The feeling that this quote gives me is that, it might seem that everyone is out to get him because they want to consume his body. People in the town seem to have hated him, as it was shown before because of the looks they gave him, so they wanted to eat him. Here it is demonstrated that he is well aware of the situation since they did the same thing to a "bad" man. Since he's cured of his paranoia perhaps that is the reason why they want to eat him. He has no doubts they will try to kill him just to consume him since he clearly states "If they are capable of eating people, the who's to say they won't eat me?" Which is an understandable idea to assume in his case.

This statement is repeated twice, once on page 30 and on this page again. As we know, repetition is used to bring attention to an idea, and often emphasize its importance. This repetition, not only makes me understand what he feels (because there's things that I think about, that give me the same exact feeling), but it also makes understand why he "can never get to sleep at night". He's so haunted by this thought of cannibalism, and how he can be the next victim, that if he thinks about this at night, I understand that it might be impossible to get any sleep, especially after getting a shiver that's twice as intense (because he mentions it twice), running from the top of his head down to the tips of his toes. If we analyze this statement, we'll notice that this shiver starts on his head, which means it also awakens and freezes his mind, and if his mind is frozen (since we know that the brain controls body movements), then his entire body is frozen, hence why he feels that "shiver" through his entire structure.

In the dialogue, the ellipses show that the talker pauses shortly in his sentence. When the talker says "uh" and changes the subject to the weather, it shows how right the "madman" is. It is like the roles have reversed. The "madman" is not the ill one anymore because everyone else is mad for eating people. Also, I notice that the topic of cannibalism is sensitive. Society accepts cannibalism, but it is not a topic that people talk about openly. This dialogue is the first conversation that seems like it is not in the madman's head. Every other encounter, the madman interprets people's facial expressions as wanting to eat him. This dialogue makes me wonder why society is being secretive about cannibalism if they know that everyone does it because it is the norm? Also, does this dialogue prove that the madman is getting better? The fact that he can have a real interactive conversation that it is not in his head seems like there is some change.

When I first read this book I was confused but after reading this line it was clear that this man was obviously paraniod and told himself things that were not true. He thought everyone was going to eat him. Every time someone looked in his direction or smiled at him he thought they were going to attack him. It makes me think did he witness something or maybe something tragic happened in his life to make him think someone is going to eat him alive?

At first i thought why did he shiver, but then i realized what will happen. I felt the shiver run through me once I read the end of the sentence. The author gave us a feeling of showing and not telling. The fact that this man is fearful and knows what's going on and still goes out shows how strong he is. A reader can picture what is going on by how the author is explaining the looks and how the character felt from the other sentences above. I believe from this, he is a strong character since he is walking around knowing what's going to happen.

I'm assuming Tom Dacre's a child.

The Narrator points out that Tom's head being shaved is not too bad in the grand scheme of things, and could be worse, as with the end of life and old age.

Describing Tom Dacre's shaven head as a lamb's helps emphasis the innocence of the young children who had to work in these jobs. Also , it shows the lamb and the children having the same innocence as they both came from god.

the sorrows of your mind cannot plague you when your head is bare ( figuratively when your mind is devoid of thought)

Yunior needs something new to keep his adrenaline running. It’s an easy way to keep his mind occupied with something else other than women. Although later Yunior does suffer from multiple health issues, he later figures out what might be best for him.

Yunior's dedication to some sort of exercise shows that he is very concerned with his own self improvement. He uses Yoga, biking and running as ways to distract himself from his destructive ways to the point of near torture as he keeps getting injured from his exercises but he continues to search for some sort of escape from having to directly confront his issues because he feels like he can't handle it if he had no other option.

Morphology does not equal specimens being the same. Even in species of lower classification with less variation, we know that is true. With humans, who show incredible variation, this is especially true- pointing out the need for genetic and molecular methods to get to the true basis of relationships between people and people groups.

Why? This sounds an awful lot like a human version of like "If there is no hell why not go murder and rape everyone".

The Biblical parallelism here is referring to John the Baptist's beheading. He is saying that even though he has cried, fasted, and prayed, he will still face death. I read this as somewhat of a lament, because even though he could do the "right" things, death is still inevitable and he is grieving that ahead of time.

This is yet another refrence to the bible, referring to John the Baptist, the man who baptized Jesus and died after the stepdaughter of a powerful king asked for his head on a platter. It is now one of the most sought after Christain relics, though no one knows if the head they pocess is truly John's. Prufrock is essentially saying he doesn't want to be confused for a prophet and shouldn't be taken seriously in that sense.

I feel like this is another reference to death and that his head being brought in upon a platter is like his life is being served up to him and that his time is ending. However he states that he's not a prophet and to lighten the mood rhymes it with it not being a great matter. So he is trying to dissuade himself from thinking that his life is ending by going along with he doesn't know what he is talking about.

These 5 lines in the stanza describe the speaker's physical appearance. He says that he dresses in nice clothes, but he is afraid of people taking notice of his balding head and his thin arms and legs. This could show the speaker's insecurities. He knows he is not attractive and he tries to make up for it by wearing nice clothes. He seems to be imagining that people will notice his flaws, which is why he predicts that others will comments on his hair and thin limbs.

What comes to mind about this phrase is an aspect of religion, especially in the Bible. In the Bible, the Second Coming is regarding the future, the return of Jesus Christ after he ascended into heaven, and it is talked about in the book of Revelation, (ironically, during the due time on Easter). I do think that Yeats brings in a religious aspect. However, I don't think it is in any way Christianity because, in the following line, he talks about Spiritus Mundi, which I believe is another spiritual figure mixed with a lion and the head of a man. (Side note: that description of Spiritus Mundi, reminds me of Narnia.)

This simile stands out to me, as I have noticed it is the only simile in the entire poem. It emphasizes the vast "pitiless" the sun offers us, and makes it almost evil which I believe is contrary to our perception of the sun. Traditionally sun is associated with light, warmth, life, and happiness yet in this poem Yeats associates the sun with the mass destruction that is coming. Pitiless makes me think that the sun spares no one in it's destruction which really emphasizes the negative light this lion with a man's head is to bring. I think this simile is important to the poem as a whole as it contributes to the destruction this second coming will bring.

This seems to me to be an allusion to the Sphinx. In Greek tragedy Oedipus, the Sphinx gives riddles to passerbys of Thebes and killed those who could not answer the riddle (Citation. This allusion may be meant to evoke the horror of Oedipus killing his father and marrying his mother, something obviously horrendous.

This links the mind to the physical body. Our mind takes in our observations and sensations of the physical world and projects our emotions and feelings by using our facial muscles to change facial expressions to ones that appropriately match the emotion. We must use our physical body to communicate what our mind has concluded.

Data science leadership is sorely lacking

This might be because the tradgedy didn't prsonally affect the majority of the bystanders.

This is the first noticeable movement in the story. Everything before now has been internal thoughts within her head. The first movement is sparked by the terror she feels about what her father might do to her which is significant. Her feelings of self preservation from her father is what moves the story forward.

a very efficient opening--good. Remember to cite author when borrowing

blunt trauma can cause thrombosis of int jugular veins asymptotically, can cause cerebral edema if bilateral in serious head inj, and if ICP remained elevated stenting should be considered

systematic PE of head-neck like CN exam and maxillofacial 3d CT should be considered after initial stabilization

Great first draft! Some spelling and grammar errors but that is expected. It also shows you just wrote what was on your mind which is important for a first draft! Anyways, as you head into your second draft, i would try to maintain much of the same plot, maybe eliminate some side pieces to the story and elaborate on some of the points i alluded to in the annotations. Overall, a job well done. I can see the parts of the story that were drawn from in class assignments which is cool. The tech used in the story is very cool considering it takes place only 5 years in the future. That also makes it very scary at the same time. But the tech is very good and rooted in science which makes it cool. The plot is also very good and intriguing. Just keep it up in your second draft and keep the base of your story the same!

I think that wanting to see all of the colors is fine and even making something that allows you to detect them is fine, but I don't see the benefit to implanting it into your body.

I feel like everyone compares themselves to other people on social media when people only post the best parts of them. People also use photo shop and so people are comparing themselves to unrealistic people.

The previous piece used more informal language, as well as a particular visual structure. However, this piece flows with plain language. The speaker in the poem is telling his friend that he should venture outside where he can be one with nature because it contains more wisdom than books. Last but not least, the use of color stood out to me.This depiction of color seems to represent passing time, both from day to night, but perhaps from summer to fall.

If it affects other places other than eyes, should it really be called "digital eye strain?" I think it should just be digital muscle straining.

This made me think of all the heavily embedded slogans in my head. "Make America Great Again", "Yes we can", "I want you for U.S. Army", "Kars for Kids" Its true that the slogan must be popular. Even without any information about what the campaign or propaganda is about, its human nature to be for something when we remember it. Therefore slogans and catchy names will always have importance, Trump will always be known for his Phrase as will Obama, Uncle Sam, and any commercials!. It also just adds to the idea that propaganda isn't meant to be informative but just eye catchy and easily liked...

does lairen know this or are we learning this from Xavier while they head to the group meeting.

Wouldn't the fact that this school is "too competitive" make the child want to do even better in their classes? The real world is very competitive so this would give the children a head start in that sense.

Love your cover here--the illustration conveys the playful tone of your chapter. Can you fix it so that the head of the bookworm shows up?

the poet tries to show the world that they arent depressed

easily the worst combination of parenthetical action and fight scene. i just can't handle this bit :(

i find no redeeming value in these fight scenes. they're too long, but more importantly they just don't work with the medium. what am i getting out of watching this fight?

Reflog - shows the history of actions in the repo.

With this information, you can easily undo changes that have been made to a repository with git reset

git reflog

reflog animation

Say that we actually didn't want to merge the origin branch. When we execute the git reflog command, we see that the state of the repo before the merge is at HEAD@{1}. Let's perform a git reset to point HEAD back to where it was on HEAD@{1}!

reflog + reset animation

Hard reset - points HEAD to the specified commit.

Discards changes that have been made since the new commit that HEAD points to, and deletes changes in working directory

git reset --hard HEAD~2
git status

hard reset animation

Soft reset - points HEAD to the specified commit.

Keeps changes that have been made since the new commit the HEAD points to, and keeps the modifications in the working directory

git reset --soft HEAD~2
git status

soft reset animation

Reset - way to get rid of unwanted commits. We have soft and hard reset

Interactive rebase - makes it possible to edit commits before rebasing.

Creates new commits for the edited commits which history has been changed.

6 actions (options) of interactive rebase:

• reword: Change the commit message
• edit: Amend this commit
• squash: Meld commit into the previous commit
• fixup: Meld commit into the previous commit, without keeping the commit's log message
• exec: Run a command on each commit we want to rebase
• drop: Remove the commit

git rebase -i HEAD~3

drop animation

squash animation

could this be at the top of the page? seems like one of the first things an academic would have to review

shows how our inner worlds reflect that of one that uses dunk tank clowns. We are always insulting people in our heads, the clowns are just brave enough to actually voice those thoughts.

short sentence of "In your head" gives emphasis!!

The next day all of the head officials had been contacted about what had happened. They elected to get Pondurance, Inc a cybersecurity specialist involved and ended up having the FBI involved as well. They worked together to find what went wrong and where it was coming from.

So I spoke about this in my discussion group. Miss Lora is about twice Yunior's age, and their whole relationship is considered rape. I find that if your read between the lines, Yunior is not happy with their relationship and that it's actually a traumatizing experience for him that he will never actually admit to it because of his machisimo aspect. He tells her "I have a girlfriend" seemingly like yeahhh this should stop. But Miss Lora doesn't care, and when hass Yunior ever cared about cheating on his girlfriend so far? And Miss Lora treats him like a son and uses and emotionally abuses him like he's a prize that she won. She says how much he's like his brother and fawns over Rafa while she's with Yunior. Not only is this older woman messing with his head and having sex with him, but she's also implanting in the back of his mind that she wouldn't have chosen him and hes there becasue Rafa isn't

The most significant time I can remember feeling like an outsider to a subject was in graduate school when we studied Mikhail Bakhtin’s theories of polyglossia and heteroglossia. My head hurts just thinking about the struggle I had understanding the two books we were assigned to read in the course, The Dialogic Imagination and The Problems of Dostoyevsky’s Poetics. It was as if I was reading a foreign language. Try as I could, I could never articulate in my own words what Bakhtin’s theories meant or how to apply them to literary theory. I so hated every time we had to discuss the books in class and always felt incompetent, especially when I could see my peers got it and even relished our class discussions. To this day, I have those two books on my bookshelf. Some years ago, I opened them and found it striking that there were no marginal notes on any of the pages. I looked through five other books from graduate school that were on the same bookshelf and every one had marginal notes. I can’t explain why the books were so difficult for me to grasp, but to this day I have absolutely no interest in those books. And, I can’t think of a way anyone could interest me in them. Realizing this makes me understand what happens when some of my students struggle with the literature I ask them to read, like Shakespeare and poetry. It also makes me think of students who struggle with math, chemistry or the various subjects they struggle with. We have to find ways to help students like this reconnect to these subjects in positive and supportive ways.

Make sure to remember which is which or else you might get lost within your solution and get it wrong.

accumulative

Shows how the organization deals with injuries

This obviously will come up later in the book because it is repeated multiple times. Dickens wants us to recognized that he has been buried 18 years ago for some reason.

Alec D'Urberville returns and Tess is surprised to see him again, given their past, his presence was not a warm one for Tess. Alec is the narrator of this part of the text as he is seen quoting the story of Adam and Eve from the Bible, still trying to assert dominance over Tess. This passage refers to the Genesis story of Adam and Eve in the Catholic Bible. It is ironic that Alec quotes himself to seem as Adam while Tess is Eve. The ironic part is seen, "A jester might say this is just like Paradise" (275). Seeing Alec actually made Tess feel "weakly" not happy or excited. He is trying to seduce Tess once again, but his idea of being the man for Tess is far fetched. He is not Adam, and she is not Eve, the irony he even thinks they are related shows how Alec really does not think he did anything wrong to Tess, if anything he showed her light or paradise, in his mind.

When Tess, the protagonist of Thomas Hardy's novel, Tess of the D'Urbervilles, is working one day, she mindlessly notices a man working next to her, but pays no direct attention to him. Upon his approach, she is horrified to see Alec, the man who raped her years ago and brought existential dread to her life. He makes these claims that he is now a man of God, who has finally recognized his sins and is ready for redemption. However, it is clear through his joking, yet overbearing demeanor towards her that he is still the same terrible man that will never truly see the error of his ways. What supports this idea is the fact that he never apologizes or begs for her forgiveness, he just tries to sink his claws in her all over again by eventually suggesting that she marries him. Referencing Eve towards the end of this passage is an ironic way to bring religion into this issue. Alec makes the references to Eve as a way to almost put the blame on Tess for his actions because Tess is being compared to Eve as a temptress or a perpetrator. Alec continuously acts blind to his own role in taking joy and intimacy out of Tess' life.

In this section of the novel, Tess has returned to working near her house for her family since Mr. and Mrs. Durbeyfield have both fallen upon sickness of varying degrees. Before Tess's return home, she is reunited with Alec who has had a religious awakening since they have parted. Alec had prided himself with turning away from his past wickedness, but has since backslid from his religious practices due to the sight of Tess reigniting his temptations. A third person omniscient narrator describes Tess's realization that Alec has disguised himself as one of the labourers in order to be close to her. In this section of the scene, Alec compares this interaction between him and Tess to the temptation of Eve by the snake. This is not the first time Alec had compared Tess to Eve from the Biblical story of original sin. However, Alec had previously referred to himself as Adam in relation to Tess's Eve rather than the snake by saying, "the old Adam of my former years" (241). It is interesting that he changes the roles in this scene since Alec had expressed to Tess that she was tempting him, which we know from him saying it outright and from their history regarding his inappropriate actions toward her, including the rape. This view would make sense to compare them two to Adam and Eve, since in the Biblical story Eve gives the fruit to Adam. Now, with Alec assuming the role of the snake, it changes his portrayl of his side of their evolving story. Hardy is perhaps suggesting that Alec is trying to mask the fact the he is still the one being tempted through no longer referring to himself as Adam, a sinner. Since he feels that he was tempted by her in their past, he now aims to tempt her in return (though Tess, of course, did not aim to to tempt him). Hence, his referral to his own self as the snake and is referral to Tess as Eve. This is why he is now often seen looking upon her and inserting himself into her life since their reunion.

As Tess, the protagonist in, Tess of the D'Ubervilles, by Thomas Hardy, is working she notices a man that is working in a close proximity to her. She pays no attention to him. However, once she realizes it is Alec, the man that once raped Tess and essentially ruined her life, she is completely thrown off. At a first glance, this is a dialouge between Tess and Alec and Alec is alluding to the Bible, specifically the story of Adam and Eve. Keeping in mind the history of Tess and Alec, it is clear Hardy chose this language purposely. Alec "jokingly" refers to the story in the Bible when Adam and Eve are tempted and commit sin and he compares Tess to Eve and himself to the tempter, rather than Adam, a fellow sinner. This is perhaps showing that Alec does not see himself as a sinner for his actions, but more of a temptation for Tess. It is sadly ironic because for Tess, Alec was never once a temptation, but more of an aggressor. The language of this text is also particularly upsetting for Tess because she struggles with faith so much because of her past and rather than being seen in a saintly or good light that the readers know she should be, she is instead compared to Eve, one of the sinners in the Bible.

In this section, the motif of zombies (neither this nor that) can be seen in the line “And bats with baby faces in the violet light.” Aside from having an aura of creepy undeadness, the bats with baby faces are not quite human, not quite unhuman. They lie somewhere in between baby and bat. The un/natural time motif can be seen in the line “Tolling reminiscent bells, that kept the hours.” But unlike in my previously annotated section, this marker of time is unnatural. Bells are manmade signifiers of the passage of time, unlike the seasons or sunsets/sunrises. The “voices singing out of empty cisterns and exhausted wells” is clearly an example of the voice motif, but unlike my previously annotated section, these voices are, perhaps, humans, using actual human speech. Either way, there is general sense of exile in this section – the woman seems to be in a cave-type setting, cast out from the rest of the world and stuck with creepy bats against a “blackened wall.” The voices singing out of empty spaces also make me think they are calling out for something – help, maybe – so this last line uses the motif of desire frustrated.

The voices in this excerpt appears to be between two women. The beginning of “The Game of Chess” describes in vivid detail the vast and sophisticated room of a women that’s confined in exile. It’s not clear if this woman, who I believe is named Lil, is awaiting her husband to return from serving in the army because the time sequence of this section isn't natural, particularly in the latter half when the second women says, “When Lil’s husband got demobbed, I said—”. This quote makes me speculate that the second women is flashing back to a point in time she held an actual conversation with Lil. Moreover, the second woman’s reply to Lil in this excerpt, “Those are pearls that were his eyes” makes me believe that the husband, Albert, might be dead.

This excerpt reveals on behalf of Lil a frustrated desire to connect with somebody. She halfwittedly inquires twice on the noise that the wind is doing. And the second women’s zombie-like reply of “nothing” is another motif in this excerpt. It’s as if nobody wants to talk to Lil; Lil is quite the buzzkill even though she is on some meds herself, the irony.

Here Elliot is remixing "The Tempest" by Shakespeare, immediately following with the zombie motif of being zombie like. Kind of interesting that he notes the head is empty, but the eyes are treasure. He also remixes Shakespeare's usage of "Oh", but then reduces it to the vowel, and creates a rhythm on it, referencing ragtime. Mixing poetry and music. The rest of this section continues in a different direction, I can only assume to be their desire frustrated or still to refer to being a walking dead member of society. Like changing your hair would do anything about it.

I don't know how to do this in github or how feasible this is either, but example visuals (even just one graph) would be really helpful for this topic. It's going over my head

Sometimes this is hard for me to wrap my head around. Considering I grew up in the generation that did not have the internet to begin with to now being in the generation that relies completely on the internet to exist, I often find myself in a weird juxtaposition.

Flashbacks to statistics class; oh no! This is way over my head. I haven't taken any math in three years.

the repetition of "poor" really put an image in my head to resemble and correlate to "broken country"

As Joan Baxter explained in Part IV of her Fool's Gold series, the site targeted by the Black Point Aggregate Project:

"...wasn’t just any old piece of land. It was a parcel of coastal area about 12km from the town of Canso, boasting spectacular granite cliffs and hidden beaches on Chedabucto Bay, including locations identified on maps as Black Point and Fogerty Head. A piece of land immortalized by Stan Rogers, the folk legend who died in a fiery plane crash in 1983, viii in his 1976 song “Fogarty’s Cove.”

While i appreciate the way you synthesize these sources, I recommend not stringing together three quotations from three different sources. I'd like to see more commentary from you between these quotations.

edit for fragment

Very good, but a bit dated. I know Taubenbock from when I was at the TU Berlin, he did some work with one of my colleagues. They used LiDAR to capture the 3D signature of building envelopes in order to classify building type /land use from a building by building resolution. The HRSL is similar to this. Taubenbock used to be the head of a research group at the DLR in Germany (kind of like the German NASA). I wonder what type of work they are doing currently?

wow

This goes back to the idea that surnames serve as a reminder of where ones roots originated from. When we are given a last name, it also comes with the history of generations before us. The weight of all the struggles, fights, and bloodshed lace the last name in a hidden bow. When he says 'It should be heavy' I feel like he is saying that if a surname does not contain some weight or substance, it is no good. Since everyone has a surname, we all do indeed have an unshakeable chain and are are tied to a lineage until the day of our death. When I read that expert I was immediately reminded of the song 'Cost of the Crown' by Mercedes Lackey. The one part that has the strongest relations to the annotation is 'But once I took the crown to which I had been schooled and bred, I found it heavy on the heart, though light upon the head.'. This goes back to being given something innocent enough but chained to it is the burden and weight of history tied to the gift.

couldn't this be considered a fitness trait?

What is their relationship together?

• Mary Tudor and Thomas Cromwell were diametrically opposed in every way that mattered. She was a staunch Roman Catholic; he a reformist who masterminded the destruction of the monasteries and England’s break from Rome. She was the daughter of Henry VIII’s first queen, Catherine of Aragon; he helped engineer the annulment of their marriage so that the king might marry Anne Boleyn. Thanks to Cromwell, Mary suffered the misery and humiliation of being demoted from heir to the throne to illegitimate outcast.
• even rumoured that the king’s chief minister harboured secret plans to marry the Lady Mary so that his heirs might inherit the crown of England. There is little reliable proof that Cromwell ever presumed so far. Even if he had, it is highly unlikely that Henry VIII would have sanctioned such a marriage, or that Mary herself would have agreed to it. In fact, the real reason behind the apparent cordiality between Cromwell and Mary during the mid-1530s was that he was trying to persuade the king’s stubborn eldest daughter to acknowledge the invalidity of her parents’ marriage and accept her father’s new status as supreme head of the church.

"an organism containing a mixture of genetically different tissues, formed by processes such as fusion of early embryos, grafting, or mutation." (Oxford) But interestingly, the first definition given was "(in Greek mythology) a fire-breathing female monster with a lion's head, a goat's body, and a serpent's tail." (Oxford). Interesting that the monster is specified to be female. Was this double meaning used on purpose?

everything is a remix reference

English teacher being forced to teach online. New times.

Sex is a gateway for Latin women to be sucked into a life of servitude for men

Summary:

• First ancestor of most animals, including humans, has been discovered—Ikaria wariootia had a mouth, anus, gut, and a bilaterian body plan.
• Bilateral symmetry was a critical step in evolution, enabling organisms to move purposefully, but so far the first organism to develop it wasn’t known.
• Ikaria wariootia was discovered through careful analysis of 555 million-year-old samples.
• It was a wormlike creature, up to 7mm (0.27in) long, with a distinct head and tail, as well as faintly grooved musculature.
• This discovery confirms what evolutionary biologists previously predicted.

A shift in human thought as exemplified and written on by Plato. Very cool stuff. Relating to today with technology that is even more mnemonically devastating.

quoteworthy

This article is definitely something that I would come back and use when making a resume.

I never thought about why the functionalist view shot straight into popularity, but this cleared it up for me. Anthropologists were slightly at an impasse because the focus on comparison and historical "evolution" was the basis for their thinking. Functionalism flipped that kind of on its head looking for a complete answer for every question, which in itself comes with faults.

Victor was afraid of creating another murder. What if the female monster he was now creating worse than the monster than already existed? His anguish and fear is so painfully explained when he said that the tourture was like a single drop of water continually falling on his head.

The personification of the garden gives the reader an emotional connection to what is happening due to the Giant's selfish actions. The image of a beautiful flower going back into the ground is meant to evoke emotion from the reader and be mad at the giant.

Thiessen is carrying Trump's propaganda:

Intelligence agencies “have been warning on this since January,” a U.S. official who had access to intelligence reporting told the Post. “Donald Trump may not have been expecting this, but a lot of other people in the government were — they just couldn’t get him to do anything about it.

It is interesting to have this perspective of a younger, more vulnerable Yunior because we as readers know that he (as a teenager) loves to use his recently acquired English. We have access to this information because of Diaz's use of unstable chronology from one story to another. By jumping around in time in his storytelling, we experience moments of Yunior as a teenager and in later stories we have him as a younger boy who has just arrived to the United States. In this moment in "Invierno," we see his vulnerability as an immigrant who feels alienated in a new land that has its own language. Here, Yunior is not swaggering around using his Spanglish to degrade and objectify women. Instead, he is miming and gesturing his desires with Elaine on a cold winter day. Diaz writes, "She took her hands out of her mittens and rubbed them together. We were out of the wind and I followed her example" (141). Uncharacteristically (at least in comparison to his older years), Yunior is following the lead of the opposite gender. He watches her to make a similar move. In the next moment when Eric shows up, Yunior copies Elaine's moves in stepping out of the pipe. Yunior is limited in his language comprehension and Diaz shows this when he writes, "She was standing next to her brother. When he saw me he yelled something and threw a snowball in my direction" (141). When Diaz writes "yelled something," he emphasizes the likely possibility that Yunior does not understand what Eric is saying. This shows that Yunior is isolated with regard to the English language, exchange and communication.

One thing their father cannot tame is Yunior's hair. His father projects his own fears based on assimilation toward Yunior's unruly hair, representing evidence of their DR heritage. Yunior's hair becomes a liability for their father's wishes to become Americans in ultimately achieving the American Dream. His order to shave Yunior's hair is the only option for him to achieve his dream while also maintaining control over the bodies of his family.

<html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40">

<span class=SpellE><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>SciScore</span></span><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>: 6 </span><span style='color:blue'>What's this?</span>

Document Identifier: 3879

Below you will find two tables showing the results of <span class=SpellE>SciScore</span>. Your score is calculated based on adherence to guidelines for scientific rigor (Table 1) and identification of key biological resources (Table 2). Points are given when <span class=SpellE>SciScore</span> detects appropriate information in the text. Details on each criteria and recommendations on how to improve the score are appended to the bottom of this report.

Table 1: Rigor Adherence Table

<u style='text-underline:black'>Institutional Review Board Statement</u>

<span style='font-size:11.0pt;line-height:107%'>IRB: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

<span style='font-size:11.0pt;line-height:107%'>Consent: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

<u style='text-underline:black'>Randomization</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

<u style='text-underline:black'>Blinding</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

<u style='text-underline:black'>Power Analysis</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

<u style='text-underline:black'>Sex as a biological variable</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

Table 2: Key Resources Table

Your Sentences

REAGENT or

RESOURCE

SOURCE

IDENTIFIER

<o:p> </o:p>

<u style='text-underline:black'>Software and Algorithms</u>

<o:p> </o:p>

<span style='font-size:11.0pt;line-height:107%'>Microsoft Excel <span class=GramE>( MS</span> Excel 2013 ,</span>

<span class=GramE><span style='font-size:11.0pt;line-height: 107%'>v.15.0 )</span></span><span style='font-size:11.0pt;line-height:107%'> was used for data collection of the epidemiological and clinical information .</span>

<span style='font-size:11.0pt;line-height:107%'>Microsoft Excel</span>

<o:p> </o:p>

<span style='font-size:11.0pt;line-height:107%;color:gray'>Suggestion: (Microsoft Excel,</span>

<span style='font-size:11.0pt;line-height:107%;color:gray'>RRID:SCR_016137)</span><span style='font-size:11.0pt;line-height:107%;color:black;text-decoration:none; text-underline:none'>(</span><span style='font-size:11.0pt;line-height:107%;color:blue'> link</span><span style='font-size:11.0pt;line-height:107%'>)</span>

<o:p> </o:p>

Other Entities Detected

Your Sentences

Recognized Entity

Oligonucleotides

<span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

<span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA; Reverse primer ACGATTGTGCATCAGCTGA;</span>

<span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA</span>

<span style='font-size:11.0pt;line-height:107%'>The probe 5#-VIC-</span>

<span style='font-size:11.0pt;line-height:107%'>CCGTCTGCGGTATGTGG</span>

<span style='font-size:11.0pt;line-height:107%'>AAAGGTTATGG-BHQ1-3# Target 2 <span class=GramE>( N</span>):</span>

<span style='font-size:11.0pt;line-height:107%'>5#-VIC-CCGTCTGCGGTATGTGG AAAGGTTATGG-</span>

<span style='font-size:11.0pt;line-height:107%'>BHQ1-3#</span>

<span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

<span class=GramE><span style='font-size:11.0pt;line-height: 107%'>GGGGAACTTCTCCTGCTAGAAT;</span></span>

<span style='font-size:11.0pt;line-height:107%'>Reverse primer</span>

<span style='font-size:11.0pt;line-height:107%'>CAGACATTTTGCTCTCAAGCTG;</span>

<span style='font-size:11.0pt;line-height:107%'>GGGGAACTTCTCCTGCTAGAAT</span>

<span style='font-size:11.0pt;line-height:107%'>The probe 5#-FAM-</span>

<span style='font-size:11.0pt;line-height:107%'>TTGCTGCTGCTTGACAGATT-TAM</span>

<span style='font-size:11.0pt;line-height:107%'>RA-3<span class=GramE># .</span></span>

<span style='font-size:11.0pt;line-height:107%'>5#-FAM- TTGCTGCTGCTTGACAGATT-TAM RA-3#</span>

<span class=SpellE>SciScore</span> is an <u style='text-underline:black'>automated tool</u> that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. <span class=SpellE>SciScore</span> is not a substitute for expert review. <span class=SpellE>SciScore</span> checks for the presence and correctness of RRIDs (research resource identifiers) in the <span class=GramE>manuscript, and</span> detects sentences that appear to be missing RRIDs. <span class=SpellE>SciScore</span> also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. <span class=SpellE>SciScore</span> does not guarantee that the rigor criteria that it detects are appropriate for the <span class=GramE>particular study</span>. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources.

<u style='text-underline: black'>Rigor Table:</u>

In the rigor table (table 1 of this report), <span class=SpellE>SciScore</span> highlights sentences that include various elements of rigor as described by <span class=SpellE>Hackam</span> and <span class=SpellE>Redelmeier</span> in <span style='color:blue'>2006</span>, and by van der Warp and colleagues in <span style='color:blue'>2010</span>. <span class=SpellE>SciScore</span> was trained using sentences from thousands of published papers that were tagged by expert curators to indicate that the sentence described blinding (either during the experiment or during data analysis), group selection criteria such as how subjects were randomized, power analysis (statistical test), or sex as a biological variable. If a cell line is detected then <span class=SpellE>SciScore</span> ‘expects’ that cell line authentication criteria are described, a cell line is not detected this section of the table will not be visible or scored. When a criterion is expected, but a sentence that addresses the criterion is not detected by <span class=SpellE>SciScore</span>, the statement “Not Detected” is given. It is possible that a criterion is not necessary for a <span class=GramE>particular manuscript</span> or that <span class=SpellE>SciScore</span>, an automated tool, makes a mistake. If <span class=SpellE>SciScore</span> makes substantial mistakes with your manuscript, please <span style='color: blue'>contact us </span><span style='mso-spacerun:yes'> </span>to help us learn from our mistakes. Please see the <span style='color:blue'>FAQ </span><span style='mso-spacerun:yes'> </span>for more details.

<u style='text-underline: black'>Scoring for Rigor Table (total 5 points):</u>

The rigor table makes up 5 points of the total score. Those five points are split evenly among the expected rigor criteria, each criterion being worth five divided by the number of rows in the table points. Scores are rounded to the nearest whole number. For each sentence that describes an expected rigor criterion, such as blinding, <span class=SpellE>SciScore</span> adds the fractional number of points for that criterion, and if it is unable to find a statement on blinding then this section is labeled "Not Detected" and receives a score of 0. To improve detection, please make sure that your language is clear and written in standard English.

<u style='text-underline: black'>Key Resources Table</u>

The key resources table (table 2 of this report), contains two types of things that are detected automatically by <span class=SpellE>SciScore</span>:

<span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>1.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>RRIDs, research resource identifiers

<span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>2.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>Sentences that “should” have RRIDs

RRIDs, are unique identifiers for reagents and other resources that largely overlap those resources that have been labeled as particularly problematic by the National Institutes of Health in recent changes to grant review criteria, please see <span style='color:blue'>"key biological resources"</span>, e.g., antibodies, cell lines and transgenic organisms. The RRID initiative is led by community repositories that provide persistent unique identifiers to their resources, such as transgenic mice, salamanders, antibodies, cell lines, plasmids and software projects such as statistical software. RRIDs are described in a primer by Bandrowski and Martone in<span style='color:blue'>2016</span>.

RRIDs are unique numbers that resolve to a particular database record, for example the <span class=GramE>RRID:CVCL</span>_0063 resolves to this record for a cell line:

<span style='color:blue'>https://web.expasy.org/cellosaurus/CVCL_0063</span>

The information in that database is structured and curated by <span class=SpellE>Cellosaurus</span> staff, the authority for cell lines. If authors use this RRID then <span class=SpellE>SciScore</span> will ask the database about the number. Once an RRID is found in the database, <span class=SpellE>SciScore</span> attempts to match text in the sentence with the database record, most often it attempts to find the name of the resource, in this case HEK293T, and information about the company or catalog number to verify that authors have put the right RRID in the sentence. If a typo is made by authors, that renders the RRID not valid, the RRID column will be blank (table 3 will contain the RRID in the unresolved RRID column in red). If an RRID was submitted to the authority by authors, it often takes a week or more to become available in the resolver database, thus exercise caution in the interpretation of the <span class=SpellE>SciScore</span> report in cases of newly minted RRIDs.

Sentences that should have RRIDs are detected by <span class=SpellE>SciScore</span>, by looking for patterns in a sentence that are <span class=GramE>similar to</span> how cell lines or antibodies are described in published papers. A sentence that describes one or more antibodies may be detected by <span class=SpellE>SciScore</span> and this will be placed into the table without a corresponding RRID. <span class=SpellE>SciScore</span> will attempt to find the name(s) and catalog numbers of the resource. In cases where the tool is relatively confident, it will suggest an RRID. The suggested RRID appears in gray with a link to the RRID website where authors must confirm that the RRID found by <span class=SpellE>SciScore</span> is the correct RRID.

<u style='text-underline: black'>Note of caution:</u>

Please verify all RRID suggestions, only the author can know whether suggestions are correct.

<u style='text-underline: black'>Scoring for Resources Table (total 5 points):</u>

Each resource that is detected is scored, and the total is 5 points, with scores rounded to the nearest whole number. For each RRID detected, points are awarded, but for each sentence that is detected that does not contain an RRID, points are not awarded. If <span class=SpellE>SciScore</span> detects catalog numbers or relatively unambiguous resources, partial points are awarded. For each RRID that does not resolve properly only partial points are also awarded. Therefore, the way to maximize the points from this section is to add RRIDs, and proper citations that include vendor names, catalog numbers, lot and version numbers into the methods section of the manuscript.

<u style='text-underline: black'>Incorrect sentences:</u>

<span class=SpellE>SciScore</span> is a text analysis tool, and it is therefore susceptible to making two types of errors, false positives or false negatives.

False <span class=SpellE><span class=GramE>negatives:<span style='font-weight:normal'>The</span></span></span> most common error occurs when the algorithm fails to detect a sentence that contains an antibody or another resource. False negatives generally occur either because the sentence is complex or in a less common syntax pattern. Generally simple sentences in clear standard English are simpler to process and result in few false negatives. If a truly complex sentence structure is required to describe reagents, a table may help not only <span class=SpellE>SciScore</span>, but also human readers. If an RRID is detected in a sentence, <span class=SpellE>SciScore</span> will be triggered to <span class=GramE>take a look</span> at the sentence, which may have been skipped otherwise.

False positives: This type of error includes cases where a sentence does not contain an antibody, but the algorithm asserts that this sentence does have an antibody. If many resources are used and all have RRIDs, a single false positive will not reduce the score substantially. But if only 1-2 resources are used, then a false positive can reduce your <span class=SpellE>SciScore</span> needlessly. False positives are most often seen in the tools portion of table 2, as the algorithm detects company names, where it should not. We try to minimize these false positives using several strategies. If this impacts your score, please contact our team (http:// sciscore.com) and include the sentence where <span class=SpellE>SciScore</span> made the error. While we can't fix the score, we can learn from our mistakes.

</html>

spoken about in beautiful minds - diffusion of responsibility for both those ordering the tasks (but doing actually doing them with their own hands) and those executing them (those who are just following orders of higher ups). In htis case it seems Eichmann is victim ot both of these forces due to the nature of his position

tells this like a story, accounting the events of the whole courtroom

He clearly is using a metaphor rather than a literal plant. Or something went over my head.

Going sailing by the lake represented Victor’s way of self reflecting on the things that he had gone through after the destruction caused by the monster. He feels that he is miserable because of how sad and painful like is going for him. Also, going by the lake represents somewhere that he goes to clear his head.

Victor is upset that the monster comes to see him, despite of everything he did to Victor’s life. He is outraged.

This goes completely against backward design... Providing learners with finished samples has allowed them to create excellent finished products themselves... The same can be said for sharing learning goals, learners should know the direction they are expected to head in.

PQ: How does Polybius describe LIvy when they met? Are accounts like these the reason why we should be skeptical about first hand accounts?

1. name and size

As the article indicates, there are unfortunately more students experiencing childhood trauma, especially at a younger age and more incidents of behaviour because of this. However, the implementation of the DECA has allowed teachers to understand how to assess and teach their students better and thus feel better supported and more confident in teaching their students.

By this point, I'll admit, I was just as shocked as Watson was when the speckled band meaning was finally reviled. I wonder if the mystery seems silly in countries where this is a known name for the deadly snake

I have seen some children with autism who "has to" step on certain tiles when walking or has their own "circle/route” to take when playing in the field. They would be agitated if someone break it off. I wonder if this counts as possible symptoms of OCD.

When Othello says "lie with her", the jealousy that Iago brainwashed him with had already got into his head

he could've been a little slight foil in terms of the way he handled his jealousy if he didn't let iago get in his head.

Desdemona has remained upapproached by Othello to resolve his inner conflict. Defiently tragic. At this point it is too late for Desdemona to persuade Othello to see it any other way, thanks to Iago planting these delusions in Othello's head

With all these caveats listed, it makes me wonder for which tags auto-blocking does work. Only script tags inside of head?

They are a bit vague in their "how it works" description...

Which is why head-on cavalry charges against formed infantry are a fools game!

The men do not agree with Hutchinson taking the side of the British government. They look at themselves as their own country at this point and head streat for Griffin's wharf where the Tea Party will take place soon.

This has happened to me so many times! I will be wondering why my neck is so sore and forget that it is due to all the screen time!

I can agree with this because when you're hearing and typing you usually try to get everything down. On the other hand when it comes to writing them down you can actually listen and get your head around that main ideas.

Definitely sounds like an illness similar to the one the Joker has in the recent movie. In that movie, the character suffered head trauma as a child, and as a result developed a condition where he randomly laughs uncontrollably. It's sad that in her current situation she's clearly ill, but that it's chalked up to religion, as she roams destitute, trying to find her way back home.

OUT

Bannerman never explicitly states where this "jungle" is located. While the presence of tigers and her use of the word "ghi" suggests that the story takes place in India, her use of Black caricatures suggests that the characters may be African in origin.

Due to this ambiguity, later adapters have set their retellings of The Story of Little Black Sambo in India, Africa, and even the American South. In most cases, the creators' choice of setting directly influences how they racially portray the characters. For instance, books set in India, such as Fred Marcellino's The Story of Little Babaji (1996), typically depict the characters with stereotypical Orientalized clothing, like turbans and saris. By contrast, adaptations set in Africa, like John R. Neill's Little Black Sambo, frequently represent the characters wearing grass skirts (or even no clothing at all) and living in primitive grass huts. Finally, adaptations like Julius Lester and Jerry Pinkney's Sam and the Tigers (1996) shift the narrative to the American South.

However, some critics have argued that Bannerman deliberately made the setting of her book ambiguous in order to enhance the fantasy aspect of the story. Rosemary Dinnage writes, “The Sambo adventures… happen to never-never people in a never-never land that is neither India nor Africa nor--certainly--the American South; alas for Anglo-Indian Mrs. Bannerman, her head full of perfectly real exotic scenes, and real snakes and tigers, innocently coloring her figures black to suit the story” (84).

The underlining of this character's name is interesting, considering Phil doesn't appear until the last two pages of the 21st chapter, and in a different setting from the Smallweed's home. He is described with incredible physical disfigurements, and as the closest relationship George has. Interestingly, Phil's physical appearance and mobility is described as primal and almost atavistic

George's Shooting Gallery to-night, which is so devoid of company that a little grotesque man with a large head has it all to himself and lies asleep upon the floor (350).

This is similar to the descriptions of Judy Smallweed earlier in this installment. George's connections with, or at least intrigue by, these characters help shape him as one of the most psychologically developed characters Bleak House offers.

She seemed like an animal of another species, and there was instinctive repugnance on both sides (335).

The readers are finally provided with a name for Lady Dedlock's French maid. We also get some interesting insights into her and Lady Dedlock's relationship, as well as her personality. We see Lady Dedlock injure Hortense's pride by leaving her behind to walk home, and we see how Hortense responds to it -- with passionate fury that leaves her walking home shoeless through the rain-soaked grass. This tension between the two of them could indicate some of the motive Hortense had for framing Lady Dedlock for Mr. Tulkinghorn's murder later in the novel.

We also get the keeper mentioning aspects of Hortense's personality, saying:

"...She's mortal high and passionate -- powerful high and passionate" as well as saying that she isn't insane, that she "has as good a head-piece as the best" (299-300).

This is interesting if we look at the novel's events as a whole, with Hortense murdering Mr. Tulkinghorn.

There seems to be an in emphatic finality with which Dickens places the period beside Lady Deadlock’s name. This suggests that he already knew before starting this chapter she was going to tell Esther in this section. The timing was left ambiguous. He seems to come to the conclusion that it would be best to begin with Lady Dedlock telling Esther in the first chapter, Chesney Wold. Although further analysis uncovers that this line of questioning he jots down reveals his writing process. From the very first set of installment notes he already knows that a major plot point in this novel is the uncovering of this relationship; however, when analyzing these notes one understands that Dickens has to physically put pen to paper and articulate his thoughts in a way that is accessible to readers. The disconnect between a perfect thought in one's head and actually plotting a scene can be a difficult task and here we see an example of Dickens trying to figure this out first hand.

Missionary: Sent with a religious message. Minister: The "head" of a religious group. Teacher: Teachings of certain or various subjects.

Combined these make for a very focused class. Teaching Native American children to speak, read, and write in English all so he can teach them the message of God. Which is both jobs of a missionary and minister.

Another change(I think there is gonna be more)

I'd suggest moving this to be the last bullet

"I swear by Cupid’s strongest bow and his best gold-tipped arrow"

This is an example of coordinators the sentence uses for the F in FANBOYS

I think that reading a book is more for learning/school related but online reading is more for "why does my head hurt after blah blah blah..." Online reading is more accessible than offline because with offline we have to find the book, buy it/check it out, find the page and read it. Online reading we just type something in a push a few buttons, takes less than 5 minutes to do.

The devil is planting evil thoughts into his head and telling him to buy some poison to kill his brothers.

running head on to meet death- sure yeah that seems like a brilliant idea.

This line can be an example of Connotation. The father isn't actually harming the child but the word beat makes it seem worse than it actually is.

I always found this song of hers so interesting. Is it an actual song? I found it random since even though they do use music as metaphors and such, nobody has actually done anything musically till now? This also mad me wonder even more about her mother.

I always personally loved this part of the scene since you can see Othello spiraling even more in his head and losing his sanity to the point he falls into a trance. I think it's rather powerful.

What Iago says to desdemona feels like he is teasing her and her response makes me believe he says this to build more of his fake reputation by seeming playful.

Why do I find this compliment to be such a contradiction to what it's trying to say in a way? He holds Othello in a high regard so he doesn't care about race but still felt compelled to say that he is more "fair than black" implies in my head he still consider black or sees it as a negative thing.

Cassio talks to Desdemona about how he was sorry for what he had done to Montano. Desdemona forgives him. Iago denys that Cassio was in Desdemona's room. Desdemona tells Othello that you should reconsider Cassio. Iago then convinces Othello that Desdemona is cheating on Othello with Cassio. Othello tells Desdemona that his head hurts, so Desdemona gives gifted Napkin, drops it. Emily picks up Napkin and gives it to Iago. Iago stages that Desdemona and Cassio were together by placing the napkin in there. Iago convinces Othello that Cassio and Desdemona were together. Othello was outraged by this and tells Iago to kill Cassio. Iago is then promoted to Lieutenant.

The very act of robbing can highlight how women were viewed in society. In lines 94-96, we see Desdemona depicted as an animal - a piece of property. Iago refers to her as an object of her father's possession, making it seem that her actions are meant to be controled. By her having sex, especially with a Moor, can be taken as a slight toward Brabantio's whole family, but specifically toward Brabantio as the head of his household.

Othello seems to be of honest character. He admits that while he is not the most graceful speaker, his only "crime" was marrying Desdemona.

This entire article in general just reminds me how certain things can have such large effects. Money is an example- some people can be all about money, to the point where it takes them over and controls them. It is crazy how things can just snowball into something that we probably did not even imagine, which is what happened with coffee and the Ottoman Empire... or how things that we love so much, can become poison at some point and cause a lot that we did not ask for. These were just all of my thoughts that were running through my head while reading this.

This appears to be a bit of hyperbole as it would be very, very expensive for clothing to weigh that much. Considering how expensive fabric actually is- and was- you'd need a lot of fabric to make a dress this heavy, let alone a head-dress. It would be extremely impractical and wasteful to squander money on a single article of clothing for the sake of luxury and status unless you were royalty, so I highly doubt they meant this in a literal sense for some wandering wife. If anything this line serves a comical purpose to entertain the reader and to lighten the mood of the story a bit.

I'm curious what they expect to be the alternative for people who this will be affecting? It's difficult for me to wrap my head around the idea that they would take this essential funding away from underserved populations and yet imposing higher taxes for wealthy is considered crazy.

major rule change aimed to keep players safe that has altered the way football is played.

2011 Rule change as an attempt to combat head injuries on kickoffs. This change was before the 2013 settlement with NFL and former players talked about by John Guccione. http://web.a.ebscohost.com.ezjsrcc.vccs.edu:2048/ehost/pdfviewer/pdfviewer?vid=7&sid=9c5d19e4-a579-48a1-a02a-59451894dc30%40sessionmgr4007

The number of head injuries decreased on kickoff plays overall. Mainly due to the fact that there were more touchbacks. The injury rate was not observed to fall during active gameplay kickoff situations.

Nice would be highly subjective. "Nice guys" aren't usually nice people, they are like alligator snapping turtles trying to lure in prey with nice words but will try and bite your head off at the slightest hint of being ignored or brushed off. Expectations do not equal reality.

this just all points to Commodus being insane.

Here Cassius writes about how Severus was demonstrating himself to be a cruel and violent Emperor. Even Severus himself says that the path of cruelty and severity taken by Sulla and Augustus was what allowed them to be great men in their times. He claims that the "mildness" of Caesar and Pompey is what eventually led to their deaths.

Hmm.... language indicates models, indicates common functionality.

Can you actually apply this in practice without your head exploding. I guess it can influence what yuo are thinking and be part of your role.

Kipling was right. In his poem he talks about how the Philippines is America’s responsibility and because of that, it’s become a burden. America has this need that helping other nations is just simply their destiny. This was what America was trying to do here also. "Half devil and half child" This shows America's perspective of the Philippines which was why they felt like they needed to do something about it. In Section 3 of The American Empire, it also states something important. It says, "American forces were instructed to secure Manila". When you imagine America as a whole country compared to these small nations, it's like a father caressing a baby. This is what I vision in my head when I read this. Of course, not everyone had mutual feelings when it came to this. Therefore, I would say that Kipling's argument is true.

wow that is lot of stuff that happened and its understandable that he wouldn't leave right away.

The verb "shaking" included with the flirtatious response gives me a better sense of the character. The character appears to be quick witted.

Horatio knows what is up.

[Note: this preprint has been peer reviewed by eLife. The decision letter after peer review, based on three reviews, follows. The decision was sent on 19 May 2019.]

Summary

This paper describes five cryo-EM structures of ribosomal complexes apparently representing different stages of RF2-catalyzed translation termination. The novel observations here are that the tip of domain 3 of RF2 undergoes a rearrangement from an a-helical conformation to a b-hairpin conformation during termination that likely facilitates exit of the newly synthesized protein from the ribosomal polypeptide exit tunnel and that the ribosome can undergo two thermally activated, spontaneous conformational changes, a relative rotation of the ribosomal subunits and a swiveling of the 'head' domain of the small subunit, during termination that likely facilitate dissociation of RF2 from the ribosome. These are interesting observations that significantly extend our understanding of how class I RFs and ribosome conformational changes drive important steps during termination and, as such, all three reviewers recommended publication provided the following comments are addressed adequately.

Essential Revisions

1) The maps provided through the eLife system seemed to be unsharpened, as they showed very little detail. However, even after sharpening them with a B-factor of -100A2, they still did not show the expected features for their respective resolutions. My suspicion is that FREALIGN has been used to overfit the data. This should be addressed in the revision. It should be indicated whether gold-standard separation of halves of the data sets were used in the final refinements, or whether those were limited to a specific spatial frequency (like was done in the classifications). If the latter, those frequencies should also be stated in the manuscript, and they should be significantly lower than the claimed resolutions.

In addition: a lot of basic cryo-EM information is missing: the authors should include: a) at least one micrograph image b) some representative 2D class averages c) local resolution maps of the five structures. Also, because the density of important parts of the maps seems to be a lot worse than the resolution claimed, it would be good to explicitly mention the local resolution of the important features discussed in the main text. d) for each structure, some zoomed-in figures with the density on top of the molecular model. These figures should be chosen as to validate the resolution claim. For example, in structures I, II and V, the RNA bases should be well separated (they do so at 3.6A), and in structures III and IV beta-strands should be well separated, and many (larger) side chains should be visible. In addition, some panels with density for the most important features of each structure should be shown. e) FSC curves between the refined PDB models and the cryo-EM maps are missing from the manuscript. These should be included. In addition, to evaluate potential overfitting of the models in the maps, for each structure, the authors should also include the FSC curves between a model that was refined in half-map1 versus half-map1, as well as the FSC curve between _thesame model versus half-map2.

2) There appear to be many self-citations, and there are also a few places where relevant citations are missing or are mis-cited. There are too many to list individually, but, just a few examples: Page 4: the only citation for the phrase "recent biophysical and biochemical findings suggest a highly dynamic series of termination events" is a Rodnina paper. There are many, earlier papers from Ehrenberg, Gonzalez, Puglisi, Green, Joseph, etc. that should be cited here. Page 5: The only citation for the sentence "By contrast, biochemical experiments showed..." is a Green paper. There are earlier papers from Ehrenberg characterizing the effects of the GGQ-->GAQ mutations on the ability of RF3 to accelerate the dissociation of class I RFs from termination complexes that should be cited here. Page 5: There's a sentence that refers to X-ray, cryo-EM, and smFRET studies, but only provides citations to two smFRET studies (Casy et al, 2018 and Sternberg et al, 2009); Page 5: Moazed and Noller, 1989 identified and characterized the P/E hybrid state, but they didn't report that a deacylated P-site tRNA 'samples' the P/E hybrid state 'via a spontaneous intersubunit rotation'--that was later work from Noller and Ha; etc. There are several other instances of missing citations or mis-citations. We would ask that the authors review their citations with an eye for excessive self-citations and for missing citations or mis-citations. In this context, "Ensemble-EM" is also cited as a specific method in the introduction (Abeyrathne et al., 2016; Loveland et al., 2017). However, this method is more commonly known as (3D) classification of cryo-EM images, and there are many older, more appropriate citations.

3) The sample imaged is a model sample generated by in vitro assembly with purified components of a termination complex. In order to mimic a bona fide termination complex, a short messenger RNA with a strong Shine-Dalgarno sequence followed by a start codon and immediately after by a stop codon was used (mRNA sequence: 5'-GGC AAG GAG GUA AAA AUG UGA AAAAAA-3'). Similar constructs were used to crystallize termination complexes in the past and it has been proven by smFRET experiments that, at least regarding ribosomal inter-subunit dynamics, this model sample behaves similarly to a real termination complex with a peptide linked to the P site tRNA. However, the nature of this model sample should be apparent for the non-specialist reader, highlighting its similarities with a real termination complex but also its possible limitations, especially regarding the "artificial" nature of having a stop codon so close to the Shine-Dalgarno sequence, a situation that never happens in real mRNAs. The authors should explicitly acknowledge this and discuss its implications in the main text.

4) The authors set up a couple of somewhat 'strawman' arguments in claiming that: (i) there are discrepancies in the X-ray, cryo-EM, and smFRET literature with regard to whether ribosomes can undergo intersubunit rotation while bound to class I RFs or whether the non-rotated conformation of the ribosome is stabilized by bound class I RFs and (ii) class I RFs are able to terminate translation and dissociate from the ribosome without the aid of RF3. In the case of (i), it is obviously possible for class I RF-bound ribosomes to undergo intersubunit rotation while still favoring the non-rotated conformation of the ribosome. Moreover, there are enough differences between the cited studies, both in terms of the experimental conditions as well as the technical limitations associated with the various experimental techniques, that it is easy to rationalize differences with regard to whether the class I RF-bound ribosomes would be expected to undergo intersubunit rotation and/or whether the researchers would have been able to capture/observe intersubunit rotation. In the case of (ii), decades of biochemistry from Buckingham, Ehrenberg, Green, and others had already demonstrated that class I RFs are able to terminate translation and dissociate from the ribosome without the aid of RF3, and that the role of RF3 in termination is to accelerate the spontaneous dissociation of the class I RFs. If the authors want to highlight discrepancies in the literature, they should frame them in the context of differences between the studies, experimental design, limitations of the approaches/techniques in the cited papers that might account for such discrepancies. Re-writing this paragraph also in the light of addressing the missing citations and mis-citations pointed out under (2) will further help in toning these arguments down, which would strengthen the manuscript's scholarship.

5) Class I RFs are post-translationally methylated at the Q residue of the GGQ motif of domain 3 and Buckingham, Ehrenberg, and others have shown that this methylation accelerates and/or facilitates class I-catalyzed termination both in vitro and in vivo. Nonetheless, Svidritskiy et al do not report whether and to what extent their RF2 is methylated. Was RF2 overexpressed in a manner that ensured homogeneous methylation or lack of methylation? If they are overexpressing prfB and not overexpressing prmC, it is likely that they have a mix of methylated and unmethylated RF2. Assuming they are using the wt E. coli prfB gene, then the residue at position 246 is a T, rather than an A or S, and Buckingham has shown that, in the wt T246 background, a lack of methylation at Q252 is either seriously detrimental in richer media or lethal in more minimal media. It was felt that a discussion of this issue was not needed in the main text, but that it would be helpful if the authors would include the important/relevant experimental details in the Methods section, for example, did they use the T246 wt E. coli variant of RF2; and did they overexpress prmC along with prfB?

6) Structure I is denoted and treated as a pre-termination complex, but that does not seem at all possible given that the sample was prepared by incubating a pre-termination complex for 30 min in the presence of excess RF2, conditions that Figure 1-Figure Supplement 3 suggest results in robust termination. Structure I is more likely the non-rotated conformation of a post-termination complex that is in equilibrium with its rotated counterpart, Structure V. Based on my reading of the manuscript, it is likely that the authors understand this point, but are nonetheless using this structure as a mimic/analog of a pre-termination complex. If so, I think this is fine, but the authors should explicitly state that this is what they are doing. Related to this, the authors should clarify the description of their activity assay, show the raw data, and/or report 'Released [S35]-fMet (%)' instead of 'Released [S35]-fMet, CPM' on the y-axis of Figure 1-Figure Supplement 3; as the activity assay is currently described, reported, and plotted, it is impossible to determine whether RF2 is 1% or 99% active in termination.

7) The final sentence of the manuscript reads: "Translation termination and recycling of the release factors and the ribosome therefore rely on the spontaneous ribosome dynamics, triggered by local rearrangements of the universally conserved elements of the peptidyl-transferase and decoding centers". There are a couple of problems with this sentence as written. First, smFRET experiments by Gonzalez, Puglisi, and Rodnina have previously shown that "Translation termination and recycling of the release factors and the ribosome therefore rely on the spontaneous ribosome dynamics" and the relevant articles should therefore be cited here. Moreover, given the data are static structures solved using a sample that is at equilibrium, it is not clear how the authors determined that these spontaneous ribosome dynamics were "triggered by local rearrangements of the universally conserved elements of the peptidyl-transferase and decoding centers". Isn't it equally possible, given the data presented, that the local rearrangements were triggered by the ribosome dynamics?

about the same as a small 2" sphere

It's hard for me to wrap my head around being able to separate and categorize tales like this. The sheer magnitude of the pool of possible variables as well as stories themselves is massive. How do you categorize though substance/concept? Region? and even concentration in relation to each other?

Section summary: defines Stereotype =Tools people used to form impressions on others. =Lead to a lot of controversy the media is a big source that supports stereotypes.=Usually targets those that the targets group that are unfamiliar/ignorant.

This is very true! People have different views o everyone depending on their experiences with them.

Stereotypes are used to show what a culture looks like or seems to be in another culture. One's culture is oversimplified by another culture.