tags

not great/excellent/amazing

neutral

annotation meta: may need new tag

Annotators

TylerRick

URL

metacritic.com/game/switch/incredible-mandy
stackoverflow.com stackoverflow.com

Which semantic HTML tag for displaying side notes and admonitions?

11
1. TylerRick 06 Apr 2021
  
  in Public
  
  Which HTML tag I should use to enclose such notes to add a semantic meaning of a note that may be useful to read at a given point of a tutorial, but is not part of the main tutorial flow?
  
  good question semantic meaning semantic markup
2. TylerRick 06 Apr 2021
  
  in Public
  
  good question I have this question too HTML: <aside>
3. TylerRick 06 Apr 2021
  
  in Public
  
  A better description is in the specification itself. Why read secondary remarks when the source is written so good?
  
  prefer primary source over secondary source why _ when _?
4. TylerRick 06 Apr 2021
  
  in Public
  
  I respectfully disagree with your assessment. You are referencing the quote "It's not appropriate to use the aside element just for parentheticals, since those are part of the main flow of the document." However the OP specifically said that they are looking for a semantic element for "a note that may be useful to read at a given point of a tutorial, but is not part of the main tutorial flow". That is what "aside" is for. It's not part of the main content flow.
  
  That's a tough one. I can see it both ways.
  
  controversial everyone has different interpretation good question subjective open to interpretation respectfully disagree
5. TylerRick 06 Apr 2021
  
  in Public
  
  An admonition is a parenthetical
  
  admonition relationship: is a parenthetical
6. TylerRick 06 Apr 2021
  
  in Public
  
  <aside> is appropriate if the side note "could be considered separate from the content"
  
  From a programmer's perspective:
  
  It shouldn't be in an <aside>, if it is actually directly about what is in <main>
  
  An <aside> should be able to be evaluated on its own, (almost entirely) in isolation from, and not dependent on anything in, the <main> content. This could be especially important/relevant for screen readers.
  
  clarification definition/description HTML: <aside> appropriateness makes sense to me sidenote
7. TylerRick 06 Apr 2021
  
  in Public
  
  <aside> is not appropriate if the side note is "a parenthetical". The W3C gives no examples of what it means.
  
  appropriateness HTML: <aside> parenthetical ambiguous
8. TylerRick 06 Apr 2021
  
  in Public
  
  In my opinion, the W3C definition is unnecessarily confusing and restrictive. The dictionary definition of aside is "a temporary departure from a main theme or topic", and the spec should just stick to that, rather than introducing subtle distinctions.
  
  aside definition I agree confusing unnecessarily restrictive subtle distinction
9. TylerRick 06 Apr 2021
  
  in Public
  
  I believe the accepted answer is not quite correct. According to the HTML5 working draft, the <aside> element can be used to mark up side notes in certain, but not all cases:
  
  subtle distinction
10. TylerRick 06 Apr 2021
  
  in Public
  
  Of course, there is no reason why you can't use <aside> for all sidenotes, if it makes your code simpler. Think of it as civil disobedience. :)
  
  civil disobedience use what works for you you can do whatever you want
11. TylerRick 06 Apr 2021
  
  in Public
  
  The dictionary definition of aside is "a temporary departure from a main theme or topic"
  
  tangentially related content (aside) definition aside
Visit annotations in context

Tags

parenthetical

sidenote

I agree

unnecessarily restrictive

clarification

controversial

you can do whatever you want

semantic meaning

HTML: <aside>

relationship: is a

definition/description

respectfully disagree

I have this question too

makes sense to me

definition

ambiguous

everyone has different interpretation

subtle distinction

subjective

prefer primary source over secondary source

aside

open to interpretation

semantic markup

civil disobedience

use what works for you

good question

tangentially related content (aside)

confusing

why _ when _?

admonition

appropriateness

Annotators

TylerRick

URL

stackoverflow.com/questions/7579826/which-semantic-html-tag-for-displaying-side-notes-and-admonitions
www.plymouth.edu www.plymouth.edu

9780199554232_000i-00ii_Sodhi_Biology_color_Htitle 1..2

1
1. abbeykuzma 06 Apr 2021
  
  in Public
  
  Subsequent maintenance requires an expenditureof under US$10 per acre every two to three years
  
  It is truly sad that our country will dump so much money into infrastructure and politics but not conservation and ecosystem management. I know everything has a cost, but with so many billionaires and overall wealthy people in this country, conservation efforts should be one of the lead measures to consider. Putting a price tag on our ecosystems is just so disturbing. Without our biodiversity and ecosystems, money, politics and every other issue is completely irrelevant.
Visit annotations in context

Annotators

abbeykuzma

URL

plymouth.edu/courses/pluginfile.php/1878178/mod_resource/content/1/Chapter12.pdf
www.yourdictionary.com www.yourdictionary.com

Tangentially Meaning | Best 2 Definitions of Tangentially

1
1. TylerRick 06 Apr 2021
  
  in Public
  
  Tangentially is defined as briefly mentioning a subject but not going into it in detail, or is defined as going off in a different direction.
  
  in the case of
  
  briefly mentioning a subject but not going into it in detail the topic/subject need not be related at all (it sounds like).
  
  What about in the case fo:
  
  is defined as going off in a different direction. Does the fact that it's going off in a different direction imply that it at least starts out connected/related to the original (starting point) subject (as it does in the geometry sense of tangential)? Or does it permit "jumping" to another topic (in another direction) without being related/connected at all??
  
  I don't think I like this definition very much. It doesn't quite fit the sense I'm trying to use it for in my tag:
  
  tangentially related content (aside)
  
  Ah, here's a definition that matches what I thought it meant (one of the senses anyway): https://hyp.is/3Bn2bpZ7Eeu3Ok8vg03AVA/www.merriam-webster.com/dictionary/tangential
  
  tangentially related content (aside) definition I have a question about this
Visit annotations in context

Tags

definition

I have a question about this

tangentially related content (aside)

Annotators

TylerRick

URL

yourdictionary.com/tangentially
www.edutopia.org www.edutopia.org

Putting Learning First With New Tech Tools | Edutopia

1
1. tessmeram 05 Apr 2021
  
  in Public
  
  The digital tools many students have access to both inside and outside the classroom require us all to take a hard look at the way we use these tools in the context of learning experiences. It’s easy to get caught up with the shiniest, brightest, or most attention-grabbing digital device or website, but it is possible to pause, reflect, and prioritize tasks over digital tools in the classroom. Are we putting the learning first?
  
  This is a valid point, but it also creates an issue of equitability for students too. The digital world comes with a price tag that often has to be footed by underfunded school districts in order to make sure that all students have access to the tools.
Visit annotations in context

Annotators

tessmeram

URL

edutopia.org/article/putting-learning-first-new-tech-tools
www.sciencedaily.com www.sciencedaily.com

Exercise can tackle symptoms of schizophrenia

1
1. Drugs_and_Ethics 05 Apr 2021
  
  in Public
  
  Exercise can tackle symptoms of schizophrenia
  
  Not only am I unsurprised by this, but I'd be surprised if it were otherwise. The logic is that schizophrenia is a sleep disorder, and exercise enhances sleep. Additionally, lack of movement is one of the negative symptoms of schizophrenia. Therefore, this poverty of movement may play a role in the pathogenesis of schizophrenia symptoms.
  
  I need to start a google search document with predictions prior to actually searching. It will slow down my research speed, but it is necessary in order to provide unbiased data on my intuitive understanding of diseases. It seems like the majority of my strong intuitions are true. Edit: I'll just record the search phrase in my hypothes.is notes. This one was "exercise schizophrenia"
  
  schizophrenia exercise sleep theory hypothesis search tag
Visit annotations in context

Tags

theory

exercise

search tag

sleep

hypothesis

schizophrenia

Annotators

Drugs_and_Ethics

URL

sciencedaily.com/releases/2016/08/160812073654.htm
www.archion.de www.archion.de

Viewer - Archion

1
1. Falke 04 Apr 2021
  
  in Public
  
  Bild 308
  
  1742
  
  20.10. Johann Gottlob Klotzsche, Benjamin Heinrich Klotzsche, 4 Jahre, 12 Wochen, 1 Tag
  
  death
Visit annotations in context

Tags

death

Annotators

Falke

URL

archion.de/de/viewer/
www.kickstarter.com www.kickstarter.com

Update 16: More Unlocked Stretch Goals & a Preliminary Rule Book · Stellaris Infinite Legacy

1
1. TylerRick 04 Apr 2021
  
  in Public
  
  We use an online editing program called ProofHQ, where you and our development team will review the rules, discuss ideas, and add comments and suggestions, so that these rules are of the same high quality as our other game rules. We have used this process for years, because integrating outside eyes and ears is an invaluable asset.
  
  having more eyes is better
  
  annotation meta: may need new tag board games: rulebook editing
Visit annotations in context

Tags

editing

annotation meta: may need new tag

board games: rulebook

Annotators

TylerRick

URL

kickstarter.com/projects/academygames/stellaris-infinite-legacy
www.sciencedirect.com www.sciencedirect.com

Asterix/Gtsf1 links tRNAs and piRNA silencing of retrotransposons

1
1. scibot 01 Apr 2021
  
  in Public
  
  StrepMAB-Classic (murine Strep-tag® II specific monoclonal)
  
  DOI: 10.1016/j.celrep.2021.108914
  
  Resource: (IBA GmbH Cat# 2-1507-001, RRID:AB_513133)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_513133
  
  What is this?
  
  RRIDCUR:Missing RRID:AB_513133
Visit annotations in context

Tags

RRIDCUR:Missing

RRID:AB_513133

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S221112472100228X

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Tags

Annotators

URL

Annotators

URL

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Annotators

URL

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Tags

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Tags

Annotators

Annotators

URL

Annotators

URL

Tags

Annotators

URL