5,068 Matching Annotations
  1. Apr 2021
    1. It limits the complexity and the roundedness of the characters.

      That solely writing a character to depict blacks also does no justice to the character as it makes the character bland, so therefore why he creates characters with complexity and with the character being black, it helps the black community in the long run as it does not show stereotypes nor have a white washing effect.

    2. monolithic depiction of Black people and Black culture

      Monolithic meaning not open to new ideas and remaining with the same old stereotypes and depictions of blacks in the past.

    3. With a focus on increasing authentic representation of people of color, Milestone Media created a world of splash pages and panels that is both inextricably bound to the music, politics, and energy of its time—much like the Black Arts Movement

      This site is here to help the Black community get more involved in poetry and music and other jobs that we may think only white people run

    4. “My problem—and I’ll speak as a writer now—with writing a black character in either the Marvel or DC universe is that he is not a man. He is a symbol. Like Wonder Woman—if you write Wonder Woman, she is all women

      I agree with this not a lot of people go out and say my favorite hero is Wonder woman or my favorite hero is Black panther. I think we need more male black hero's

    5. felt the paucity of characters of color, queer characters, and women characters within American comics needed to be addressed

      We need more hero's that are of different origin's I know of a few hero's that are black (Black Panther, Storm, and cyborg just to name a few.

    6. characters of color, queer characters, and women characters within American comics needed to be addressed.

      All of these things being prevalent as there was still issues with women rights, gays being shamed , and blacks still being discriminated and stereotyped.

    7. Black artist downtown became more and more isolated from that so-called ‘mainstream’ by the growing need to fully express [their] soul and mind connection with Black struggle in [their] art and in the street”.

      Shows me that black artists are dying down which isn't a good thing

    8. Cam Newton and Colin Kaepernick

      Here I see Cam Newton abiding by the NFL therefore assimilating to the white audience, while I see Colin Kaepernick using his freedom of speech to voice his opinions on black lives

    9. Martin Luther King Jr. and Malcolm X

      MLK taking the civil approach with civil protest, and Malcom X taking the violent riot approach of demanding rights now

    10. confines of society.

      What I don't get is that if he came from a child hood where he was a slave and saw the impossible happen being the freedom of slaves, why not continue the ambitions of the slaves but instead continue to fight for their right stop be actually equal instead of being free, but confined by white society.

    11. Be stereotyped, don’t go too far, don’t shatter our illusions about you, don’t amuse us too seriously. We will pay you,’ say the whites.”

      Shows me that the whites don't understand where this young poet is coming from and now yawl want to be nice to him just doesn't make sense

    12. lack race should be to obtain marketable skills within the current confines of society.

      I can see why Booker T says this because after all he was a slave, when coming from an upbringing like that, all anybody would want is to just live life like how society already is instead of giving in for hope for change that might never come.

    13. The Negro artist works against an undertow of sharp criticism and misunderstanding from his own group and unintentional bribes from the whites.

      People are gonna hate you for what you do and that's the truth I make music and not everyone likes it but I'm still standing tall

    14. higher education

      Ironic how Booker T was the first one to set up a school for high education, which eventually led to Dubois getting his education and being Booker T biggest opponents.

    15. no great poet has ever been afraid of being himself

      This is true through everything like being a song writer don't be someone your not just because a certain crowd doesn't follow you be yourself and your time will come

    16. the young poet tells Hughes that he wants to be “a poet—not a Negro poet,” which Hughes takes to mean that, at best, the young poet seeks to downplay his race

      This shows me that this young poet doesn't believe in his race it shows me he is less confident about his race.

    17. founded for the higher education of African Americans.

      He wants blacks to accommodate yet founded a school for high education for African Americans, that clearly goes against what many whites think of about black people. In my opinion contradicts his own statement.

    18. provided them rather than seek access and opportunity through protest and civil unrest:

      This is where I would disagree with him, as not seeking for opportunity in itself is already bad advice as given an opportunity one should take it.

    19. A proponent of vocational education for Blacks, Washington contended that the rights and privileges of true citizenship for Black people could only be gained through gradual struggle and the development of marketable skills.

      This proves how Booker T Washington was living a double consciences, by living his life out but also pertaining to his white counterparts.

    20. The debate over the best sociopolitical direction for African Americans not only crosses over to different generations but also crosses over to different forms of media.

      This pertains with the many different activist with all differing views from one another

    21. in doing so often found many of their solutions standing in stark contrast to the ideas of their fellow Black intellectuals and activists.

      The disputes between ideologies, such as Dubois and Booker T, with Dubois arguing for having his rights and equality now VS Booker wanting to accommodate.

    1. SciScore for 10.1101/2021.04.09.439147: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PVDF membranes were treated with 6xHis Tag Monoclonal Antibody (3D5) HRP (Invitorogen, USA) for 6xHis-tagged proteins, and ANTI-FLAG M2-peroxidase (HRP)-conjugated</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>M2-peroxidase</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, serial diluted recombinant ACE2 (from 1 μg/ml to 0.06 μg/mL) (ab151852, abcam), subsequent rabbit anti ACE2 antibody (HPA000288, Atlas Antibodies) and HRP conjugated anti rabbit IgG (7074S, Cell signaling) were incubated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>subsequent rabbit anti ACE2 antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect K-874A binding to immobilized S protein, serial diluted K-874A (1 μg/ml to 0.002 μg/ml) in 1%BSA/PBS was incubated, and K-874A which bound to S protein was detected by HRP-conjugated anti VHH antibody (#128-035-232, Jackson immuno Research).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti VHH</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 binding on and early replication in Vero/TMPRSS2 cells: 2.5×104 TCID50 (MOI=50) of SARS-CoV-2 was incubated with 150 μg/ml of VHHs for 2 hours at 37°C and then 24 hours at 4°C and inoculated to 5.0×104 VeroE6/TMPRSS2 cells for an hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw Illumina paired-end reads that passed through the Q30 filter were merged using PEAR software [21].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PEAR</div><div>suggested: (PEAR, RRID:SCR_003776)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VHHs-encoding sequences were translated based on standard genetic code using MEGA X software [22].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Equal numbers of ZsGreen-HiBiT-expressing cells and LgBiT-expressing cells were plated on a 96-well plate (1603101, ThermoFisher Science).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Science</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Individual movies were subjected to per-frame drift correction by MotionCor2 [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The contrast transfer function parameters of each micrograph were estimated using CTFFIND4 [27] and the flowing 2D and 3D classification, 3D refinement, and local resolution calculation were performed with RELION3.1 software [28].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION3.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extracted density was used to generate the mask using “Mask creation” in RELION 3.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The homology models of K-874A, RBD and NTD were rigid-body-fitted into the map using the COOT [31] and then refined using PHENIX [32].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. It should be defined inline. If you are using the img tag, that image should have semantic value to the content, which is why the alt attribute is required for validation. If the image is to be part of the layout or template, you should use a tag other than the img tag and assign the image as a CSS background to the element. In this case, the image has no semantic meaning and therefore doesn't require the alt attribute. I'm fairly certain that most screen readers would not even know that a CSS image exists.

      I believed this when I first read it, but changed my mind when I read this good rebuttal: https://hyp.is/f1ndKJ5eEeu_IBtubiLybA/stackoverflow.com/questions/640190/image-width-height-as-an-attribute-or-in-css

    2. Neither question nor answer appears to understand the notion of semantic HTML. Height and width are presentational attributes regardless of where you put them. For semantics we establish what the image means to content in the alt tag. I don't remember why it was so important to width/height in the HTML but I suspect it was in case you hit browsers without CSS rendering. It's not a semantics issue. If anything it thwarts separation of concerns to a degree.

      claim: that the OP's question and this answer are incorrect

      Could we say that this answer (that this comment replies to) missed the point?

      I actually believed and thought this answer was spot on ... until I read this comment, and then I reversed my opinion.

    1. What you want is not to detect if stdin is a pipe, but if stdin/stdout is a terminal.

      The OP wasn't wrong in exactly the way this comment implies: he didn't just ask how to detect whether stdin is a pipe. The OP actaully asked how to detect whether it is a terminal or a pipe. The only mistake he made, then, was in assuming those were the only two possible alternatives, when in fact there is (apparently) a 3rd one: that stdin is redirected from a file (not sure why the OS would need to treat that any differently from a pipe/stream but apparently it does).

      This omission is answered/corrected more clearly here:

      stdin can be a pipe or redirected from a file. Better to check if it is interactive than to check if it is not.

    1. By the way, the README file of the expect says there is a libexpect library that can be used to write programs on C/C++ which allows to avoid the use of TCL itself. But I'm afraid, this subject is beyond this article. Besides authors of expect themselves seem to prefer expect-scripts to the library.

      possible but doesn't seem preferred

      looking at what the authors themselves use

    1. SciScore for 10.1101/2021.04.08.21254348: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient selection, samples and Institutional Review Board permits: Experiments were carried out following the ethical principles established in the Declaration of Helsinki. Patients (or their representatives) were informed about the study and gave a written informed consent.<br>IACUC: Implications for therapeutic decision-making” approved by La Princesa Health Research Institute Research Ethics Committee (register # 4070) were used; samples and data from patients with severe vs mild disease were provided by the Biobank Hospital Universitario Puerta de Hierro Majadahonda (HUPHM)/Instituto de Investigación Sanitaria Puerta de Hierro-Segovia de Arana (IDIPHISA) (PT17/0015/0020 in the Spanish National Biobanks Network), they were processed following standard operating procedures with the appropriate approval of the Ethics and Scientific Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were stratified and randomly spliced into a training and a test set.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beads were incubated with either rabbit anti-His-tag antibody (Proteintech Group) or plasma from patients or healthy donors in a final volume of 50 μl in 96-well-plates (Nunc™ MicroWell™ 96-Well, Thermo Fisher Scientific) using the dilutions indicated in each experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To visualize antibody bound to antigen-coated beads, either PE-conjugated anti-rabbit antibody (0.25 μg/ml, Southern Biotech)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE-conjugated anti-rabbit antibody ( 0.25 μg/ml , Southern Biotech)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, PE-conjugated anti-human IgG and IgM, or FITC-conjugated anti-human IgA antibody (Immunostep S.L.) were added (30 μL/well) and incubated for 20 minutes at room temperature under agitation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant cDNAs coding for soluble S (residues 1 to 1208) and RBD (332 to 534) proteins were cloned in the pcDNA3.1 vector for expression in HEK-293F cells using standard transfection methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: To assess the prediction capacity of the new methodology, an algorithm was built using Scikit-learn python package [11] (code available on request).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparison between severe and mild patients in each variable was performed by multiple t-tests followed by False Discovery Rate (1%) correction by two-stage step-up method in Graph Pad Prism 8 Software (GraphPad Software, USA, www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      In addition to an impact on early classification of patients, current limitations in the availability of vaccine doses suggest a novel possible application for sensitive multi-antigen assays for SARS-CoV-2 seropositivity. It has been shown that the antibody response to the first vaccine dose in individuals with pre-existing immunity is comparable or greater to that observed in naïve individuals who have been immunized twice [17]. Screening of the unvaccinated population with an assay sufficiently sensitive to identify individuals previously infected despite waning of antibody titres over time, would allow these individuals to be given the vaccine as a single booster, sparing them from possible suffering and complications after a second dose, and freeing up many urgently needed vaccine doses to be given to individuals with no protection. The test described here would also provide comprehensive information to support selection of convalescent sera or plasma for therapeutic use. Our data indicate the importance of this multi-antigen, multi-isotype analysis to detect potential SARS-CoV-2 reinfections in vaccinated individuals and suggest a possible use in establishing alternative vaccine administration routes that may elicit more potent IgA responses. This multi-antigen and multi-Ig assay can be easily modified for detection of antibodies in other fluids as saliva and breast milk. It is also highly tunable to different research needs, including detection of different immunoglobul...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.08.438924: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells were routinely checked to confirm the absence of mycoplasma contamination.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound proteins were eluted from the beads using the elute buffer [25 mM Tris pH 8.0, 150 mM NaCl, 0.1% (w/v) DDM, 0.01% (w/v) CHS, and 250 ng/mL Flag peptide], and analyzed by immunoblotting using antibodies for the Strep tag (HuaxingBio, HX1816) or His tag (TransGen, HT501)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HT501</div><div>suggested: (Transgen Biotech Cat# HT501, RRID:AB_2801417)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were analyzed by immunoblotting using antibodies for the Flag tag (SIGMA, SLCD6338).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flag tag (SIGMA, SLCD6338</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: The HEK293T cell line was from EdiGene Inc., and Huh 7.5 cell line was from S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRISPRa screening for SARS-CoV-2 entry factors: The HEK293T cells were engineered to stably express the CRISPRa system including lenti dCAS-VP64_Blast and lenti MS2-P65-HSF1_Hygro vectors, termed as HEK293T-CRISPRa cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-CRISPRa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Strep-tagged S6P spike protein was expressed in the HEK293F cells and purified as described previously (50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO enrichment and expression pattern analysis: The Gene Ontology (GO) enrichment analysis of identified host factors (RRA score < 0.001) was performed using Metascape Resource (32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis of all data apart from CRISPRa screening was performed using GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 10 and 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. TTY is right there in the name, but this article makes no attempt to clarify what exactly the relationship between a pseudoterminal and a TTY. I feel like a whole paragraph about the relation to TTY would be warranted, including a link to TTY article, of course, which does link [back] to and explain some of the relation to pseudoterminal:

      In many computing contexts, "TTY" has become the name for any text terminal, such as an external console device, a user dialing into the system on a modem on a serial port device, a printing or graphical computer terminal on a computer's serial port or the RS-232 port on a USB-to-RS-232 converter attached to a computer's USB port, or even a terminal emulator application in the window system using a pseudoterminal device.

    1. Although echo "$@" prints the arguments with spaces in between, that's due to echo: it prints its arguments with spaces as separators.

      due to echo adding the spaces, not due to the spaces already being present

      Tag: not so much:

      whose responsibility is it? but more: what handles this / where does it come from? (how exactly should I word it?)

    1. There is a tendency in short luck-heavy games to require you to play multiple rounds in one sitting, to balance the scores. This is one such game. This multiple-rounds "mechanic" feels like an artificial fix for the problem of luck. Saboteur 1 and 2 advise the same thing because the different roles in the game are not balanced. ("Oh, well. I had the bad luck to draw the Profiteer character this time. Maybe I'll I'll draw a more useful character in round 2.") This doesn't change the fact that you are really playing a series of short unbalanced games. Scores will probably even out... statistically speaking. The Lost Cities card game tries to deal with the luck-problem in the same way.

      possibly rename: games: luck: managing/mitigating the luck to games: luck: dealing with/mitigating the luck problem

    1. Lag (2015:953) om kollektivtrafikresenärers rättigheter

      Kollektivtrafikresenärers rättigheter

      Lagen om kollektivtrafikresenärers rättigheter innehåller delar om tillgänglighet för personer med funktionsnedsättning. Lagen om kollektivtrafikresenärers rättigheter innehåller bestämmelser om reseinformation, ersättning och prisavdrag vid förseningar. Den innehåller också delar om att kunna säga upp periodbiljett vid resor i kollektivtrafik med tåg, spårvagn, tunnelbanetåg, buss och personbil. Enligt lagen har transportören en skyldighet att tillhandahålla information om en försening eller annan störning i trafiken och dess orsak, varaktighet och konsekvenser, resenärens rättigheter som finns i lagen transportörens allmänna avtalsvillkor, biljettpriser, tidtabeller och linjesträckningar, tillgänglighet till fordon, stationer och hållplatser, möjligheten att medföra cyklar och villkor för detta, säkerhets- och trygghetsfrågor hur transportören kan kontaktas. Information ska ges i den eller de former som är mest lämpliga för att resenärerna ska kunna ta del av informationen. Vid bedömningen av lämplig form ska särskild vikt läggas vid behoven hos personer med funktionsnedsättning. Konsumentverket har rätt att utfärda föreskrifter enligt lagen och har dessutom tillsynsansvar. Lag (2015:953) om kollektivtrafikresenärers rättigheter på riksdagens webbplats Senast granskad: 19 februari 2020 https://www.mfd.se/verktyg/lagar-och-regler-om-tillganglighet/transporter/kollektivtrafikresenarers-rattigheter/

    1. But other constraints in the horizon of intent have no external ana-logues. I may avoid doing certain things not because they aren't possible or because they are against the rules, but because I know that they are tacti-cally unwise. I could stand still in the batter's box after getting a hit in base-ball; however, I don't, because t hat would make it easier for an opposing player to tag me out. I could run straight into the maw of a boss during a boss battle; however, I don't, because I know that would get my character killed. My horizon of intent is defined not just by what I believe I can do, but also by what I believe I should do-my internal strategic constraints.

      The strategy in the game is not only what you want to do, but also what you should do. Because there are rules in the game, we should understand what we should do while having our own ideas.

    1. Author Response:

      We thank the editors and the reviewers for their positive assessment of our work.

      Reviewer #1 (Public Review):

      [...] One major concern is that the levels of protein expression and folding are not verified. This is concerning for the Gln118 mutation because lack of fitness could result trivially from misfolding or accelerated degradation that might result from increased flexibility and conformational stability. Moreover, the authors' finding that it was not possible to purify Gln118 mutant proteins for biochemical studies is consistent with this sort of trivial explanation for apparent lack of biological function.

      As described in the manuscript, the sidechain of Gln 118 makes hydrogen bonds with the backbone segment leading into an adjacent helix. We had omitted to point out in the original manuscript that Gln 118 is completely buried in thestructure (we now do so in the revised manuscript, on page 29). As shown by Worth and Blundell, buried polar sidechains that form backbone hydrogen bonds (as Gln 118 does) are highly conserved in proteins, and these polar sidechains are important for the stabilization of the protein architecture (Worth and Blundell BMC Evolutionary Biology 2010, 10:161). Thus, we do expect the mutation of Gln118 to destabilize the clamp loader structure. However, we do not find the identification of the importance of Gln118 to be a trivial finding, because the role of polar residues in maintaining structure is quite commonly linked to their functional role, making it difficult to separate the two effects. For example, the proximal histidine that links the F helix in hemoglobin to the iron atom is perhaps the most important residue for allosteric communication in hemoglobin. Mutation of the proximal histidine severely destabilizes hemoglobin, due to loss of heme binding and conversion to a molten globule state (see, for example, Brennan and Matthews, Hemoglobin, 21:393-403, 1997).

      It was an oversight for us to have not analyzed the effects of Q118 mutations on stability and function, and we have now rectified this. We now include the results of the following four experiments, in which we compare the expression of the mutant and wild-type forms of the clamp loader, their behavior on gel filtration analysis, and their activities in ATPase assays and DNA replication assays. These experiments demonstrate that the mutation most likely destabilizes the protein, and affects the nature of the assembled complex. These results further emphasize the crucial nature of the hydrogen-bonding interactions made by the Gln 118 sidechain.

      1) We created a clamp loader variant in which the ATPase subunit is C-terminally tagged with the fluorescent protein mCherry, allowing the expression levels of the proteins to be monitored by flow cytometry of E. coli cells. This experiment shows that introduction of the Q118N mutation leads to a very substantial reduction in protein expression (Figure 6 supplement 2 in the revised manuscript). An important point is that the proteins are expressed using a strong promoter (T7 RNA polymerase promoter), which was done so as to purify proteins for biochemical experimentation and also enable ready detection of the mCherry fluorescence. The natural T4 promoter that is used in the phage assay results in very low levels of protein expression (no detectable fluorescence signal when mCherry is fused to the ATPase subunit), and we do not know whether the expression defect that we see is also manifested under conditions where the protein expression is low. Nevertheless, the data do indicate that the Q118N mutation destabilizes the clamp loader complex.

      2) We purified mCherry tagged variants of the wild-type clamp-loader complex, the Q118N mutant complex, and the Q118N/I141L double mutant that has partial recovery of fitness in the phage propagation assay. SDS-PAGE analysis (not shown) confirms that all complexes have the ATPase and clasp subunits of the clamp loader in the proper 4:1 ratio. Gel filtration analysis shows that the wild-type complex corresponds to a single peak eluting at ~70 ml, which we assume corresponds to correctly assembled clamp loader (see Figure 9 supplement 1 in the revised manuscript). For both mutants, there is a peak at ~70 ml, corresponding to the properly assembled clamp loader, but also an additional peak that is close to the void volume of the column (~45 ml). For the Q118N mutant, the fraction of the protein corresponding to the properly assembled clamp loader is small. This fraction is substantially larger for the double mutant that has increased fitness (Q118N/I141L), indicating that one effect of the second mutation is to recover the ability of the clamp loader to assemble properly.

      3) We measured the rates of DNA-stimulated ATP hydrolysis for purified and mCherry-tagged wild-type clamp loader and the Q118N mutant, as we had described in the original manuscript for several other mutants (Figure 9 supplement 2 in the revised manuscript). Addition of the mCherry tag to the wild-type clamp loader results in a slight reduction of the ATPase activity. The Q118N mutation has a very low rate of DNA-stimulated ATPase activity (less than 10% of activity of the wild-type mCherry-tagged clamp loader). These data indicate that even in the fraction of Q118N mutant that can be purified as part of an intact clamp loader complex, the mutation compromises the ability to hydrolyze ATP. This is likely to be due to the failure to assemble into a competent conformation.

      4) We measured the extent of plasmid DNA replication by the T4 replisome, using wild-type and mutant clamp loaders, as described in the original manuscript (Figure 9 supplement 3 in the revised manuscript). As for the ATPase assay, addition of the mCherry tag to the wild-type clamp loader results in a slight reduction of replication efficiency. Introduction of the Q118N mutation leads to a near-total loss of replication efficiency, to a level comparable to that seen in the absence of the clamp loader.

      The main text of the manuscript now includes a description of these new results, and the new data are included as supplementary figures.

      Reviewer #2 (Public Review):

      [...] One potential weakness is that among all the questions posed at the beginning of the study not all received a definitive answer. In particular, the question "To what extent does the mutational sensitivity of the system in a particular organism, carrying out the essential function of DNA replication, reflect the sequence diversity seen across the spread of life?" is only partially addressed.

      We agree that we have not fully probed the issue of evolutionary sequence diversity versus mutational sensitivity. We find it exciting that the two sets of data show clear divergence in certain positions, pointing to epistasis. This will be an exciting direction for future exploration.

      The second question, "The clamp loader subunits respond cooperatively to the clamp, ATP and DNA. How do the mechanisms underlying this cooperativity impose constraints on the sequence?", has not been answered and goes beyond the scope of this study.

      Answering this question requires the analysis of second-order mutations. We have demonstrated the feasibility of using the phage propagation assay for such analysis, but we agree with the reviewer that this is beyond the scope of the present study.

    1. Socializationallows users to share their personal collections and see who else isreading the same publications, including added information suchas related papers with the same keyword (or ‘‘tag’’) and what notesother people have written about a given publication.

      Compartir contenido de biblioteca digital, proceso de uso de información en la Web 2.0

    1. SciScore for 10.1101/2021.04.06.438709: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B-cell isolation and recombinant mAb production: Discovery and initial characterization of six antibodies in our panel was previously reported (S309 and S3044,17, S2X35, S2H13 and S2H1417, and S2E128), and six new antibodies are first described here (S2H97, S2X16, S2H58, S2D106, S2X58, S2X227).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2H1417</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2E128</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epitope classes shown in Fig. 1a are defined as in Piccoli et al.17 Briefly, the classification of these epitope classes results from Octet binning experiments using structurally characterized antibodies, structural insights to define the recognition of open-only RBD and ability of antibodies to interfere with RBD binding to ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed, and secondarily labeled with 1:200 PE-conjugated goat anti-human-IgG antibody (Jackson ImmunoResearch 109-115-098) to label for bound antibody, and 1:100 FITC-conjugated chicken anti-Myc-tag (Immunology Consultants Lab, CYMC-45F) to label for RBD surface expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We sorted approximately 7.5e6 RBD+ cells per library on a BD FACSAria II, collecting yeast cells from the antibody-escape sort bin (fractions of library falling into antibody escape bin given in Extended Data Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape sort bin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sorted cells were recovered overnight, plasmids were extracted from the pre-sort and antibody-escape populations, and variant-identifier barcode sequences were PCR amplified and sequenced on an Illumina HiSeq 25003,28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape populations ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As previously described3,23, sequencing counts pre- and post-selection were used to estimate the “escape fraction” for each library variant, which reflects the fraction of yeast expressing a variant that fall into the antibody-escape FACS bin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape FACS bin .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The interactive visualizations of antibody escape maps (https://jbloomlab.github.io/SARS-CoV-2-RBD_MAP_Vir_mAbs) were created using dms-view42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dms-view42</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Although we have various follow-up binding data illustrating reduced affinity binding for some “escaped” sarbecovirus RBDs, these follow-up experiments were not conducted systematically for all antibody/RBD combinations, and therefore would bias breadth estimates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody/RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These antibodies and their citations include: S2X259, accompanying paper Tortorici et al. 2021; LY-CoV55521; COV2-2196 and COV2-213033; REGN10933, REGN10987, and LY-CoV01623; and all other COV2 antibodies and CR30223.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR30223</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2c incorporate the authentic SARS-CoV-2 neutralization IC50s as reported in this study (Fig. 1a), together with the live SARS-CoV-2 neuralization IC50s for the COV2 antibodies reported by Zost et al.10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">goat anti-human IgG secondary antibody (Southern Biotech, 2040-04) was added and incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat anti-human IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2040-04, RRID:AB_2795643)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lenti-X 293T cells (Takara, 632180) were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were used for VSV-SARS-CoV-2, VSV-SARS-CoV-1, and VSV-GD-Pangolin-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BHK-21 cells stably expressing ACE2 were used for VSV-GX-Pangolin-CoV and VSV-WIV1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 HexaPro Spike protein for cryoEM analysis was produced in HEK293F cells grown in suspension using FreeStyle 293 expression medium (Life Technologies) at 37°C in a humidified 8% CO2 incubator rotating at 130 r.p.m.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Escape clones were plaque-purified on Vero cells in the presence of mAb, and plaques in agarose plugs were amplified on MA104 cells with the mAb present in the medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent neutralization data were analyzed and graphed using Prism (GraphPad, v9.0.1)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The geometric mean from at least two independent experiments was calculated using Excel (Microsoft, Version 16.45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene sequence phylogeny was inferred using RAxML version 8.2.1249, with the GTRGAMMA substitution model and a partition model with separate parameters for first, second, and third codon positions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 was performed using the Python scikit-learn package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3D refinements were carried out using non-uniform refinement64 along with per-particle defocus refinement in CryoSPARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutant RBD:S309 complexes were constructed from the fully glycosylated WT RBD:S309 complex using PyMOL 2.3.5 (Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The glycosylated proteins were parameterized with the Amber ff14SB74 and GLYCAM_06j-175 force fields.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amber</div><div>suggested: (AMBER, RRID:SCR_016151)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-bonded interactions were treated with the Particle Mesh Ewald method79 using a real-space cutoff of 1.0 nm and the OpenMM default relative error tolerance of 0.0005, with grid spacing selected automatically.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OpenMM</div><div>suggested: (OpenMM, RRID:SCR_000436)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.06.438579: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Formaldehyde fixed cells were washed with phosphate buffered saline and permeabilized for immunofluorescence using 0.1% Triton X-100 in PBS with 1% bovine serum albumin (BSA) fraction V (www.emdmillipore.com) and stained for SARS-CoV-2 with a primary anti-Nucleocapsid antibody (www.genetex.com GTX135357) labeled with AlexaFluor 594.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: (GeneTex Cat# GTX135357, RRID:AB_2868464)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins in VLP and cell lysates were separated on 10% SDS-PAGE gels, transferred to PVDF membranes, and immunoblotted with the following antibodies (Fig 7A): mouse monoclonal anti-V5 tag (www.thermofisher.com, #R960-25), rabbit polyclonal anti-SARS M (generous gift of C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were detected using horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (www.bio-rad.com) or HRP-donkey anti-rabbit IgG (www.bio-rad.com) and Western Clarity detection reagent (www.bio-rad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antiviral test of amilorides: Vero E6 and Caco-2 were obtained from ATCC and grown in DMEM (www.corning.com) with 10% FBS, 10mM HEPES, and Penicillin-Streptomycin (www.thermofisher.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 isolate USA-WA1/2020 (www.beiresources.org) was propagated on Caco-2 cells and infectious units quantified by focus forming assay using Vero E6 (ATCC) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were cultured in complete Dulbecco’s modified Eagle medium containing 10% Fetal Bovine Serum and penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 and CC50 were determined using the nonlinear regression analysis in GraphPad Prism 9 with the bottom and top parameters constrained to 0 and 100, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chemiluminescence was detected using a Bio-Rad Chemi Doc imaging system and analyzed using Bio-Rad Image Lab v5.1 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Image</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. The diagram shows the client libraries communicate with the Server passing each Selenium command for execution. Then the server passes the Selenium command to the browser using Selenium-Core JavaScript commands. The browser, using its JavaScript interpreter, executes the Selenium command. This runs the Selenese action or verification you specified in your test script.

      This is my annotation.

    1. SciScore for 10.1101/2021.04.06.438614: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, acetonitrile (ACN), ammonium bicarbonate (NH4HCO3), anti-FALG antibody, anti-FLAG M2 affinity gel, and neuraminidase were purchased from Sigma-Aldrich (St. Louis, MO, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FALG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>neuraminidase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S protein subunit 1 (His tag) expressed by HEK-293 cells were purchased from Sanyoubio (Shanghai,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The glycosites and glycoforms of S protein purified from HEK-293T cells were confirmed according to the mass spectrometry results of commercial S1 using a ‘match between runs’ analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometric data analysis: The LC-MS/MS raw data were analyzed manually for each glycopeptide using Xcalibur 3.0.63 (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the MD simulations were performed using the Amber14 package(Case et al., 2014).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amber14</div><div>suggested: (Assisted Model Building with Energy Refinement (AMBER, RRID:SCR_014230)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 29. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to Reviewers

      Title: "Towards deciphering the Nt17 code: How the sequence and conformation of the first 17 amino acids in Huntingtin regulate the aggregation, cellular properties, and neurotoxicity of mutant Httex1".

      Tracking #: RC-2021-00675 Authors: Vieweg et al.

      MAJOR COMMENTS from Referees #1, #2, and #3

      Referee #1

      General comments

      « The manuscript by Vieweg, Mahul-Mellier, Ruggeri et al., describes the role of the sequence and conformation of the extreme N-terminus of the Huntingtin protein in terms of aggregation and toxicity together with its relation to the polyglutamine length. The authors use some outstanding methods to ensure that the conclusions are based on good quality data. Overall, this is an excellent study.

      We thank the referee for the very positive feedback and for recognizing the quality of our work and his/her appreciation of our systematic approach to dissect the role of the Nt17 domain in regulating the aggregation, cellular properties, and neurotoxicity of mutant Httex1.

      “The manuscript is generally well written although it might benefit from reducing the length of the discussion section ».

      We thank the referee for his/her valuable comment. We have reduced by 10% the discussion as per requested.

      Major comments

      1) “For their in vitro data, the authors do not go beyond 42 polyglutamines. Is there any particular reason for that? The authors see a clear difference between 36Q and 42Q, but although not critical, it would have been useful to use longer repeats. In my view, the authors should at least discuss the rationale for this, particularly as in cellular models they do use 72Q constructs.”

      We thank the referee for raising this point.

      Most HD patients have a polyQ repeat stretch of 40-45 glutamines (1-4).

      In vitro, the use of Httex1 constructs consisting of 42 polyglutamine residues is sufficient to induce mutant Httex1 aggregation and fibril formation. Mutant Httex1 proteins with polyQ repeats of 72Q or higher are highly aggregation-prone and difficult to purify, handle, or disaggregates. This is why all of the in vitro aggregation studies are based on mutant Htt proteins with polyQ ranging from 23Q-53Q (5-14). We have reviewed the literature carefully and were unable to identify any in vitro studies with recombinant Htt proteins containing polyQ repeats of 72 or greater.

      In cells, induction of mature Htt inclusions requires much longer polyQ repeats. This is clearly reflected by the fact that most cellular studies use mutant Htt with polyQ repeats above 64Q and up to 160Q to induce the formation of cellular aggregates (10, 15-30).

      We have recently conducted a systematic study on the effect of the polyQ repeat length on Htt inclusion formation in cells https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21). Characterization of the inclusions by EM revealed that the polyQ tract length dramatically influences the ultrastructure properties and the architecture of the Httex1 inclusions in cells. The dark shell structure that delimitated the core from the periphery of the Httex1 72Q inclusions was absent in the Httex1 39Q inclusions. Also, the Httex1 39Q inclusions appeared less dense compared to that of the Httex1 72Q. Finally, no significant cell death was observed in HEK cells overexpressing 39Q constructs while overexpression of Httex1 72Q was toxic. For these reasons, we and others select to use Httex1 with polyQ repeat of 75 or higher.

      2) « The role of the N-terminus 17 aminoacids of huntingtin (Nt17) is addressed by comparing peptides with and without the Nt17 and their relation to the adjacent polyglutamine tract. Using this approach, the peptide without the Nt17 is composed of pure polyglutamines in its N-terminus, followed by the rest of exon 1 in its C-terminus. This is clearly the key comparison to address the role of the Nt17 in the context of an exon1 containing polyQ. »

      Yes. In fact, we did perform this experiment and assessed if the addition of the Nt17 would be sufficient to inhibit mutant Httex1 aggregation or make ΔNt17-Httex1 aggregate similar to Httex1. This data is included in the original version of the manuscript as Figure S5 in supporting material. We observed that that __the presence of the Nt17 peptide during the aggregation of ΔNt17-exon1 fibrils did not interfere with the aggregation kinetic of mutant Httex1 or alter the fibril morphology of ΔNt17-exon1,__ indicating that intramolecular interactions between the Nt17 domain and the adjacent polyQ tract are key determinants of mutant HTtex1 fibrillization and fibril morphology.

      Referee #2

      General comments

      This article describes the results from studies into mechanisms of the aggregation and toxicity of Htt Exon1 protein. The authors investigated the role of N17, polyQ length, M9C mutation, and phosphorylation. Multiple approaches were used that included biochemical protein design, biophysical measurements, and cell biological experiments with cultured mammalian cells. The authors demonstrate the effects of protein context on aggregation. Furthermore, the authors were able to visualize the aggregates in mammalian cells and in neurons using multiple methods. These are interesting data.

      We greatly appreciate the positive feedbacks on our data and our systematic and integrative approaches.

      There are several major weaknesses in the study. First problem is that most of the results related to aggregation mechanisms and toxicity are not original and incremental when compared to many previously published articles.

      We respectfully disagree with this assessment and suggestion that our studies are not original and represent only incremental advances.

      Originality

      Our study provides novel mechanistic insights into the role of not only the sequence but also the conformational properties of the Nt17 domain in regulating the dynamics of Httex1 fibrillization, the kinetic fibril growth, the structure and morphology of Httex1 fibrils. Besides, we also addressed for the first time how the Nt17 domain and phosphorylation at different residues within this domain regulate the cellular uptake, subcellular localization (phosphorylated proteins) and toxicity of extracellular monomeric and fibrillar forms of mutant Httex1 in primary neurons. We are not aware of previous reports that have conducted similar studies addressing these questions and using multiple methods. Also, some of our findings using native Httex1 sequences are not in agreement with previous reports using Httex1 proteins fused to peptide/protein tags, thus underscoring the limitations of previous studies.

      1) We demonstrated that the Nt17 domain plays an important role in shaping the surface properties of mutant Httex1 fibrils and regulate their lateral association and cellular uptake. Our findings are not in agreement with previous findings published in eLife by Shen et al. __(10)__, where they reported that removal of the Nt17 domain has the opposite effect of what we observed in our study, i.e., ∆Nt17 promotes the formation of fibrils that exhibit a low tendency to laterally associated and form a “bundled” architecture (10). Careful examination of their constructs revealed that all the proteins they used contained a highly charged 15-mer peptide tag (S-tag: Lys-Glu-Thr-Ala-Ala-Ala-Lys-Phe-Glu-Arg-Gln-His-Met-Asp-Ser) at the C-terminus of Httex1, which we believe would strongly influence the aggregation properties of the mainly uncharged ∆Nt17-Httex1 and Httex1 protein, thus possibly explaining the discrepancy between our findings and those of Shen et al (10). In fact, a previous study has shown that adding short peptide tags such as the HA or the LUM tag to mutant Htt171 changed the toxicity dramatically. In addition, we show that the subcellular localization of Htt171 expressed in cells (e.g: expression of Htt171 carrying the LUM tag was more toxic than untagged Htt171 and induced the formation of nuclear aggregates rather than the classical cytoplasmic aggregates) (31). The reference to this paper is now included and discussed in the main manuscript (page 11).

      Our observations __highlight__ the critical importance of using tag-free proteins to investigate the sequence and structural determinants of Httex1 aggregation and structure.

      2) Our study is the first to demonstrate that the Nt17 domain influences the relationship between fibril length and polyQ repeat length. This correlation disappears when the Nt17 is removed. This aspect of our work was not explored by Shen et al. (10), who limited their in vitro aggregation study to Httex1 wild-type and mutants (∆Nt17 or ∆PRD for Polyn Rich Domain).

      3) This is also the first study to assess the effect of modulating the helicity of Nt17 on fibrils growth and morphology and Httex1 cellular properties.

      1. a) Using the helix and membrane-binding disrupting mutation (M8P), we showed that disrupting the Nt17 helix (M8P mutation) slows the aggregation propensity of Httex1 in vitro but does not alter the morphology of the fibrils. In contrast, removing the Nt17 domain leads to a strong lateral association of the fibrillar aggregates with ribbon-like morphology. This demonstrated that the __Nt17 sequence, but not its helical structure, is the key determinant of the quaternary packing of Httex1 fibrils. Shen et al. (10) did not investigate the effect of modulating the helicity of Nt17 on fibrils growth and morphology using M8P mutant__.
      2. b) Our cellular studies comparing the membrane association and uptake of extracellularly added Httex1 43Q and M8P Httex1 43Q fibrils in primary rat striatal neurons showed that disrupting the Nt17 helix promotes the internalization of M8P Httex1 while Httex1 stays bound to the plasma membrane. These findings suggest that the Nt17 helical conformation persists in the fibrillar state or that the Nt17 domain regains its helical structure upon interaction with the plasma membrane resulting in the sequestration of Httex1 fibrils at the membrane and impeding their uptake. This aspect of our study has never been explored in previous studies.
      3. c) Using the site-specific bona fide phosphorylation on T3, S13, SS16, and both S13/S16, this is the first study that shows that modulation of the overall helicity of Httex1 through site-specific phosphorylation of the Nt17 domain (pT3 stabilizes the alpha-helical conformation of Nt17 while pS13 and/or pS16 disrupts it (9)) enhance the rapid uptake of extracellular Httex1 monomeric species into neurons and their nuclear accumulation. Previous studies relied on phosphomimetic mutations (32), which we have shown do not reproduce the effect of phosphorylation at these residues on the structure of Nt17 (8, 9). Shen et al. __(10) did not investigate the effect of modulating the helicity of Nt17 on fibrils growth and morphology using site-specific __phosphorylation of the Nt17 domain. 4) Our overexpression model in HEK cells showed that removing the Nt17 domain or disrupting its helical structure (M8P mutation) was sufficient to prevent the cell death induced by Httex1 72Q overexpression and reduce the number of cells with inclusions drastically. Our data indicate that the cell death level correlates with the number of cells that contain inclusions or the number of inclusions formed in the cells or/and their subcellular localization. In contrast to our results, Shen et al.,__(10)__ demonstrated that the overexpression of ΔN17-Httex1 induced toxicity at a similar level as the full-length Httex1 in striatal-derived neurons or neurons from cortical rat brain slices culture, although ΔN17-Httex1 led to a significant reduction of punctate structures in these cells. The discrepancy between these studies and our Httex1 overexpression model in HEK cells may be due to the fact that in neurons, Httex1 lacking the Nt17 domain accumulates in the nucleus. In contrast, in HEK, it stayed mostly cytosolic. In line with this hypothesis, it has been recently shown that cytosolic inclusions (Httex1 200Q) and nuclear aggregates (Httex1 90Q) contribute – to various extents – to the onset and the progression of the disease in a transgenic HD mice model (33). Thus, the difference in cellular localization but also the cell type (HEK vs. neurons) could influence the toxic response of the cells to the overexpression of ∆Nt17-Httex1, with toxicity triggered only by the nuclear ∆Nt17-Httex1 species.

      5) This is also the first study to investigate the role of the Nt17 domain and Nt17 PTMs in influencing the uptake, the subcellular localization, and the toxicity of extracellular Httex1 species (monomers and fibrils) in primary neurons. We showed that the helical propensity of Nt17 strongly influences the uptake of Httex1 fibrils into primary striatal neurons. At the same time, phosphorylation (at T3 or S13/S16) or removal of the Nt17 domain increased the uptake and accumulation of Httex1 fibrils into the nucleus and induced neuronal cell death. Our findings suggest that the Nt17 domain is exposed in the fibrillar state and is sufficiently dynamic to mediate fibril-membrane interactions and internalization.

      Altogether our results, combined with previous findings from our groups and others demonstrating the role of Nt17 in regulating Htt degradation (34-36), suggest that this domain serves as one of the key master regulators of Htt aggregation subcellular localization of the pathological aggregates, and their toxicity. They further demonstrate that targeting Nt17 represents a viable strategy for developing disease-modifying therapies to treat HD.

      Limitations of previous studies:

      Although the effects of the Nt17 domain in regulating Httex1 aggregation and cellular properties have been studied and reported on by other groups, we would like to stress that most of the published studies had major limitations and used protein constructs that do not share the sequence of native Httex1 and exhibit biophysical and cellular properties that differ from those of native Httex1 sequences.

      1) Many of the studies used Httex1-like model peptides (13, 37), which do not contain the complete sequence of Httex1 (e.g., Nt17 peptide (37)), contain additional solubilizing amino acids such as lysine residues(38-43) or are fused to large proteins (e.g., GST, YFP) (37).

      2) Other studies relied on artificial fusion constructs whereby the polyQ domain (44-46) or Httex1 itself (12, 47-61) are fused to large solubilizing protein tags, such as glutathione-S-transferase (GST), maltose-binding protein (MBP) or thioredoxin (TRX) or C-terminal S-tag (10, 62, 63) or fluorescent proteins (e.g., GFP or YFP) (10, 15, 49, 64, 65) for the cellular studies.

      One of the major limitations of using fusion constructs as precursors for the generation of Httex1 (12, 47-61) is the requirement to cleave the fusion protein in situ by adding a protease to release and initiate the aggregation of Httex1. Enzyme-mediated cleavage of Httex1-fusion proteins often results in the incorporation of additional amino acids at the N- or C-terminus of the protein. This could alter the biophysical and biochemical properties of Httex1 because of the important role of the Nt17 domain and the proline-rich domain in regulating the conformational and aggregation properties of the protein (38, 40, 43, 65, 66). Moreover, it has been shown that commonly used enzymes such as trypsin and thrombin may lead to cleavages within the Nt17 domain and result in the generation of undesired Httex1 fragments (7, 42, 60). The net effect of incomplete and/or unspecific enzymatic cleavage of Httex1 fusion proteins is the generation of heterogeneous protein mixtures, which precludes accurate interpretation and comparison of aggregation and structural data across different laboratories.

      Moreover, several studies have shown that the fusion of small peptide tags or large fusion protein alters the aggregation of mutant Httex1 in vitro and in cells.

      1. We have previously shown that the presence of such tags (e.g., GST) alters the ultrastructural and biochemical properties of Httex1 as well as its aggregation properties in vitro (11).

      We have also recently completed a comprehensive assessment of the GFP tag's impact on the aggregation, inclusion formation, and cellular properties of Httex1 (preprint paper available in BioRxiv https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21)). In this paper, we show that inclusions produced by mutant Httex1 72Q-GFP exhibit striking differences in terms of organization, ultrastructural properties, composition, and their impact on mitochondria functions as compared to the inclusions formed by the tag-free mutant Httex1 72Q. These findings highlight the critical importance of developing new tools that minimize the impact of large fluorescent proteins and/or label-free imaging methods and monitoring Htt aggregation in inclusion formation in cells.

      From Riguet et al., __(21)__. Influence of GFP on the ultrastructural properties of Httex1 cellular inclusions by Correlative light electron microscopy (CLEM). CLEM of Httex1 72Q (+/-GFP) transfected in HEK 293 cells after 48h. Confocal images of A. Httex1 72Q and. B Httex1 72Q GFP, 48h after transfection. Httex1 expression (red) was detected using a specific primary antibody against the N-terminal part of Htt (amino acids 50-64) and the nucleus was stained with DAPI (blue). Electron micrographs of C. Httex1 72Q and D. Httex1 72Q GFP inclusions corresponding to confocal images panel A, and B (white square), respectively. Add-in binary images generated from electron micrographs by median filtering and Otsu intensity threshold. E. **Schematic depictions and original electron micrographs of cytoplasmic inclusions formed by native (tag-free) mutant Huntington exon1 proteins (Httex1 72Q, left) and the corresponding GFP fusion protein (Httex1 72Q-GFP).

      A recent study by Chongtham et al. (31) also supports our findings and shows that adding short peptide tags such as the HA or the LUM tag to mutant Htt171 changed dramatically the toxic properties of Htt171 as well as its subcellular localization and the compactness of the aggregates formed in cells (e.g.: expression of Htt171 carrying the LUM tag was more toxic than untagged Htt171 and induce the formation of nuclear aggregates rather than the classical cytoplasmic aggregates, See Figure 4).

      Figure 4 from Chongtham et al., __(31)__. The influence of peptide modifications on HTT171 fragment behavior. (A) When expressed ubiquitously with da>Gal4, the HTT171-120Q fragment exhibits little or no lethality, but appending either an HA ( ... YPYDVPDYA)oraLUMtag ( ... GCCPGCCGG) to the C-terminus dramatically increases the toxicity of the fragment. (B) Surviving adult flies expressing an HA-tagged HTT171 transgene exhibit about half the life span of those expressing untagged 171. Flies expressingLUM-tagged HTT171 do not survive to adulthood. (C) Flies expressing HA- or LUM-tagged 171 in tracheal cells show only modest increases in lethality that do not rise to the level of significance (P=0.12; 0.09), but the inclusion of tags changes the subcellular behavior significantly. (D) In contrast, in the prothoracic gland, expression of LUM-tagged 171 shows a significant increase in toxicity compared to 171 alone, while the HA-tagged 171 borders on significance (P=0.051). (E) In trachea, pure 171 forms cytoplasmic aggregates, while the inclusion of HA causes some HTT to become nuclear diffuse, and inclusion of the LUM tag causes the bulk of the HTT to appear as diffuse nuclear material with some cytoplasmic aggregates remaining when expressed with btl>Gal4 at 29◦C. (F) In the prothoracic gland, addition of the LUM tag causes aggregated- **cytoplasmic HTT to become weakly staining diffuse-cytoplasmic material while HTT171HA remains as extensive aggregates in the cytoplasm with a haze of diffuse staining as well. Scale bars are 10 μm

      Therefore, in this study, we aimed to investigate for the first time the role of the sequence and the conformational properties of the Nt17 domain in regulating the dynamics of Httex1 fibrillization, the structure and morphology of Httex1 fibrils using a tag-free Httex1 constructs. In our studies, we used multiple methods to examine the structural and cellular properties of these proteins under the same conditions and in the same cellular systems, thus making it possible to correlate the sequence, structural and cellular properties of the different Httex1 proteins (monomers and fibrils). We are happy to see that this was nicely recognized and appreciated by the referee.

      Referee #1 “The authors use some outstanding methods to ensure that the conclusions are based on good quality data. Overall, this is an excellent study.” Referee #3 “Their findings provided the precise information for the role of tag-free Nt17. The paper advanced our knowledge of Nt17, especially in the Huntington disease field.”

      Major comments

      Referee #2 raised the following concerns:

      1) « The main hypothesis of this study solely depends on the ability of N17 domain to enhance aggregation (Fig 1 and Fig 2). According to the method for the protein solubilization 1mM TCEP was added to ∆Htt-Ex1, but not to Htt-Ex1 proteins. It is necessary to rule out the potential effects of TCEP on aggregation assay. »

      We thank the referee for raising this important point. Indeed, we were also concerned about the potential effect of TCEP and conducted experiments to address this point. Our data show that TCEP does not affect our aggregation assay. This new panel is now included in supporting information as Figure S2A-B and mentioned in the corresponding section of the Material and method (page 29).

      2) « The author needs to provide biophysical data of the mutation and phosphorylated proteins with/without Tag. »

      All the proteins used in this study have been extensively characterized in recent publications from our lab __(9, 11, 21)__. All these papers are cited throughout our manuscript as well as in the material and method section.

      The expression, purification and characterization of native tag-free Httex1 with polyQ repeats ranging from 7 to 49Q has been fully described in Vieweg et al., 2016 __(11)__. In this paper, the aggregation properties of tag-free Httex1 and Httex1 fused to GST or MBP tags were compared by sedimentation assay, while the morphology and length of the resulting fibrils were compared by EM.

      The semisynthesis, purification, and characterization of Httex1 42Q phosphorylated at Ser-13 and/or Ser-16 or at T3 was described respectively in Deguire et al., 2018 __(9) and Chiki et al., 2017 (8)__. These studies include kinetics of aggregation and morphological assessment (i.e: heights and lengths) by EM and AFM of the fibrils formed by phosphorylated or unphosphorylated mutants Httex1.

      The Httex1 mutants carrying the GFP tag were not used in the in vitro studies but were studied in our overexpression-based cellular model. The direct comparison characterization of inclusion formation by tag-free and GFP-tagged mutant Httex1 and their impact on cellular homeostasis are fully described in a preprint paper available in BioRxiv https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21). In this paper, we show that inclusions produced by mutant Httex1 72Q-GFP exhibit striking differences in terms of organization, ultrastructural properties, composition, and their impact on mitochondria functions as compared to the inclusions formed by the tag-free mutant Httex1 72Q. These findings highlight the critical importance of developing new tools that minimize the impact of large fluorescent proteins and/or label-free imaging methods and monitoring Htt aggregation in inclusion formation in cells.

      Referee #3

      General comments

      “Their findings provided the precise information for the role of tag-free Nt17.__ The paper advanced our knowledge of Nt17, especially in the Huntington disease field.”__

      We thank referee #3 for the very positive feedback and for recognizing the quality, depth and significance of our work and its potential impact in the field of Huntingtin disease.

      “However, the conceptual advance is limited.”

      We respectfully disagree with this assessment that the conceptual advance of our study is limited.

      Please see our detailed response to Referee #2 regarding our work's originality and novelty (pages 3-8, in our referees' letter).

      Major comments

      Referee #3 raised the following concerns:

      1) Finding of lateral association (bundling) of __Δ__Nt17-Httex1 fibrils is interesting.

      We agree and thank the referee for further highlighting this point.

      However, pathological significance is not clear

      We agree that the significance for delta 17 is not clear as we do not know whether this cleavage occurs in vivo or not. This is why we decided to extend our studies beyond the removal of Nt17 and investigated the effect of natural PTMs that are known to alter the sequence of Nt17 and modulate its helicity. One additional distinguishing feature of our work is that we used proteins (monomers and fibrils) that bear site-specific bona fide phosphorylation on T3, S13, SS16, and both S13/S16.

      1. a) Does even non-truncated form also increase this kind of bundling when polyQ is expanded? We have addressed this specific question in a previous study (11) in which we have compared the morphology and length of fibrils formed from Httex1 with polyQ tract from 23Q to 43Q. The increased lateral association was not observed for the fibrils generated from Httex1 43Q or Httex1 23Q, 29Q, or 37Q (Figure 5F) (11). Besides, in this paper, we were the first to show an inverse correlation between the polyQ-length and fibril length, which suggests structural differences between Httex1 proteins with different polyQ repeat lengths. Others have investigated Httex1 with different polyQ repeat, but not using tag-free Httex1 proteins, and they did not observe this inverse relationship between polyQ lenth and fibril length, as we did here and in our previous studies (11).

      2. b) When fibrils are added to striatal neurons like in Fig.5, is this structural feature preserved on the membrane or inside of the cells? We agree with the referee that this is an important point to address. However, deciphering the structural properties of the membrane-bound and internalized fibrils is not trivial, especially given the limited amount of unlabelled fibrils that are taken up by the cells. This would require extensive optimization of the CLEM technique or the use of an alternative approach such as tomography. Due to the resources and time required to address this important question, this part of the project will be included as part of future projects aimed at investigating the mechanisms of Htt seeding and propagation. We are not aware of any reports by other groups that monitor the structural changes of exogenous fibril after internalization into cells.

      3. c) When Httex1 fibrils species are expressed, is this bundling also observed? In fact, we have recently completed a comprehensive analysis of the comparison of the inclusions formed by mutant Httex1-72Q and ΔNt17 Httex1.

      In this study, we have shown that the expression of Httex1 72Q and the truncated form ΔNt17 Httex1 72Q form cytosolic inclusions of similar size and shape in HEK 293 (Figure 4). We have further characterized the architecture and organization of these inclusions at the ultrastructural level in the context of another project. Our findings are now available online (see Riguet et al., 2021, BioRxiv (21)).

      Using correlative light electron microscopy, we showed that the inclusions formed by Httex1 full length or lacking the Nt17 domain exhibited similar architecture and a ring-like organization. Interestingly, we showed the inclusions are composed of highly organized fibrillar network at the core and periphery of the inclusions. In cells inclusion formation is a multiphasic process driven by different phases of polyQ dependent aggregation processes and complex interactions with lipids, proteins and organelles (ER).

      Although CLEM approach in neurons provides very good contrast of cytosolic or nuclear inclusions, the resolution of this method is not sufficient to allow imaging at the level of individual fibrils and assessing their morphology. Differences between CLEM and EM resolution can be explained as the slices of the cellular objects are much thicker (~ 50 nm) than the fibrils prepared in vitro and directly deposited on the EM grids (the height of Httex1 pre-formed fibrils is between 5 and 7 nm). To improve the imaging and get a stronger contrast of de novo fibrils in our CLEM samples, we used a double-contrast method based on uranyl acetate and lead citrate stains. Nevertheless, the complex cellular environment and the presence of various cellular objects (e.g: organelles and proteins) surrounding the de novo fibrils might prevent the optimal stain penetration from allowing imaging at the level of individual fibrils. Finally, the preparation of the neuronal samples for CLEM imaging includes ethanol and detergents incubation and resin embedding. These steps can limit the ultrastructure detection of the de novo fibrils at the level of individual fibrils and therefore does not allow to determine their organization and their lateral association.

      1. d) What function (cell death, membrane integrity or others) is most correlated with this structural feature? In our extracellular model, we have shown that the conformation and sequence properties of the Nt17 domain are key determinants of the internalization and the subcellular localization of Httex1 fibrils in primary striatal neurons. Httex1 43Q fibrils mostly accumulate at the outer side of the neuronal plasma membrane, Httex1-ΔNt17 43Q fibrils were detected primarily in the nucleus and the M8P-Httex1 43Q fibrils were equally distributed in the cytosol and nucleus.

      Despite exhibiting completely different subcellular distribution and internalization levels, the 3 types of fibrils induced neuronal cell death with the highest toxicity observed for ∆Nt17-Httex1 (Figure 7).

      Our data suggest that the neurotoxic response is primarily dependent on the subcellular localization of the Httex1 species: 1) accumulation of the Httex1 43Q fibrils on the plasma membrane is likely to induce loss of membrane integrity, based on previous observation with aSyn fibrils; 2) the nuclear accumulation of ∆Nt17-Httex1 aggregates has been previously shown to be highly toxic in several cellular and animal models (10, 67, 68).

      Nevertheless, we could not rule out that the high toxicity of ΔNt17-Httex1 fibrils could also be due to their distinct biophysical and structural properties. ΔNt17-Httex1 forms broad fibrils characterized by lateral association, which could provide a surface for the sequestration of intracellular proteins.

      2) The authors claimed, “we investigated for the first time, the role of the Nt17 sequence, PTMs and conformation in regulating the internalization and cell-to-cell propagation of monomeric and fibrillar forms of mutant Httex1”. However, so far this reviewer understands that the authors studied the internalization but not cell-to-cell propagation.

      We agree and apologize for this mistake as we indeed only limited our study to the uptake, subcellular localization, and toxicity of extracellular Httex1 species in our primary neuronal model. The text has been amended, and cell-to-cell propagation has been removed from the abstract as well as in pages 2, 4, 12, and 17.

      Minor points for Referees #1, #2 and #3

      Referee #1

      1. « On page 6, the data on how the Nt17 domain affects Httex1 aggregation, the information on which figure it is referring to is missing. Done. The information regarding the Figure related to this data has now been added page 6.

      In Figure 1A, it is difficult to compare the data on Nt17 and DNt17, particularly for 36Q and 42Q, as the time axis are different. I understand that the kinetics are different, but particularly for the 42Q peptides (Nt17 and DNt17) as their kinetics are not that different, it may be useful to show them in the same panel. »

      Done. The new panel that combined the data on Nt17 and DNt17 has now been added as Figure S1B.

      Referee #2

      1) “Fig 8 the color codes for PolyQ and PolyP need to be corrected. »

      Done.

      2) “It is a challenging technical problem to produce proteins which are rich in Pro and Gln content. But there is not enough experimental details provided in the methods. Please add detailed procedures for expression and purification of these proteins. »

      We thank referee #2 for recognizing the technical challenges to express and produce Httex1 proteins and mutants. The expression, purification and characterization methods of all the proteins used in this manuscript have been extensively detailed in our previous studies (8, 9, 11, 69-71). We have now added the relevant references in the method section (page 29).

      Referee #3

      1) « Fig.3B arrowhead could not be seen. »

      Done. Arrowheads are now added to Fig. 3B.

      2) « Fig.4A: what do arrows mean? No scale bars? »

      The arrows indicate the aggregates formed in HEK cells overexpressing Httex1 39Q and 72Q. This now added to the legend section of the Figure 4.

      The scale bars are already present in both the main and the insets images.

      3) « Fig.5A:no scale bars? »

      Done. Scale bars were added in the 4 images where they were missing.

      4) « Fig.S3. Height and length seem to be wrong. »

      The measurement of height and length are performed as in literature (72), and are consistent with previous studies (8, 9, 11).

      5) « Fig.S6C: hard to compare. D: What is Htt2-90? Also in Fig.S13. »

      We thank the referee for bringing this to our attention and apologize for the lack of consistency in the names used for the proteins studied in Figures S6 and S13. We realized that in Figures S6 and S13 the names of the proteins have been either mislabelled due to the dash that was misplaced or the same proteins have been named in different ways. We agree that this makes it difficult to compare the data between the different panels. We have now corrected our mistakes and Figures S6B and S13 have been updated accordingly.

      The name Htt2-90 corresponds to Httex1 expressed from amino acid 2 to amino acid 90, with the first N-terminal methionine removed.

      6) « There are many abbreviations difficult to understand in supplement. » Fig.S1 Htt18-90(Q18C) etc.

      His6-Intein Ssp stands for the Intein tagged with Histidine amino acid (6 units)

      Htt18-90(Q18C) means Httex1 expressed from amino acid 18 to amino acid 90 with the Glutamine (Q) in position 18 mutated in a Cysteine (C).

      Htt2-17 means Httex1 synthesized from amino acid 2 to amino acid 17, with the first N-terminal methionine removed.

      Htt18-90(Q18A) corresponds to Httex1 expressed from amino acid 18 to amino acid 90 with the Q in position 18 mutated in an Alanine (A).

      References

      1. M. E. MacDonald, S. Gines, J. F. Gusella, V. C. Wheeler, Huntington’s Disease. NeuroMolecular Medicine 4, 7-20 (2003).
      2. S. E. Andrew et al., The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington's disease. Nature genetics 4, 398-403 (1993).
      3. J. F. Gusella, M. E. MacDonald, Huntington's disease: the case for genetic modifiers. Genome Med 1, 80 (2009).
      4. J. M. Andresen et al., The relationship between CAG repeat length and age of onset differs for Huntington's disease patients with juvenile onset or adult onset. Ann Hum Genet 71, 295-301 (2007).
      5. A. S. Wagner et al., Self-assembly of Mutant Huntingtin Exon-1 Fragments into Large Complex Fibrillar Structures Involves Nucleated Branching. Journal of molecular biology 430, 1725-1744 (2018).
      6. Y. Sun, A. Savanenin, P. H. Reddy, Y. F. Liu, Polyglutamine-expanded Huntingtin Promotes Sensitization of N-Methyl-D-aspartate Receptors via Post-synaptic Density 95. Journal of Biological Chemistry 276, 24713-24718 (2001).
      7. A. Ansaloni et al., One-pot semisynthesis of exon 1 of the Huntingtin protein: new tools for elucidating the role of posttranslational modifications in the pathogenesis of Huntington's disease. Angewandte Chemie (International ed. in English) 53, 1928-1933 (2014).
      8. A. Chiki et al., Mutant Exon1 Huntingtin Aggregation is Regulated by T3 Phosphorylation-Induced Structural Changes and Crosstalk between T3 Phosphorylation and Acetylation at K6. Angewandte Chemie International Edition 10.1002/anie.201611750, 1-6 (2017).
      9. S. M. DeGuire et al., N-terminal Huntingtin (Htt) phosphorylation is a molecular switch regulating Htt aggregation, helical conformation, internalization, and nuclear targeting. Journal of Biological Chemistry 293, 18540-18558 (2018).
      10. K. Shen et al., Control of the structural landscape and neuronal proteotoxicity of mutant Huntingtin by domains flanking the polyQ tract. eLife 5, 1-29 (2016).
      11. S. Vieweg, A. Ansaloni, Z. M. Wang, J. B. Warner, H. A. Lashuel, An intein-based strategy for the production of tag-free huntingtin exon 1 proteins enables new insights into the polyglutamine dependence of Httex1 aggregation and fibril formation. Journal of Biological Chemistry 291, 12074-12086 (2016).
      12. J. Legleiter et al., Mutant huntingtin fragments form oligomers in a polyglutamine length-dependent manner in Vitro and in Vivo. Journal of Biological Chemistry 285, 14777-14790 (2010).
      13. B. Sahoo, D. Singer, R. Kodali, T. Zuchner, R. Wetzel, Aggregation behavior of chemically synthesized, full-length huntingtin exon1. Biochemistry 53, 3897-3907 (2014).
      14. J. C. Boatz et al., Protofilament structure and supramolecular polymorphism of aggregated mutant huntingtin exon 1. Journal of molecular biology 10.1016/j.matdes.2019.108334 (2020).
      15. F. J. B. Bäuerlein et al., In Situ Architecture and Cellular Interactions of PolyQ Inclusions. Cell 171, 179-187.e110 (2017).
      16. A. Iwata, B. E. Riley, J. A. Johnston, R. R. Kopito, HDAC6 and microtubules are required for autophagic degradation of aggregated Huntingtin. Journal of Biological Chemistry 280, 40282-40292 (2005).
      17. M. Kim et al., Mutant Huntingtin Expression in Clonal Striatal Cells : Dissociation of Inclusion Formation and Neuronal Survival by Caspase Inhibition. The Journal of neuroscience : the official journal of the Society for Neuroscience 19, 964-973 (1999).
      18. Y. E. Kim et al., Soluble Oligomers of PolyQ-Expanded Huntingtin Target a Multiplicity of Key Cellular Factors. Molecular cell 63, 950-964 (2016).
      19. H. Luo et al., Herp Promotes Degradation of Mutant Huntingtin: Involvement of the Proteasome and Molecular Chaperones. Molecular neurobiology 10.1007/s12035-018-0900-8 (2018).
      20. T. R. Peskett et al., A Liquid to Solid Phase Transition Underlying Pathological Huntingtin Exon1 Aggregation. Molecular cell 10.1016/j.molcel.2018.04.007, 1-14 (2018).
      21. N. Riguet et al., Disentangling the sequence, cellular and ultrastructural determinants of Huntingtin nuclear and cytoplasmic inclusion formation. bioRxiv 10.1101/2020.07.29.226977, 2020.2007.2029.226977 (2020).
      22. K. Tagawa et al., Distinct aggregation and cell death patterns among different types of primary neurons induced by mutant huntingtin protein. Journal of Neurochemistry 89, 974-987 (2004).
      23. Z. Zheng, A. Li, B. B. Holmes, J. C. Marasa, M. I. Diamond, An N-terminal nuclear export signal regulates trafficking and aggregation of huntingtin (Htt) protein exon 1. Journal of Biological Chemistry 288, 6063-6071 (2013).
      24. S. W. Davies et al., Formation of Neuronal Intranuclear Inclusions Underlies the Neurological Dysfunction in Mice Transgenic for the HD Mutation. Cell 90, 537-548 (1997).
      25. L. Mangiarini et al., Exon I of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87, 493-506 (1996).
      26. D. Martindale et al., Length of huntingtin and its polyglutamine tract influences localization and frequency of intracellular aggregates. Nature genetics 18, 150-154 (1998).
      27. J. Ochaba et al., PIAS1 Regulates Mutant Huntingtin Accumulation and Huntington's Disease-Associated Phenotypes In Vivo. Neuron 90, 507-520 (2016).
      28. G. Schilling et al., Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Human Molecular Genetics 8, 397-407 (1999).
      29. G. Matsumoto, S. Kim, R. I. Morimoto, Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Molecular Properties in Human Cells. The Journal of biological chemistry 281, 4477-4485 (2006).
      30. S. Waelter et al., Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Molecular biology of the cell 12, 1393-1407 (2001).
      31. A. Chongtham et al., Effects of flanking sequences and cellular context on subcellular behavior and pathology of mutant HTT. Human molecular genetics 29, 674-688 (2020).
      32. T. Maiuri, T. Woloshansky, J. Xia, R. Truant, The huntingtin N17 domain is a multifunctional CRM1 and ran-dependent nuclear and cilial export signal. Human Molecular Genetics 22, 1383-1394 (2013).
      33. C. Landles et al., Subcellular Localization And Formation Of Huntingtin Aggregates Correlates With Symptom Onset And Progression In A Huntington’S Disease Model. Brain Communications 2 (2020).
      34. C. Cariulo et al., Phosphorylation of huntingtin at residue T3 is decreased in Huntington’s disease and modulates mutant huntingtin protein conformation. Proceedings of the National Academy of Sciences 10.1073/pnas.1705372114, 201705372-201705372 (2017).
      35. R. N. Hegde et al., TBK1 phosphorylates mutant Huntingtin and suppresses its aggregation and toxicity in Huntington's disease models. The EMBO journal 10.15252/embj.2020104671, e104671 (2020).
      36. L. M. Thompson et al., IKK phosphorylates Huntingtin and targets it for degradation by the proteasome and lysosome. Journal of Cell Biology 187, 1083-1099 (2009).
      37. R. S. Atwal et al., Kinase inhibitors modulate huntingtin cell localization and toxicity. Nature chemical biology 7, 453-460 (2011).
      38. A. Bhattacharyya et al., Oligoproline effects on polyglutamine conformation and aggregation. Journal of molecular biology 355, 524-535 (2006).
      39. S. Chen, V. Berthelier, W. Yang, R. Wetzel, Polyglutamine aggregation behavior in vitro supports a recruitment mechanism of cytotoxicity. Journal of molecular biology 311, 173-182 (2001).
      40. S. L. Crick, K. M. Ruff, K. Garai, C. Frieden, R. V. Pappu, Unmasking the roles of N- and C-terminal flanking sequences from exon 1 of huntingtin as modulators of polyglutamine aggregation. Proceedings of the National Academy of Sciences 110, 20075-20080 (2013).
      41. K. Kar, M. Jayaraman, B. Sahoo, R. Kodali, R. Wetzel, Critical nucleus size for disease-related polyglutamine aggregation is repeat-length dependent. Nature Structural and Molecular Biology 18, 328-336 (2011).
      42. R. Mishra et al., Serine phosphorylation suppresses huntingtin amyloid accumulation by altering protein aggregation properties. Journal of molecular biology 424, 1-14 (2012).
      43. A. K. Thakur et al., Polyglutamine disruption of the huntingtin exon1 N-terminus triggers a complex aggregation mechanism Ashwani. Nat Struct Mol Biol 16, 380-389 (2009).
      44. D. Bulone, L. Masino, D. J. Thomas, P. L. San Biagio, A. Pastore, The interplay between PolyQ and protein context delays aggregation by forming a reservoir of protofibrils. PloS one 1, e111 (2006).
      45. L. Masino, G. Kelly, K. Leonard, Y. Trottier, A. Pastore, Solution structure of polyglutamine tracts in GST-polyglutamine fusion proteins. FEBS Letters 513, 267-272 (2002).
      46. Y. Nagai et al., A toxic monomeric conformer of the polyglutamine protein. Nature Structural and Molecular Biology 14, 332-340 (2007).
      47. E. J. Bennett, N. F. Bence, R. Jayakumar, R. R. Kopito, Global Impairment of the Ubiquitin-Proteasome System by Nuclear or Cytoplasmic Protein Aggregates Precedes Inclusion Body Formation. Molecular cell 17, 351-365 (2005).
      48. C. W. Bugg, J. M. Isas, T. Fischer, P. H. Patterson, R. Langen, Structural features and domain organization of huntingtin fibrils. Journal of Biological Chemistry 287, 31739-31746 (2012).
      49. P. R. Dahlgren et al., Atomic force microscopy analysis of the Huntington protein nanofibril formation. Nanomedicine: Nanotechnology, Biology, and Medicine 1, 52-57 (2005).
      50. W. C. Duim, Y. Jiang, K. Shen, J. Frydman, W. E. Moerner, Super-resolution fluorescence of huntingtin reveals growth of globular species into short fibers and coexistence of distinct aggregates. ACS Chemical Biology 9, 2767-2778 (2014).
      51. J. M. Isas, R. Langen, A. B. Siemer, Solid-State Nuclear Magnetic Resonance on the Static and Dynamic Domains of Huntingtin Exon-1 Fibrils. Biochemistry 54, 3942-3949 (2015).
      52. J. Legleiter et al., Monoclonal antibodies recognize distinct conformational epitopes formed by polyglutamine in a mutant huntingtin fragment. Journal of Biological Chemistry 284, 21647-21658 (2009).
      53. E. Monsellier, V. Redeker, G. Ruiz-Arlandis, L. Bousset, R. Melki, Molecular interaction between the chaperone Hsc70 and the N-terminal flank of huntingtin exon 1 modulates aggregation. Journal of Biological Chemistry 290, 2560-2576 (2015).
      54. P. J. Muchowski et al., Hsp70 and Hsp40 chaperones can inhibit self-assembly of polyglutamine proteins into amyloid-like fibrils. Proceedings of the National Academy of Sciences 97, 7841-7846 (2000).
      55. Y. Nekooki-machida et al., Distinct conformations of in vitro and in vivo amyloids of huntingtin-exon1 show different cytotoxicity. Proceedings of the National Academy of Sciences 106, 9679-9684 (2009).
      56. L. G. Nucifora et al., Identification of novel potentially toxic oligomers formed in vitro from mammalian-derived expanded huntingtin exon-1 protein. Journal of Biological Chemistry 287, 16017-16028 (2012).
      57. L. Pieri, K. Madiona, L. Bousset, R. Melki, Fibrillar α-synuclein and huntingtin exon 1 assemblies are toxic to the cells. Biophysical Journal 102, 2894-2905 (2012).
      58. M. A. Poirier et al., Huntingtin spheroids and protofibrils as precursors in polyglutamine fibrilization. Journal of Biological Chemistry 277, 41032-41037 (2002).
      59. E. Scherzinger et al., Huntingtin encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell 90, 549-558 (1997).
      60. E. Scherzinger et al., Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: implications for Huntington's disease pathology. Proceedings of the National Academy of Sciences of the United States of America 96, 4604-4609 (1999).
      61. J. L. Wacker, M. H. Zareie, H. Fong, M. Sarikaya, P. J. Muchowski, Hsp70 and Hsp40 attenuate formation of spherical and annular polyglutamine oligomers by partitioning monomer. Nature Structural and Molecular Biology 11, 1215-1222 (2004).
      62. M. Jayaraman et al., Kinetically competing huntingtin aggregation pathways control amyloid polymorphism and properties. Biochemistry 51, 2706-2716 (2012).
      63. A. K. Thakur, W. Yang, R. Wetzel, Inhibition of polyglutamine aggregate cytotoxicity by a structure-based elongation inhibitor. FASEB J 18, 923-925 (2004).
      64. D. W. Colby et al., Potent inhibition of huntingtin aggregation and cytotoxicity by a disulfide bond-free single-domain intracellular antibody. Proceedings of the National Academy of Sciences of the United States of America 101, 17616-17621 (2004).
      65. S. Tam, R. Geller, C. Spiess, J. Frydman, The chaperonin TRiC controls polyglutamine aggregation and toxicity through subunit-specific interactions. Nature Cell Biology 8, 1155-1162 (2006).
      66. R. S. Atwal et al., Huntingtin has a membrane association signal that can modulate huntingtin aggregation, nuclear entry and toxicity. Human Molecular Genetics 16, 2600-2615 (2007).
      67. X. Gu et al., N17 Modifies Mutant Huntingtin Nuclear Pathogenesis and Severity of Disease in HD BAC Transgenic Mice. Neuron 85, 726-741 (2015).
      68. M. B. Veldman et al., The N17 domain mitigates nuclear toxicity in a novel zebrafish Huntington's disease model. Molecular neurodegeneration 10, 67 (2015).
      69. M. s. Anass Chiki et al., One -pot Semi synthesis Of Exon1 Of The Mutant Huntingtin Protein : An Important Advance Towards Elucidating The Molecular And Structural Determinants Of Huntingtin's. Health and Biomedical, 1047-1047 (2014).
      70. A. Chiki et al., Site-specific phosphorylation of Huntingtin exon 1 recombinant proteins enabled by the discovery of novel kinases. Chembiochem : a European journal of chemical biology 10.1002/cbic.202000508 (2020).
      71. A. Reif, A. Chiki, J. Ricci, H. A. Lashuel, Generation of native, untagged huntingtin Exon1 monomer and fibrils using a SUMO fusion strategy. Journal of Visualized Experiments 2018, 1-9 (2018).
      72. F. S. Ruggeri, T. Šneideris, M. Vendruscolo, T. P. J. Knowles, Atomic force microscopy for single molecule characterisation of protein aggregation. Arch Biochem Biophys 664, 134-148 (2019).
    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The authors investigated the structural feature of N-terminal amino acid (Nt17) of Huntingtin, the gene product of Huntington disease. Nt17 was reported to play roles in modulating Huntingtin's aggregation, its life cycle, membrane binding and toxicity, however, those reports used tagged Nt17 and the authors thought the tags have the potential influence to the aggregation process and others and used tag-free Nt17-huntingtin exon1(Httex1) protein. Using Nt17 deleted Httex1 and mutant which disrupt helix conformation such as M8P, and phosphorylated Nt17, they found Nt17 sequence but not its helical conformation determined the morphology and growth of Httex1 fibrils in vitro. In cells, Nt17 sequence and its helical conformation influenced on aggregation propensity and toxic properties. Furthermore, the uptake o Httex1 into primary striatal neurons is influenced by the helical propensity of Nt17. They concluded Nt17 domain serves as the master regulator of Htt aggregation and toxicity. Their findings provided the precise information for the role of tag-free Nt17.

      Major concerns:

      1) Finding of lateral association(bundling) of ΔNt17-Httex1 fibrils is interesting. However, pathological significance is not clear. a) Does even non-truncated form also increase this kind of bundling when polyQ is expanded? b) When fibrils are added to striatal neurons like in Fig.5, is this structural feature preserved on the membrane or inside of the cells? c) When Httex1 fibrils species are expressed, is this bundling also observed? d) What function (cell death, membrane integrity or others) is most correlated with this structural feature?

      2) The authors claimed < we investigated for the first time, the role of the Nt17 sequence, PTMs and conformation in regulating the internalization and cell-to-cell propagation of monomeric and fibrillar forms of mutant Httex1.>. However, so far this reviewer understand, the authors studied the internalization but not cell-to-cell propagation.

      Minor points

      1) Fig.3B arrowhead could not be seen.

      2) Fig.4A: what do arrows mean? The insets are hard to identify. No scale bars?

      3) Fig.5A:no scale bars?

      4) Fig.S3. Height and length seem to be wrong.

      5) Fig.S6C: hard to compare. D:What is Htt2-90? Also in Fig.S13.

      6) There are many abbreviations difficult to understand in supplement. Fig.S1 Htt18-90(Q18C) etc.

      Significance

      The paper advanced our knowledge of Nt17, especially in the Huntington disease field. However, the conceptual advance is limited.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This article describes the results from studies into mechanisms of the aggregation and toxicity of Htt Exon1 protein. The authors investigated role of N17, polyQ length, M9C mutation, and phosphorylation. Multiple approaches were used that included biochemical protein design, biophysical measurements, and cell biological experiments with cultured mammalian cells. The authors demonstrates effects of protein context on aggregation. Furthermore, the authors were able to visualize the aggregates in mammalian cells and in neurons using multiple methods. These are interesting data, but there are several major weaknesses in the study. First problem is that most of the results related to aggregation mechanisms and toxicity are not original and incremental when compared to many previously published articles. Moreover, there are several problems in interpretation of obtained data and in making conclusions. Some of the most critical problems are listed below.

      • The main hypothesis of this study solely depends on the ability of N17 domain to enhance aggregation (Fig 1 and Fig 2). According to the method for the protein solubilization 1mM TCEP was added to ∆Htt-Ex1, but not to Htt-Ex1 proteins. It is necessary to rule out potential effects of TCEP on aggregation assay.
      • The author needs to provide biophysical data of the mutation and phosphorylated proteins with/without Tag. As stated by the authors, even the slight change in a protein context could lead to unexpected changes in structural behavior of a protein. Thus, importance of Tag needs to be evaluated.
      • It is a challenging technical problem to produce proteins which are rich in Pro and Gln content. But there is not enough experimental details provided in the methods. Please add detailed procedures for expression and purification of these proteins.
      • Fig 8 the color codes for PolyQ and PolyP need to be corrected.

      Significance

      This article describes the results from studies into mechanisms of the aggregation and toxicity of Htt Exon1 protein. The authors investigated role of N17, polyQ length, M9C mutation, and phosphorylation. Multiple approaches were used that included biochemical protein design, biophysical measurements, and cell biological experiments with cultured mammalian cells. The authors demonstrates effects of protein context on aggregation. Furthermore, the authors were able to visualize the aggregates in mammalian cells and in neurons using multiple methods. These are interesting data, but there are several major weaknesses in the study. First problem is that most of the results related to aggregation mechanisms and toxicity are not original and incremental when compared to many previously published articles. Moreover, there are several problems in interpretation of obtained data and in making conclusions. Some of the most critical problems are listed below.

      • The main hypothesis of this study solely depends on the ability of N17 domain to enhance aggregation (Fig 1 and Fig 2). According to the method for the protein solubilization 1mM TCEP was added to ∆Htt-Ex1, but not to Htt-Ex1 proteins. It is necessary to rule out potential effects of TCEP on aggregation assay.
      • The author needs to provide biophysical data of the mutation and phosphorylated proteins with/without Tag. As stated by the authors, even the slight change in a protein context could lead to unexpected changes in structural behavior of a protein. Thus, importance of Tag needs to be evaluated.
      • It is a challenging technical problem to produce proteins which are rich in Pro and Gln content. But there is not enough experimental details provided in the methods. Please add detailed procedures for expression and purification of these proteins.
      • Fig 8 the color codes for PolyQ and PolyP need to be corrected.
    1. SciScore for 10.1101/2021.04.06.438630: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Use of healthy volunteer PBMC for this project, including those from WBS, was ethically approved by the Cardiff University School of Medicine Research Ethics Committee (SMREC) nos. 20/55 and 20/101.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used were against HLA-ABC (W632; AbD Serotec), NCR3LG1/B7-H6 (MAB7144, Biotechne R&D Systems), Nectin 1 (R1.302; Biolegend), MICA (AMO1-100; BAMOMAB), MICB (BMO2-100; BAMOMAB), ULBP2 (BUMO1; BAMOMAB), Spike (1A9; Insight), Nucleocapsid (1C7; Stratech), anti-mouse IgG AF647 (Thermofisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HLA-ABC</div><div>suggested: (Leica Biosystems Cat# NCL-HLA-ABC, RRID:AB_563879)</div></div><div style="margin-bottom:8px"><div>MAB7144</div><div>suggested: (R and D Systems Cat# MAB7144, RRID:AB_2636810)</div></div><div style="margin-bottom:8px"><div>BMO2-100</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BAMOMAB</div><div>suggested: (BAMoMAB Cat# BM02-100, RRID:AB_2636812)</div></div><div style="margin-bottom:8px"><div>ULBP2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (SouthernBiotech Cat# 1030-31, RRID:AB_2794301)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cells were harvested using TrypLE Express (Gibco), preincubated for 30 min with the relevant antibody or serum preparations, then mixed with PBMCs at an effector:target (E:T) ratio of 10:1 in the presence of GolgiStop (0.7 μl/ml, BD Biosciences), Brefeldin-A (1:1000, Biolegend) and anti-CD107a–FITC (clone H4A3, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Brefeldin-A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD107a–FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody (anti-nucleocapsid 1C7, Stratech, 1:500 dilution) was added in PBST containing 1% non-fast milk and incubated for 1h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing in PBST, secondary antibody (anti-mouse IgG-HRP, Pierce, 1:3,000 dilution) was added in PBST containing 1% non-fat milk and incubated for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody depletions: Anti-spike antibody was depleted from sera using magnetic bead conjugated spike trimer protein (Acrobiosystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: A549 were transduced with lentiviruses expressing human ACE2, and TMPRSS2 (AAT cells), as previously described 27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The England2 strain of SARS-CoV2 was obtained from Public Health England (PHE), grown on VeroE6 cells, and titrated by plaque assay on both VeroE6 and AAT, as previously described27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were midiprepped (Nucleobond Xtra Midi; Machery-Nagel), and transfected into 293T cells using GeneJuice (Merck) according to manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were loaded onto a trapping column (300μm x 5mm PepMap cartridge trap (Thermo Fisher)) at 10μL/min for 5 minutes at 60 degrees.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PepMap</div><div>suggested: (BioWorks, RRID:SCR_014594)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During the gradient elution, mass spectra were acquired with the parameters detailed in Fig S4 using Tune v3.3 and Xcalibur v4.3 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository74 with the dataset identifier PXD025000 and 10.6019/PXD025000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional Annotation Clustering: Assessment of enriched gene annotation terms in temporal cluster one was carried out using the Functional Annotation Clustering tool at DAVID (david.ncifcrf.gov) v6.875, using the default clustering settings for medium stringency and the following libraries: Uniprot UP_Keyword, GOTERM:MF_ALL, BIOCARTA,, KEGG_PATHWAY and REACTOME_PATHWAY.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAVID</div><div>suggested: (DAVID, RRID:SCR_001881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and transfections: Lentivirus plasmids encoding each SARS-CoV2 ORF individually, with a C-terminal twin-strep tag, were obtained from Addgene76.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Addgene76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cells were harvested using TrypLE Express (Gibco), preincubated for 30 min with the relevant antibody or serum preparations, then mixed with PBMCs at an effector:target (E:T) ratio of 10:1 in the presence of GolgiStop (0.7 μl/ml, BD Biosciences), Brefeldin-A (1:1000, Biolegend) and anti-CD107a–FITC (clone H4A3, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired using an AttuneNxT (Thermo Fisher) and analyzed with Attune NxT software or FlowJo software version 10 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where sera were tested at a range of dilutions, the area under the curve (AUC) was calculated using Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.02.437747: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intermediate R&D preparations of swine glyco-humanized polyclonal antibody against SARS-CoV-2 have been prepared, presenting variable anti-SARS-CoV-2 binding activities 17.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 binding activities 17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike/ACE-2 neutralization assay: An assay was developed to assess the properties of anti-SARS-CoV-2 spike antibodies to inhibit binding of ACE-2 to immobilized spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike RBD antibodies diluted in PBS-Tween-0.05%-1% skimmed milk (dilution range between 50 and 0.39 µg/mL) were then added and incubated for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1h incubation at room temperature and 3 washes, the mouse Fc tag was revealed with a specific HRP-conjugated anti-mouse IgG secondary antibody (diluted in in PBS-Tween-0.05%-1% skimmed milk powder at 1:1000, incubated 1h at RT and washed 3 times).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stocks were generated using one passage of isolates on Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CPE reduction assay was performed as follows: Vero E6 cells were seeded in 96-well clusters at a density of 5,000 cells/well 2 days before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 were analyzed by nonlinear regression using a four-parameter dosage-response variable slope model with the GraphPad Prism 8.0.2 software (GraphPad Software, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04453384</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Safety and Efficacy of XAV-19 in Patie…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04469179</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Pharmacokinetics of SAB-185 in Amb…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. I respectfully disagree with your assessment. You are referencing the quote "It's not appropriate to use the aside element just for parentheticals, since those are part of the main flow of the document." However the OP specifically said that they are looking for a semantic element for "a note that may be useful to read at a given point of a tutorial, but is not part of the main tutorial flow". That is what "aside" is for. It's not part of the main content flow.

      That's a tough one. I can see it both ways.

    2. <aside> is appropriate if the side note "could be considered separate from the content"

      From a programmer's perspective:

      • It shouldn't be in an <aside>, if it is actually directly about what is in <main>
      • An <aside> should be able to be evaluated on its own, (almost entirely) in isolation from, and not dependent on anything in, the <main> content. This could be especially important/relevant for screen readers.
    1. Subsequent maintenance requires an expenditureof under US$10 per acre every two to three years

      It is truly sad that our country will dump so much money into infrastructure and politics but not conservation and ecosystem management. I know everything has a cost, but with so many billionaires and overall wealthy people in this country, conservation efforts should be one of the lead measures to consider. Putting a price tag on our ecosystems is just so disturbing. Without our biodiversity and ecosystems, money, politics and every other issue is completely irrelevant.

    1. Tangentially is defined as briefly mentioning a subject but not going into it in detail, or is defined as going off in a different direction.

      in the case of

      briefly mentioning a subject but not going into it in detail the topic/subject need not be related at all (it sounds like).

      What about in the case fo:

      is defined as going off in a different direction. Does the fact that it's going off in a different direction imply that it at least starts out connected/related to the original (starting point) subject (as it does in the geometry sense of tangential)? Or does it permit "jumping" to another topic (in another direction) without being related/connected at all??

      I don't think I like this definition very much. It doesn't quite fit the sense I'm trying to use it for in my tag:

      tangentially related content (aside)

      Ah, here's a definition that matches what I thought it meant (one of the senses anyway): https://hyp.is/3Bn2bpZ7Eeu3Ok8vg03AVA/www.merriam-webster.com/dictionary/tangential

    1. The digital tools many students have access to both inside and outside the classroom require us all to take a hard look at the way we use these tools in the context of learning experiences. It’s easy to get caught up with the shiniest, brightest, or most attention-grabbing digital device or website, but it is possible to pause, reflect, and prioritize tasks over digital tools in the classroom. Are we putting the learning first?

      This is a valid point, but it also creates an issue of equitability for students too. The digital world comes with a price tag that often has to be footed by underfunded school districts in order to make sure that all students have access to the tools.

    1. Exercise can tackle symptoms of schizophrenia

      Not only am I unsurprised by this, but I'd be surprised if it were otherwise. The logic is that schizophrenia is a sleep disorder, and exercise enhances sleep. Additionally, lack of movement is one of the negative symptoms of schizophrenia. Therefore, this poverty of movement may play a role in the pathogenesis of schizophrenia symptoms.

      I need to start a google search document with predictions prior to actually searching. It will slow down my research speed, but it is necessary in order to provide unbiased data on my intuitive understanding of diseases. It seems like the majority of my strong intuitions are true. Edit: I'll just record the search phrase in my hypothes.is notes. This one was "exercise schizophrenia"

  2. Mar 2021
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Overall, we were pleased that the reviewers found our study carefully designed and interesting. We have addressed their comments below.

      Reviewer #1 (Evidence, reproducibility and clarity)

      The manuscript by Kern, et al., demonstrates that phagocytosis in macrophages is regulated in part by the intermolecular distance of phagocytosis-promoting receptors engaging phagocytic targets. Cells expressing chimeric receptors containing cytosolic domains of Fc receptors (FcR) and defined ligand-binding DNA domains were used to drive phagocytosis of opsonized glass beads coated with complementary DNA ligands of defined spacing and number. These so-called origami ligands allowed manipulation of receptor spacing following engagement, which allowed the demonstration that tight spacing of ligands (7 nm or 3.5 nm) optimized signaling for phagocytosis. The study is carefully performed and convincing. I have a few technical concerns and minor suggestions.

      1. It is assumed that the origami preparations were entirely uniform. How much variation was there? Is that supported by TIRF microscopy of origami preparations? Was the TIRF microscopy calibrated for uniformity of fluorescence (ie., shade correction)?

      Our laboratory, Dong et al., has extensively characterized the origami uniformity and robustness of these exact pegboards. This paper was just posted on bioRxiv (Dong et. al, 2021). We have also cited this paper in our revised manuscript in reference to the characterization of the DNA origami (Line 117).

      We did not use any shade correction. Instead we only collected data from a central ROI in our TIRF field. To check for uniformity of illumination, we plotted the origami pegboard fluorescent intensity along the x and y axis. We observed very modest drop off in signal - the average signal intensity of origamis within 100 pixels of the edge is 76 ± 6% the intensity of origamis in a 100 pixel square in the center of the ROI. Fitting this data with a Gaussian model resulted in very poor R values. While this may account for some of the variation in signal intensity at individual points, we expect the normalized averages of each condition to be unaffected. We have amended the methods to describe this strategy (Lines 851-854).

      [[images cannot be shown]]

      2. Likewise, how much variation was there in the expression of the chimeric receptors? Large variation in receptor numbers per cell could significantly alter the quantitative studies. Aside from the flow sorting for cells expressing two different molecules, how were cells selected for analysis?

      We thank the reviewer for bringing up this point. We confirmed comparable receptor expression levels at the cell cortex of the DNA CAR-𝛾 and the DNA CAR-adhesion used throughout the paper. We also have confirmed that receptor levels at the cell cortex were similar for the large DNA CAR constructs used in Figure 6C-D. This data is now included in Figures S5 and S7. We have also altered the text to include this (lines 169-172):

      Expression of the various DNA CARs at the cell cortex was comparable, and engulfment of beads functionalized with both the 4T and the 4S origami platforms was dependent on the Fc__𝛾R signaling domain (Figure S5).

      When quantifying bead engulfment, cells were selected for analysis based on a threshold of GFP fluorescence, which was held constant throughout analysis for each individual experiment. We have amended the “Quantification of engulfment” methods section to convey this (lines 921-923).

      3. The scale of the origami relative to the cells is difficult to discern in Figures 2C and D. Additional text would be helpful to indicate, for example, that the spots on the Fig. 2D inset indicate entire origami rather than ligand spots on individual origami particles.

      Thank you for pointing this out, we see how the legend was unclear and have corrected it (lines 453-454), including specifically noting “Each diffraction limited magenta spot represents an origami pegboard.” We have also outlined the cell boundary in yellow to make the cell size more clear.

      4. Figure 5 legend, line 482: How was macrophage membrane visualized for these measurements?

      We have added the following clarification (line 535-536): “The macrophage membrane was visualized using the DNA CAR__𝛾, which was present throughout the cell cortex.”

      5. line 265: "our data suggest that there may be a local density-dependent trigger for receptor phosphorylation and downstream signaling". This threshold-dependent trigger response was also indicated in the study of Zhang, et al. 2010. PNAS.

      The Zhang et al. study was influential in our study design, and we wish to give the appropriate credit. Zhang et al. found that a sufficient amount of IgG is necessary to activate late (but not early) steps in the phagocytic signaling pathway. In contrast, our study addresses IgG concentration in small nanoclusters. We find that this nanoscale density affects receptor phosphorylation. Thus, we think these two studies are distinct and complementary.

      Lines 283-287 now read:

      While this model has largely fallen out of favor, more recent studies have found that a critical IgG threshold is needed to activate the final stages of phagocytosis (Zhang et al., 2010). Our data suggest that there may also be a nanoscale density-dependent trigger for receptor phosphorylation and downstream signaling.

      6. line 55: Rephrase, “we found that a minimum threshold of 8 ligands per cluster maximized FcgR-driven engulfment.” It is difficult to picture how a minimum threshold maximizes something.

      We now state “we found that 8 or more ligands per cluster maximized FcgR-driven engulfment.”

      7. line 184: Rephrase, "we created... pegboards with very high-affinity DNA ligands that are predicted not to dissociate on a time scale of >7 hr". Remove "not".

      Thank you for pointing this out, it is now correct.

      Reviewer #1 (Significance):

      This study provides a significant advance in understanding about the molecular mechanisms of signaling for particle ingestion by phagocytosis.


      Reviewer #2 (Evidence, reproducibility and clarity):

      The manuscript on “Tight nanoscale clustering of Fcg-receptors using DNA origami promotes phagocytosis" studies how clustering and nanoscale spacing of ligand molecules for a chimeric Fcg-receptors influence the phagocytosis of functionalized silicon beads by macrophage cell lines. The basis of this study is the design of a chimeric Fc-receptor (DNA-CARg) comprising an extracellular SNAP-tag domain that can be loaded with single-stranded (ss) DNA, the transmembrane part of CD86 and the cytosolic part of the Fc-receptor g-chain containing an immunoreceptor tyrosine-based activation motif (ITAM) as well as a C-terminal green fluorescent protein (GFP). As control the authors used a similar designed DNA-CAR that is lacking the intracellular ITAM-containing FCg tail. The chosen target for this chimeric DNA-CAR, are silicon beads covered by a lipid bilayer that contains biotin-labelled lipids that, via Neutravidin, can be loaded with a biotinylated DNA origami pegboard displaying complimentary ss-DNA as ligand for the DNA-CAR. The DNA origami pegboard contains four ATTO647N fluorescence for visualization and the ssDNA ligand in different quantities and spacing.

      Using these principles, the authors study how ligand affinity, concentration and spacing influence the activation of the DNA-CARg and the engulfment of the loaded beads.

      The authors show that bead engulfment is increased between 2 till 8 ssDNA ligands on the pegboard. After this, ligand numbers do not play a role anymore in the engulfment. They then study the role of the ligand spacing using pegboards that either contain 4 single strand DNA ligands in close (7nm/3,5nm) proximity or a more spaced version using 21/17,5 nm or 35/38,5 nm. The authors find that the bead engulfment is maximally and positively affected by the close spacing of the ssDNA ligands. In their final experiments the authors vary the design of the DNA-CARs by tetramerization of the ITAM-containing Fcg-signaling subunit. In their discussion the authors mention different possibilities for the effect of spacing on the engulfment process.

      I think that, in general, this is an interesting study. However, it has some caveats and open issues that should be clarified before its publication.

      Major comments

      1. As a general comment, it is somewhat a pity that the authors did not use the endogenous FcR as a control. It would have been quite easy for the authors to place the SNAP-tag domain on the Fcg extracellular domain which would allow to do all their experiments in parallel, not only with the DNA-CAR, but also with a DNA-containing wild type receptor. Such a control would be important because, by using a CD86 transmembrane domain, the authors do not know whether the nanoscale localization of their chimeric receptors is reflecting that of the endogenous Fcg receptor.**

      We agree with the reviewer completely. We have repeated experiments shown in Figure 4A with a DNA-CAR containing the Fc𝛾 transmembrane domain instead of CD86 as the reviewer suggests. We also included a DNA-CAR version of the Fc𝛾R1 alpha chain, although this construct was not expressed as well as the others. These data are now included in Figure S5, and referenced in lines 167-168.

      2. An important issue that is discussed by the authors but not addressed in this manuscript is whether the different amount and spacing of the ligand is only impacting on signaling or also on the mechanical stress of the cells. Indeed, mechanical stress on the cytoskeleton arrangement could influence the engulfment process. For this, it would be very important to test that the different bead engulfment, for example, those shown in Fig. 4, is strictly dependent on signaling kinases. The authors should repeat the experiment of Fig. 4 a and b in the presence or absence of kinase inhibitors such as the Syk inhibitor R406 or the Src inhibitor PP2 to show whether the different phase of engulfment is dependent on the signaling function of these kinases. This crucial experiment is clearly missing from their study.

      We agree this is an interesting point. We find that ligand spacing affects receptor phosphorylation; however this does not preclude effects on downstream aspects of the signaling pathway. We will clarify this by adding the following comment to the manuscript (line 299-301):

      While our data pinpoints a role for ligand spacing in regulating receptor phosphorylation, it is possible that later steps in the phagocytic signaling pathway are also directly affected by ligand spacing.

      The DNA-CAR-adhesion in Figure 1 strongly suggests that intracellular signaling is essential for phagocytosis. We have now included additional controls using this construct as detailed in our response to point 3 below. Unfortunately, Src and Syk inhibitors or knockout abrogate Fc𝛾R mediated phagocytosis (for example, PMIDs 11698501, 9632805, 12176909, 15136586) and thus would eliminate phagocytosis in both the 4T and 4S conditions. This precludes analysis of downstream steps in the phagocytic signaling pathway.

      3. Another problem of this study is that the authors show in Fig. 1A the control DNA-CAR-adhesion but then hardly use it in their study. For example, the crucial experiments shown in Fig. 4 should be conducted in parallel with DNA-CAR-adhesion expressing macrophage cells. This study could provide another indication whether or not ITAM signaling is important for the engulfment process.

      We have added this control. It is now included in Figure S5 and S7. Figure 3D also shows that the DNA-CAR-adhesion combined with the 4T origami pegboards does not activate phagocytosis and we have amended the text to make this more clear (line 152).

      4. Another important aspect is how the concentration of the loaded origami pegboard is influencing the engulfment process. In particular, it would be interesting to show the padlocks with different spacings such as the 4T closed spacing versus 4s large spacing show a different dependency on the concentration of this padlock loading on the beads. This would be another important experiment to add to their study.**

      We agree that this is an interesting question. We suspect that at a very high origami density, 4S signaling would improve, and potentially approach the 4T. However, we are currently coating the beads in saturating levels of origami pegboards. Thus we cannot increase origami pegboard density and address this directly.

      Minor comments:

      1. The definition of the ITAM is Immunoreceptor Tyrosine-based Activation Motif and not "Immune Tyrosine Activation Motif" as stated by the authors.

      We have corrected this.

      2. The authors discuss that it is the segregation of the inhibitory phosphatase CD45 from the clustered Fc receptors is the major mechanism explaining their finding that 4T closed spacing is more effective than 4s large spacing. With the event of the CRISPR/Cas9 technology it is trivial to delete the CD45 gene in the genome of the RAW264.7 macrophage cell line used in this study and I am puzzled why they author are not conducting such a simple but for their study very important experiment (it takes only 1-2 month to get the results).

      This experiment may be informative but we have two concerns about its feasibility. First, CD45 is a phosphatase with many different roles in macrophage biology, including activating Src family kinases by dephosphorylating inhibitory phosphorylation sites (PMID 8175795, 18249142, 12414720). Second, CD45 is not the only bulky phosphatase segregated from receptor nanoclusters. For example, CD148 is also excluded from the phagocytic synapse (PMID 21525931). CD45 and CD148 double knockout macrophages show hyperphosphorylation of the inhibitory tyrosine on Src family kinases, severe inhibition of phagocytosis, and an overall decrease in tyrosine phosphorylation (PMID 18249142). CD45 knockout alone showed mild phenotypes in macrophages. We anticipate that knocking out CD45 alone would have little effect, and knocking out both of these phosphatases would preclude analysis of phagocytosis. Because of our feasibility concerns and the lengthy timeline for this experiment, we believe this is outside of the scope of our study.

      In our discussion, we simplistically described our possible models in terms of CD45 exclusion, as the mechanisms of CD45 exclusion have been well characterized. This was an error and we have amended our discussion to read (lines 335-343):

      As an alternative model, a denser cluster of ligated receptors may enhance the steric exclusion of the bulky transmembrane proteins like the phosphatases CD45 and CD148 (Bakalar et al., 2018; Goodridge et al., 2012; Zhu, Brdicka, Katsumoto, Lin, & Weiss, 2008).

      Reviewer #2 (Significance):

      The innovative part of this study is the combination of SNAP-tag attached, chimeric Fc-receptor with the DNA origami pegboard technology to address important open question on receptor function.

      Referees cross-commenting

      I find most of my three reviewing colleagues reasonable I also agrée to Reviewer #1 comments 2

      Likewise, how much variation was there in the expression of the chimeric receptors?

      Large variation in receptor numbers per cell could significantly alter the quantitative studies. Aside from the flow sorting for cells expressing two different molecules, how were cells selected for analysis?

      But I want to add it is not only the amount of receptors but ils the nanoscale location that is key to receptor function

      We have ensured that all receptors are trafficked to the cell surface. We have also measured their intensity at the cell cortex as discussed in response to Reviewer 1.

      Reviewer #3 (Evidence, reproducibility and clarity):

      This is a very nicely done synthetic biology/biophysics study on the effect of ligands spacing on phagocytosis. They use a DNA based recognition system that the group has previously use to investigate T cell signaling, but express the SNAP tag linked transmembrane receptor in a macrophage cell line and present the ligands using DNA origami mats to control the number and spacing of complementary ligands that are designed to be in the typical range for low or high affinity FcR, a receptor that can trigger phagocytosis. The study offers some very nice quantitative data sets that will be of immediate interest to groups working in this area and, in the future, for design of synthetic receptors for immunotherapy applications. Other groups are working on similar platform for TCR. I don't feel there is any need for more experiments, but I have some questions and suggestions. Answering and considering these could clarify the new biological knowledge gained.

      We thank the reviewer for their support of our manuscript. Given the reviewer’s statement that no new experiments are required, we have answered their questions to the best of our ability given the current data. Should the editor decide that any of these topics require experimental data to enhance the significance of the paper, we are happy to discuss new experiments.

      Reviewer #3 (Significance):

      I think the significance would be increased by addressing these questions, that would help understand how the synthesis system described related to other system directed as similar questions and more natural settings.

      1.The densities of the freely mobile DNA ligands required to trigger phagocytosis is quite high. Was the length of the DNA duplexes optimized? The entire complex for both the intermediate and high affinity duplexes seems quite short, perhaps <10 nm. Might the stimulation be more efficient if a short stretch of DS DNA is added to increase the length to 12-13 nm?

      The extracellular domain of the DNA-CAR (SNAP tag and ssDNA strand) are approximately 10 nm (PMID 28340336). The biotinylated ligand ssDNA is attached to the bilayer via neutravidin, resulting in a predicted 14 nm intermembrane spacing. The endogenous IgG FcR complex is 11.5 nm. Bakalar et al (PMID 29958103) tested the effect of antigen height on phagocytosis and found that the shortest intermembrane distance tested (approximately 15 nm) was the most effective. As the reviewer notes, the optimal distance between macrophage and target may be larger than our DNA-CAR. However we think the intermembrane spacing in our system is within the biologically relevant range.

      We saw robust phagocytosis at 300 molecules/micron of ssDNA, which is similar to the IgG density used on supported lipid bilayer-coated beads in other phagocytosis studies (PMID 29958103, 32768386). As the reviewer noticed, this is significantly higher than ligand density necessary to activate T cells (PMID 28340336). We have added a comment on ligand density to lines 96-97.

      2. Are the origami mats generally laterally mobile on the bilayers. If so, what is the diffusion coefficient? Can one detect the mats accumulating in the initial interface between the bead and cell, particularly in cased where there is no phagocytosis? Would immobility of the mats make them more efficient at mediating phagocytosis compared to the monodispersed ligands, which I assume are highly mobile and might even be "slippery".

      We have confirmed that our bead protocol generally produces mobile bilayers, where his-tagged proteins can freely diffuse to the cell-bead interface (see accumulation of a his-tagged FRB binding to a transmembrane FKBP receptor at the cell-bead synapse below). We can qualitatively say that the origamis appear mobile on a planar lipid bilayer (see Dong et. al 2021 and images below). Directly measuring the diffusion coefficient on the beads is extremely difficult because the beads themselves are mobile (both diffusing and rotating), and cannot be imaged via TIRF. We do not see much accumulation of the origami at cell-bead synapses. This could reflect lower mobility of the origamis, or could be because the relative enrichment of origamis is difficult to detect over the signal from unligated origamis.

      Overall, we expect the origami pegboards (tethered by 12 neutravidins) are less mobile than single strand DNA (tethered by a single neutravidin, supported by qualitative images below). We are uncertain whether this promotes phagocytosis. At least one study suggests that increased IgG mobility promotes phagocytosis (PMID 25771017). However, the zipper model would suggest that tethered ligands may provide a better foothold for the macrophage as it zippers the phagosome closed (PMID 14732161). Hypothetically, ligand mobility could affect signaling in two ways - first by promoting nanocluster formation, and second by serving as a stable platform for signaling as the phagosome closes. Since our system has pre-formed nanoclusters, the effect of ligand mobility may be quite different than in the endogenous setting.

      [[image cannot be shown]]

      In the above images, a 10xHis-FRB labeled with AlexaFluor647 was conjugated to Ni-chelating lipids in the bead supported lipid bilayer. The macrophages express a synthetic receptor containing an extracellular FKBP and an intracellular GFP. Upon addition of rapamycin, FRB and FKBP form a high affinity dimer, and FRB accumulates at the bead-macrophage contact sites.

      [[image cannot be shown]]

      In the above images, single molecules were imaged for 3 sec. The tracks of each molecule are depicted by lines, colored to distinguish between individual molecules. The scale bar represents 5 microns in both panels.

      3. Breaking down the analysis into initiation and completion is interesting. When using the non-signalling adhesion constructs, would they get to the initiation stage or would that attachment be less extensive than the initiation phase.

      This is an interesting question. While we did not include the DNA-CAR-adhesion in our kinetic experiments, we have now quantified the frequency of cups that would match our ‘initiation’ criteria in 3 representative data sets where macrophages were fixed after 45 minutes of interaction with origami pegboard-coated beads. We found that an average of 16/125 of 4T beads touching DNA-CAR-adhesion macrophages met the ‘initiation’ criteria and an average of 2/125 were eaten (14% total). In comparison, we examined 4T beads touching DNA CAR𝛾 macrophages and found that on average 23/125 met the ‘initiation’ criteria, and 45/125 were already engulfed (54%). This suggests that the DNA-CAR-adhesion alone may induce enough interaction to meet our initiation criteria, but without active signaling from the FcR this extensive interaction is rare. We have added this data in a new Figure S6 and commented on this in lines 213-215.

      4. It would be interesting to put these results in perspective of earier work on spacing with planar nanoarrays, although these can't be applied to beads. For integrin mediated adhesion there was a very distinct threshold for RGD ligand spacing that could be related to the size of some integrin-cytoskeletal linkers (PMID: 15067875). On the other hand, T cell activation seemed more continuous with changes in spacing over a wide range with no discrete threshold (PMID: 24117051, 24125583) unless the spacing was increased to allow access to CD45, in which case a more discrete threshold was generated (PMID: 29713075). The results here for phagocytosis with the very small ligands that would likely exclude CD45 seems to be more of a continuum without a discrete threshold, although high densities of ligand are needed. This issue of continuous sensing vs sharp threshold is biologically interesting so would be good assess this by as consistent standards are possible across systems.**

      We agree that this is an interesting body of literature worth adding to our discussion. We have added a paragraph that puts our study in the context of prior work on related systems, including these nanolithography studies (Line 364-382):

      How does the spacing requirements for Fc__𝛾R nanoclusters compare to other signaling systems? Engineered multivalent Fc oligomers revealed that IgE ligand geometry alters Fcε receptor signaling in mast cells (Sil, Lee, Luo, Holowka, & Baird, 2007). DNA origami nanoparticles and planar nanolithography arrays have previously examined optimal inter-ligand distance for the T cell receptor, B cell receptor, NK cell receptor CD16, death receptor Fas, and integrins (Arnold et al., 2004; Berger et al., 2020; Cai et al., 2018; Deeg et al., 2013; Delcassian et al., 2013; Dong et al., 2021; Veneziano et al., 2020). Some systems, like integrin-mediated cell adhesion, appear to have very discrete threshold requirements for ligand spacing while others, like T cell activation, appear to continuously improve with reduced intermolecular spacing (Arnold et al., 2004; Cai et al., 2018). Our system may be more similar to the continuous improvement observed in T cell activation, as our most spaced ligands (36.5 nm) are capable of activating some phagocytosis, albeit not as potently as the 4T. Interestingly, as the intermembrane distance between T cell and target increases, the requirement for tight ligand spacing becomes more stringent (Cai et al., 2018). This suggests that IgG bound to tall antigens may be more dependent on tight nanocluster spacing than short antigens. Planar arrays have also been used to vary inter-cluster spacing, in addition to inter-ligand spacing (Cai et al., 2018; Freeman et al., 2016). Examining the optimal inter-cluster spacing during phagosome closure may be an interesting direction for future studies.


      Additional experiments performed in revision

      In addition to these reviewer comments, we have added additional controls validating the DNA-CAR-4x𝛾 used in Figure 6c,d. We compared the DNA-CAR-4x𝛾 to versions of the DNA-CAR-1x𝛾-3x𝛥ITAM construct with the functional ITAM in the second and fourth positions (see the schematics now included Figure S7). We found that four individual receptors with a single ITAM each were able to induce phagocytosis regardless of which position the ITAM was in. However the DNA-CAR-4x𝛾 construct, which also contains 4 ITAMs, was not. This further validates the experiment presented in 6c,d. We also fixed minor errors we discovered in the presentation of data for Figures 1C and S1A.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reviewer #3

      Evidence, reproducibility and clarity

      This is a very nicely done synthetic biology/biophysics study on the effect of ligands spacing on phagocytosis. They use a DNA based recognition system that the group has previously use to investigate T cell signaling, but express the SNAP tag linked transmembrane receptor in a macrophage cell line and present the ligands using DNA origami mats to control the number and spacing of complementary ligands that are designed to be in the typical range for low or high affinity FcR, a receptor that can trigger phagocytosis. The study offers some very nice quantitative data sets that will be of immediate interest to groups working in this area and, in the future, for design of synthetic receptors for immunotherapy applications. Other groups are working on similar platform for TCR. I don't feel there is any need for more experiments, but I have some questions and suggestions. Answering and considering these could clarify the new biological knowledge gained.

      Significance:

      I think the significance would be increased by addressing these questions, that would help understand how the synthesis system described related to other system directed as similar questions and more natural settings.

      1. The densities of the freely mobile DNA ligands required to trigger phagocytosis is quite high. Was the length of the DNA duplexes optimized? The entire complex for both the intermediate and high affinity duplexes seems quite short, perhaps <10 nm. Might the stimulation be more efficient if a short stretch of DS DNA is added to increase the length to 12-13 nm?
      2. Are the origami mats generally laterally mobile on the bilayers. If so, what is the diffusion coefficient? Can one detect the mats accumulating in the initial interface between the bead and cell, particularly in cased where there is no phagocytosis? Would immobility of the mats make them more efficient at mediating phagocytosis compared to the monodispersed ligands, which I assume are highly mobile and might even be "slippery".
      3. Breaking down the analysis into initiation and completion is interesting. When using the non-signalling adhesion constructs, would they get to the initiation stage or would that attachment be less extensive than the initiation phase.
      4. It would be interesting to put these results in perspective of earier work on spacing with planar nanoarrays, although these can't be applied to beads. For integrin mediated adhesion there was a very distinct threshold for RGD ligand spacing that could be related to the size of some integrin-cytoskeletal linkers (PMID: 15067875). On the other hand, T cell activation seemed more continuous with changes in spacing over a wide range with no discrete threshold (PMID: 24117051, 24125583) unless the spacing was increased to allow access to CD45, in which case a more discrete threshold was generated (PMID: 29713075). The results here for phagocytosis with the very small ligands that would likely exclude CD45 seems to be more of a continuum without a discrete threshold, although high densities of ligand are needed. This issue of continuous sensing vs sharp threshold is biologically interesting so would be good assess this by as consistent standards are possible across systems.
    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The manuscript on "Tight nanoscale clustering of Fcg-receptors using DNA origami promotes phagocytosis" studies how clustering and nanoscale spacing of ligand molecules for a chimeric Fcg-receptors influence the phagocytosis of functionalized silicon beads by macrophage cell lines. The basis of this study is the design of a chimeric Fc-receptor (DNA-CARg) comprising an extracellular SNAP-tag domain that can be loaded with single-stranded (ss) DNA, the transmembrane part of CD86 and the cytosolic part of the Fc-receptor g-chain containing an immunoreceptor tyrosine-based activation motif (ITAM) as well as a C-terminal green fluorescent protein (GFP). As control the authors used a similar designed DNA-CAR that is lacking the intracellular ITAM-containing FCg tail. The chosen target for this chimeric DNA-CAR, are silicon beads covered by a lipid bilayer that contains biotin-labelled lipids that, via Neutravidin, can be loaded with a biotinylated DNA origami pegboard displaying complimentary ss-DNA as ligand for the DNA-CAR. The DNA origami pegboard contains four ATTO647N fluorescence for visualization and the ssDNA ligand in different quantities and spacing. Using these principles, the authors study how ligand affinity, concentration and spacing influence the activation of the DNA-CARg and the engulfment of the loaded beads.

      The authors show that bead engulfment is increased between 2 till 8 ssDNA ligands on the pegboard. After this, ligand numbers do not play a role anymore in the engulfment. They then study the role of the ligand spacing using pegboards that either contain 4 single strand DNA ligands in close (7nm/3,5nm) proximity or a more spaced version using 21/17,5 nm or 35/38,5 nm. The authors find that the bead engulfment is maximally and positively affected by the close spacing of the ssDNA ligands. In their final experiments the authors vary the design of the DNA-CARs by tetramerization of the ITAM-containing Fcg-signaling subunit. In their discussion the authors mention different possibilities for the effect of spacing on the engulfment process.

      I think that, in general, this is an interesting study. However, it has some caveats and open issues that should be clarified before its publication.

      Major comments

      1. As a general comment, it is somewhat a pity that the authors did not use the endogenous FcR as a control. It would have been quite easy for the authors to place the SNAP-tag domain on the Fcg extracellular domain which would allow to do all their experiments in parallel, not only with the DNA-CAR, but also with a DNA-containing wild type receptor. Such a control would be important because, by using a CD86 transmembrane domain, the authors do not know whether the nanoscale localization of their chimeric receptors is reflecting that of the endogenous Fcg receptor.
      2. An important issue that is discussed by the authors but not addressed in this manuscript is whether the different amount and spacing of the ligand is only impacting on signaling or also on the mechanical stress of the cells. Indeed, mechanical stress on the cytoskeleton arrangement could influence the engulfment process. For this, it would be very important to test that the different bead engulfment, for example, those shown in Fig. 4, is strictly dependent on signaling kinases. The authors should repeat the experiment of Fig. 4 a and b in the presence or absence of kinase inhibitors such as the Syk inhibitor R406 or the Src inhibitor PP2 to show whether the different phase of engulfment is dependent on the signaling function of these kinases. This crucial experiment is clearly missing from their study.
      3. Another problem of this study is that the authors show in Fig. 1A the control DNA-CAR-adhesion but then hardly use it in their study. For example, the crucial experiments shown in Fig. 4 should be conducted in parallel with DNA-CAR-adhesion expressing macrophage cells. This study could provide another indication whether or not ITAM signaling is important for the engulfment process.
      4. Another important aspect is how the concentration of the loaded origami pegboard is influencing the engulfment process. In particular, it would be interesting to show the padlocks with different spacings such as the 4T closed spacing versus 4s large spacing show a different dependency on the concentration of this padlock loading on the beads. This would be another important experiment to add to their study.

      Minor comments:

      1. The definition of the ITAM is Immunoreceptor Tyrosine-based Activation Motif and not "Immune Tyrosine Activation Motif" as stated by the authors.
      2. The authors discuss that it is the segregation of the inhibitory phosphatase CD45 from the clustered Fc receptors is the major mechanism explaining their finding that 4T closed spacing is more effective than 4s large spacing. With the event of the CRISPR/Cas9 technology it is trivial to delete the CD45 gene in the genome of the RAW264.7 macrophage cell line used in this study and I am puzzled why they author are not conducting such a simple but for their study very important experiment (it takes only 1-2 month to get the results).

      Referees cross-commenting

      I find most of my three reviewing colleagues reasonable

      I also agree to Reviewer #1 comments 2

      Likewise, how much variation was there in the expression of the chimeric receptors? Large variation in receptor numbers per cell could significantly alter the quantitative studies. Aside from the flow sorting for cells expressing two different molecules, how were cells selected for analysis?

      But I want to add it is not only the amount of receptors but ils the nanoscale location that is key to receptor function.

      Significance:

      The innovative part of this study is the combination of SNAP-tag attached, chimeric Fc-receptor with the DNA origami pegboard technology to address important open question on receptor function.

    1. SciScore for 10.1101/2021.03.23.21253460: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics approval and consent to participate: The plasma sample use was reviewed by the WRAIR Human Subjects’ Protection Branch which determined that the research does not involve human subjects (NHSR protocol WRAIR #2567, WRAIR#2755, #EID-029) as the samples used were de-identified and no link between samples and subjects exists.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">As this was a retrospective analysis of COVID-19 samples collected during a public health investigation of a local outbreak, no a priori power calculation was carried out.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The detection antibody, SULFO-TAG either with anti-human IgG (Cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">No D20JL, MSD) antibody or anti-human IgM (Cat.No D20JP, MSD) was diluted to 2 µg/ml in Diluent 100 (MSD) and added to the wells (50 µl/well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was carried out in R using the stats, ggplot2, and corrplot,.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This limitation is highlighted in the apparent 50% IgM seropositivity for MERS-CoV in the Control Group. While there was a MERS outbreak in South Korea in 2015, there were only 186 confirmed cases in that outbreak [21] and a more likely explanation is that this reflects a cross-reactivity from immunity to a related beta coronavirus. On a similar note, we were surprised to find 25% IgG seropositivity for SARS-CoV-2 in the Control group. Given that they were all seronegative to SARS-CoV-2 by IgM, this suggests the possibility of either a prior asymptomatic SARS-CoV-2 infection or cross-reactivity from immunity to another coronavirus. Assessing the serological landscape of CoV-specific IgM and IgG responses resulted in several key observations: 1) IgG seropositivity to seasonal OC43 and HKU1 as well as influenza H3 was high, while IgM seropositivity to these antigens was low; 2) IgM seropositivity to SARS-CoV-2 was highly specific, with 90% seropositivity in COVID-19 samples and 0% seropositivity in Control or Pre-COVID samples; 3) SARS-CoV-2 IgG responses were highly cross-reactive with almost 60% of SARS-CoV-2 IgG seropositive samples being seropositive for all five CoV spike antigens; and 4) IgM and IgG SARS-CoV-2 spike responses appear to show different fine specificities, with IgM spike responses being largely recapitulated by the SARS-CoV-2 RBD antigen, while IgG spike responses were not. Taken together these observations suggest a few explanations. First, that the IgM res...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.23.21254165: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Research Design: Ethical approval for the study was granted by the MBRU, Institutional Review Board (Reference # MBRU-IRB-2020-032).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A Strengths, Weaknesses, Opportunities, and Threats (SWOT) analysis of the impact on education of the pandemic highlights, among many of the factors discussed in the preceding paragraphs, the opportunity for educational leadership in times of crisis and the challenge of executing it with budgetary constraints (36). The COVID-19 experience is also a living example to demonstrate to students the health inequities and difficult ethical decisions in a contemporary life or death scenarios; it constituted an invaluable experience that reinforces knowledge of health systems and standards of practice (7). Resilience, grit, and tolerance have transformed from mere teaching points to demonstrable practice (7). The tag: front-liner, has become a proud identity, inspirational for the budding physician. This study is characterized by several limitations that are worth shedding light on. Although the focus on a single program enabled the development of thorough reflections and insights, the generalizability of the generated findings is limited to institutions that are characteristically and contextually like MBRU. It would be worthwhile for future studies to collect data from several programs and run a comparative analysis. The small sample size and low response rate were also limitations. The data collection extended until after the end of course assessments, and hence, the perception of the participating students might have been influenced by their performance in the respective exams and...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.24.435771: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: ACE2 antibody abcam, ab27269 1:400 TMPRSS2 antibody Santa Cruz sc-515727 1:400 Anti-NP, sino-biological 40143-MM05 1:400 Anti-NP, sino-biological 40143-R001 1:400 Anti-NP, thermofisher MA1-7401 1:400 K8/K18, progen, 90001 1:400 Donkey-anti-rabbit750, abcam ab175731</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies: ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-NP</div><div>suggested: (Bio-Rad Cat# MCA400, RRID:AB_2151884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With rigorous washing steps in between the proteins were detected with mouse anti-strep-tag-antibodies (IBA) and goat anti-mouse IgG antibodies (Life Biosciences). IDISCO: SARS-CoV-2 infected and non-infected Syrian hamster lungs were provided in 10% formalin, for longer storage hamster lungs were kept in PBS and 0.01% sodium azide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Obtained image stacks were analyzed with ImageJ v1.54f and Imaris 9.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the 3D renders obtained imaging data was imported into Imaris, display adjustments were made for each channel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Imaris</div><div>suggested: (Imaris, RRID:SCR_007370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The generated surfaces were subsequently used to mask the TMPRSS2 and ACE2 channels, after which statistical values were obtained and exported to GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 6. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.23.436684: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: Blood and peripheral blood mononuclear cells (PBMCs) were isolated from COVID19+ patients using protocols approved by Institutional Review Boards at Fred Hutch Cancer Research Center, University of Washington and Seattle Children’s Research Institute.<br>Consent: Informed consent was obtained from all participants and the University of Washington and/or Fred Hutchinson Cancer Research Center and CHUM Institutional Review Boards approved the entire study and procedures.<br>IACUC: All experiments adhered to the guidelines approved by the Emory University Institutional Animal Care and Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Peripheral blood mononuclear cells (PBMCs) and serum from pre-pandemic controls were blindly selected at random from the study “Establishing Immunologic Assays for Determining HIV-1 Prevention and Control”, with no considerations made for age, or sex, participants were recruited at the Seattle Vaccine Trials Unit (Seattle, Washington, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell Lines: All cell lines were incubated at 37°C in the presence of 5% CO2. 293-6E (human female, RRID:CVCL_HF20) and 293T cells (human female, RRID:CVCL_0063) cells were maintained in Freestyle 293 media with gentle shaking.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We recently reported an initial characterization of the anti-S antibody responses generated by CV1 (Seydoux et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Some samples appear to show enhanced binding in the presence of ACE2, perhaps because ACE2 binding stabilizes and exposes their binding sites, these antibodies are considered not competitive with ACE2. mAb competition BLI: To measure competition between individual mAbs for binding to SARS-CoV-2 S-2P and RBD, S-2P and RBD were biotinylated using EZ-Link NHS-PEG4 Biotin at a molar ratio of 1:2/ Biotinylated protein was purified using a Zeba spin desalting column.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-2P</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-OC43, HCoV-HKU1, HCoV-NL63 and HCoV-229E S1+S2 ECTs (Cat#’s 40607-V08B, 40606-V08B, 40604-V08B, 40605-V08D), SARS-HCoV-2 S1 domain (CAT#: 40591-V08B1), SARS-CoV-2 S1 N-terminal domain (CAT#40591-V41H) SARS-HCoV-2 S2 extra-cellular domain (CAT#: 40590-V08B) and SARS-CoV2 RBD (CAT#: 40150-V05H) were purchased from SinoBiologicals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines: All cell lines were incubated at 37°C in the presence of 5% CO2. 293-6E (human female, RRID:CVCL_HF20) and 293T cells (human female, RRID:CVCL_0063) cells were maintained in Freestyle 293 media with gentle shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>the</div><div>detected: ( RRID:CVCL_HF20)</div></div><div style="margin-bottom:8px"><div>293T</div><div>detected: (CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plasmids expressing the HIV-1 Gag and pol (pHDM-Hgpm2), HIV-1Rev (pRC-CMV-rev1b), HIV-1 Tat (pHDM-tat1b), the SARS CoV2 spike (pHDM-SARS-CoV-2 Spike) and a luciferase/GFP reporter (pHAGE-CMV-Luc2-IRES-ZsGreen-W) were co-transfected into 293T cells at a 1:1:1:1.6:4.6 ratio using 293 Free transfection reagent (EMD Millipore Cat #72181) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The culture supernatant was harvested after 72 hours at 32°C, clarified by centrifugation, filtered and frozen at −80C. 293 cells stably expressing ACE2 (HEK293T-hACE2) were seeded at a density of 4000 cells/well in a 100 µl volume in flat clear bottom, black walled, tissue culture 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The media was aspirated from 293T-ACE2 cells and 100 µl of the virus-antibody mixture was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monitoring RBD-binding to 293-ACE2 cells by flow cytometry: 8 pmol of biotinylated S-2P with strep tag peptide sequence on C terminus were mixed with 10 pmol of mAb and incubated for 10 min at RT in a round-bottom tissue culture 96-well plate. 200,000 HEK293T-hACE2 cells in 50 µL of cDMEM were then added to each well and the mixture of cells + RBD or S-2P + mAb was incubated for 20 min on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of k18-hACE2 mice with SARS-CoV-2: B6.Cg-Tg(K18-ACE2)2Prlmn/J mice were purchased from Jackson Laboratories.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IMGT/V-QUEST was used to assign V, D, J gene identity, and CDRL3 length to the sequences (Brochet et al., 2008).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The V(D)J enriched library was sequenced on an Illumina HiSeq or MiSeq.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Remaining model building was completed using COOT (Emsley and Cowtan, 2004) and refinement was performed in Phenix (Adams et al., 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural figures were made in Pymol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles were picked with DogPicker (Voss et al., 2009) and processed in RELION 3.0 (Scheres, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis: Sequences were analyzed using Geneious software (Version 8.1.9)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All graphs were completed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.22.436481: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 Pseudovirus Neutralization Assay: PSV was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24, 25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays 104 293T-hACE2 cells were plated in 100uL media per well in 96 well white-wall white-bottom plates (Perkin Elmer) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">([Agonist] vs. response---variable slope-four parameters), and the Area Under Curve (AUC) were calculated using GraphPad Prism 9.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.22.436337: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 infection and treatment conditions: For all in vivo experiments, the 6 to 8 weeks male and female mice were intranasally challenged with 1 x 105 FFU in 25-30 µl volume under anesthesia (0.5 - 5 % isoflurane delivered using precision Dräger vaporizer with oxygen flow rate of 1 L/min).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody depletion of immune cell subsets: For evaluating the effect of NK cell depletion during CV3-1 prophylaxis, anti-NK1.1 (clone PK136; 12.5 mg/kg body weight) or an isotype control mAb (BioXCell; clone C1.18.4; 12.5 mg/kg body weight) was administered to mice by i.p. injections every 2 days starting at 48 h before SARS-CoV-2-nLuc challenge till 8 dpi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NK1.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">containing Fc blocking antibody against CD16/CD32 (BioLegend Inc) before staining with antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were incubated 1 hr with 10% calf serum in PBS to block nonspecific antibody binding, then incubated 2 hrs with anti-S antiserum (Cohen et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were rinsed (4x 10’) with PBS then labeled for 2 hrs with 10 nm gold conjugated goat anti-mouse secondary antibody (Ted Pella, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48 hours post transfection, 293T cells were stained with CV3-1 and CV3-25 antibodies (5μg/mL), using cross-reactive anti-SARS-CoV-1 Spike CR3022 or mouse anti-His tag (Sigma-Aldrich) as positive controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV3-25</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor-647-conjugated goat anti-human IgG (H+L) Abs (Invitrogen) and goat anti-mouse IgG (H+L) Abs (Invitrogen) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-mouse SARS-CoV-2 nucleocapsid protein (Clone 1C7, Bioss Antibodies)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following extensive washing with PBS, an anti-mouse IgG HRP secondary antibody solution was formulated in PBS + 1% non-fat milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody dependent cellular cytotoxicity (ADCC) assay: For evaluation of anti-SARS-CoV-2 ADCC activity, parental CEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ADCC activity</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Second, serially diluted clarified tissue homogenates were used to infect Vero-E6 cell culture monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Uninfected monolayer of Vero cells treated identically served as controls to determine basal luciferase activity to obtain normalized relative light units.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were maintained in complete Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher, Cat. #11965–092) containing 10% fetal bovine serum (Gibco, Thermo-Fisher, Cat. #16140–071), 1% HEPES Buffer Solution (15630–130), and 1 % penicillin– streptomycin (Thermo Fisher, Cat. #15140–122).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudoviral particles were produced by transfecting 2×106 HEK293T cells with pNL4.3 Luc R-E- (3.5 μg), plasmids encoding for SARS-CoV-2 Spike or SARS-CoV-1 Spike (3.5 μg) protein and VSV-G (pSVCMV-IN-VSV-G, 1 μg) using the standard calcium phosphate method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected by the calcium phosphate method with the pNL4.3 R-E-Luc plasmid (NIH AIDS Reagent Program) and a plasmid encoding for SARS-CoV-2 Spike at a ratio of 5:4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were used as effector cells and were stained with another cellular dye (cell proliferation dye eFluor670).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YARC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image sequences were assembled and converted to videos using Image J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Nikon Elements AR version 4.5 software (Nikon Instruments Inc, Americas) and figures assembled with Photoshop CC and Illustrator CC (Adobe Systems, San Jose, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were processed and plotted using GraphPad Prism 8 v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo software (Treestar) was used to generate FACS plot shown in Figure S7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic tilt-series and large-area montaged overviews were acquired automatically using the SerialEM software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic data was calculated, analyzed, and modeled using the IMOD software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017) on iMac Pro and MacPro computers (Apple, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMOD</div><div>suggested: (IMOD, RRID:SCR_003297)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-MEN particles were then re-suspended in 50 mM pH 7.5 HEPES buffer, labeled with Cy3B(3S) and Cy5 derivative (LD650-CoA) and purified through an optiprep gradient as previously described (Lu et al., 2019; Lu et al., 2020; Munro et al., 2014) smFRET images of S-MEN particles was acquired on a home-built prism-based total internal reflection fluorescence (TIRF) microscope, as described previously (Lu et al., 2020). smFRET data analysis was performed using MATLAB (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(MathWorks)-based customized SPARTAN software package (Juette et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPARTAN</div><div>suggested: (SPARTAN, RRID:SCR_014901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P values were indicated as ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; ∗∗∗∗, p < 0.0001. Schematics: Schematics for showing experimental design in figures were created with BioRender.com.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 65, 66, 67, 68, 62 and 63. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.16.434488: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Residues 1-617 of human ACE2 ectodomain (UniProtKB Q9BYF1C) and SARS-CoV-2 spike residues 319-530 (GenBank QHD43416.1) with the G485R mutation, were each synthesised with a N-terminal honeybee melittin signal peptide and a C-terminal TEV protease cleavage site and His6-tag by GenScript (Hong Kong) and subcloned into the pFastBac1 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were integrated using XDS and scaled with AIMLESS from the CCP4 program suite (Winn et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular replacement was performed using Phaser from the Phenix program suite with the SARS-CoV-2 Spike RBD-ACE2 structure (PDB ID: 6LZG) used as a search model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternate rounds of model building and refinement were performed using Coot (Emsley et al., 2010), REFMAC5 (Murshudov et al., 2011) and phenix.refine (Afonine et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.31.229781: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All procedures in this study involving animals were reviewed and approved by the Minnan Normal University Animal Ethics and Welfare Committee (MNNU-AEWC-2020001).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse experiments: Specific pathogen-free, 8-week-old male transgenic hACE2 mice and WT male mice (C57BL/6 background) were purchased from the experimental animal center of GemPharmatech (Nanjing, China).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and reagents: Anti-His-Tag, anti-p-IKK, anti-p-JNK, and anti-p-c-Jun antibodies, FITC-conjugated donkey anti-mouse IgG, and Cy3-conjugated donkey anti-rabbit IgG were purchased from Affinity Biosciences, Inc. (Cincinnati, OH, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His-Tag,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-His-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-p-IKK, anti-p-JNK,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-p-c-Jun</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-822, RRID:AB_627262)</div></div><div style="margin-bottom:8px"><div>Cy3-conjugated donkey anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-ACE2 antibody, HRP-conjugated anti-mouse IgG, and HRP-conjugated anti-rabbit IgG were obtained from Abcam (Cambridge, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies His-Tag (1:200, Affinity, T0009, USA) and ACE2 (1:200, Abcam, ab15348, UK) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Abcam Cat# ab15348, RRID:AB_301861)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then blocked in 5% non-fat milk for 1 h at room temperature and incubated with primary antibodies (including anti-ACE2, anti-p-IKK, anti-p-JNK, anti-p-c-Jun, and anti-β-actin antibodies) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-p-IKK, anti-p-JNK, anti-p-c-Jun,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then washed with Tris buffered saline buffer with Tween 20 (TBST) for three times and incubated with secondary antibody (HRP-conjugated anti-IgG) for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">8 μM TAPI-1 was added to Vero E6 cells 30 min in advance of any additional treatment conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse experiments: Specific pathogen-free, 8-week-old male transgenic hACE2 mice and WT male mice (C57BL/6 background) were purchased from the experimental animal center of GemPharmatech (Nanjing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and reagents: Anti-His-Tag, anti-p-IKK, anti-p-JNK, and anti-p-c-Jun antibodies, FITC-conjugated donkey anti-mouse IgG, and Cy3-conjugated donkey anti-rabbit IgG were purchased from Affinity Biosciences, Inc. (Cincinnati, OH, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Affinity Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse experiments: Specific pathogen-free, 8-week-old male transgenic hACE2 mice and WT male mice (C57BL/6 background) were purchased from the experimental animal center of GemPharmatech (Nanjing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GemPharmatech</div><div>suggested: (GemPharmatech, RRID:SCR_017239)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein signals were evaluated by integrated option density (IOD) using Image J software (National Institutes of Health, Bethesda, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All data were analyzed with GraphPad Prism 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.08.331645: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Inclusion criteria were as follows; 1) Age above 18 years; 2) PCR verified SARS-CoV-2 within the preceding 12 weeks; 3) Full recovery from acute COVID-19 illness; 4) Able to give informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After sample incubation, bound IgG was detected by incubation with MSD SULFO-TAG Anti-Human IgG Antibody and subsequently measured on a MESO QuickPlex SQ 120 Reader (Cat. No. AI0AA-0) after addition of GOLD Read Buffer B (Cat. No. R60AM-2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: IgA antibodies were measured using the Anti-SARS-CoV-2 IgA ELISA from Euroimmun (Euroimmun Medizinische Labordiagnostika AG, Lübeck, Germany, Cat. No. El 2606-9601 A), according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgA type antibodies were detected by incubation with peroxidase labelled anti-human IgA followed by a chromogen solution, resulting in color development in positive wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were cultured in DMEM, containing 10% FBS and 50 U/mL P/S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 hour of incubation at 37°C BHK-G43 cells were washed three times in PBS and fresh media was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-G43</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data and Statistical analyses: Flow cytometry data was analyzed using FlowJo (Version 10.7.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data was processed and graphed in GraphPad Prism version 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.18.099507: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The ACS have been conducted in accordance with the ethical principles set out in the declaration of Helsinki and all participants provided written informed consent.<br>IRB: The study was approved by the Academic Medical Center institutional Medical Ethics Committee of the University of Amsterdam.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">n=24 Live Attenuated vaccine) and HBV antibodies (n=17 natural infection, n=16 HBsAg vaccination)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HBV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of CMV-specific antibodies from sera: CMV-specific antibodies were purified using antigen-coated plates (Serion ELISA classic, Cytomegalovirus IgG, Würzburg, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Serion ELISA classic , Cytomegalovirus IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of Measle- and Mump-virus specific antibodies from sera: Ag-specific antibodies were purified using antigen-coated plates (Serion ELISA classic, Measles IgG and Mumps IgG, Würzburg, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Serion ELISA classic , Measles IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Mumps IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As positive control, anti-HIV gp120 monoclonal was used (IgG1 b12; 100 µg purified antibody in PBS at 1 mg/ml; NIH Aids Reagent Program, La Jolla, CA, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of anti-N and anti-S specific antibodies from plasma: SARS-Cov-2-specific antibodies were purified using antigen-coated plates (NUCN, Roskilde, Denmark).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of total IgG from sera: Total IgG1 antibodies were captured from 2 µL of serum using Protein G Sepharose 4 Fast Flow beads (GE Healthcare, Uppsala, Sweden) in a 96-well filter plate (Millipore Multiscreen, Amsterdam, The Netherlands) as described previously (11) or by using Protein G cartridges on the AssayMAP Bravo (Agilent Technologies, Santa Clara, USA) Briefly, 1 µL serum diluted in PBS were applied to the cartridges, followed by washes of PBS, LC-MS pure water and finally eluted with formic acid (1%)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sera: Total IgG1 antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Total IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Briefly , 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometric IgG-Fc glycosylation analysis: Eluates containing either antigen-specific antibodies or total IgG were collected in V-bottom plates, dried by vacuum centrifugation for 2.5 hours at 50°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>total IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were coated (over-night, 4°C) with recombinant trimerized spike protein produced as described recently (28) or N protein (accession number MN908947, produced in HEK cells with HAVT20 leader peptide, 10xhis tag and a Brit tag as in (23)) in PBS(5 µg/mL and 1 µg/mL, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As positive control, anti-HIV gp120 monoclonal was used (IgG1 b12; 100 µg purified antibody in PBS at 1 mg/ml; NIH Aids Reagent Program, La Jolla, CA, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Aids Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometry results were extracted and evaluated using FlexAnalysis software (Bruker Daltonics) for all samples except for the Measles virus, and Mumps virus cohorts that were analyzed with Skyline software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Skyline</div><div>suggested: (Skyline, RRID:SCR_014080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad Prism version 7.02 for Windows (GraphPad Software Inc.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.17.20104869: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: The study protocols were approved by the University of Melbourne Human Research Ethics Committee (#2056689) and all associated procedures were carried out in accordance with the approved guidelines.<br>Consent: All participants provided written informed consent in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies for surface staining included: CD19-ECD (J3-119) (Beckman Coulter), CD20 Alexa700 (2H7), IgM-BUV395 (G20-127), CD21-BUV737 (B-ly4), IgD-Cy7PE (IA6-2), IgG-BV786 (G18-145) (BD), CD14-BV510 (M5E2), CD3-BV510 (OKT3), CD8a-BV510 (RPA-T8), CD16-BV510 (3G8), CD10-BV510 (HI10a), CD27-BV605 (O323) (Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD21-BUV737</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD14-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OKT3</div><div>suggested: (BD Biosciences Cat# 566779, RRID:AB_2869862)</div></div><div style="margin-bottom:8px"><div>CD8a-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD10-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27-BV605</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following stimulation, cells were washed, stained with Live/dead Blue viability dye (ThermoFisher), and a cocktail of monoclonal antibodies: CD27 BUV737 (L128), CCR7 Alexa700 (150503), CD45RA PeCy7 (HI100), CD20 BUV805 (2H7), CD14 BUV395 (MOP9) (BD Biosciences), CD3 BV510 (SK7), CD4 BV605 (RPA-T4), CD8 BV650 (RPA-T8)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (BD Biosciences Cat# 742012, RRID:AB_2871310)</div></div><div style="margin-bottom:8px"><div>CCR7</div><div>suggested: (BD Biosciences Cat# 741981, RRID:AB_2871284)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: (BD Biosciences Cat# 742052, RRID:AB_2871341)</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BD Biosciences Cat# 563781, RRID:AB_2744325)</div></div><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BD Biosciences Cat# 740241, RRID:AB_2739988)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) or HCoV-HKU1 S protein (isolate N5;residues 1 – 1290) were synthesised with furin cleavage site removed and P986/987 stabilisation mutations39, a C-terminal T4 trimerisation domain, Avitag and His-tag, expressed in Expi293 cells and purified by Ni-NTA affinity and size-exclusion chromatography using a Superose 6 16/70 column (GE Healthcare) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Residual virus infectivity in the plasma/virus mixtures was assessed in quadruplicate wells of Vero cells incubated in serum-free media containing 1 μg/ml TPCK trypsin at 37°C/5% CO2; viral cytopathic effect was read on day 5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data are available via ProteomeXchange with identifier PXD019163.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProteomeXchange</div><div>suggested: (ProteomeXchange, RRID:SCR_004055)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pairwise correlations were assessed using Spearmans tests in Prism 8.0 (Graphpad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.17.20133793: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: This study has been conducted in accordance with the ethical principles set out in the declaration of Helsinki and all participants provided written informed consent, if applicable.<br>IRB: Approval was obtained from the Medical Ethics Committees from the Academic Medical Center, VU University Medical Center and Elisabeth-TweeSteden Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The average age of participants was 31 years (SD 4.2), 7 (50%) were female and none reported relevant comorbidities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Development of SARS-CoV-2 RBD and NP based bridging assays: The RBD-mFc and RBD-ST proteins were produced as described by Okba et al.[15] The NP was produced in HEK cells with HAVT20 leader peptide, 10xhis-tag and a BirA-tag as described by Dekkers et al.[24] MaxiSORP microtiter plates (ThermoFisherScientific, US) were coated with 100 µL per well 0.125 µg/mL RBD-mFc or NP in PBS overnight at 4 ° C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing and analysis: Statistical analysis were carried out using Graphpad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are some limitations to this study. Further investigation of cross-reactivity for the different coronaviruses may be necessary since the RBD of SARS-CoV-2 may show cross-reactivity with other human coronaviruses (HCoV), and in particular SARS-CoV-1. However, we anticipate that this will not alter our findings due to the limited number of cases with SARS-CoV-1 in Europe. [37] By including a large population of healthy controls the risk of having missed substantial cross-reactivity against other HCoV is also limited; especially since antibodies against HCoV are detected in the majority of the population (>90% for all four HCoV).[38,39] Furthermore, although this study provides an insight into the antibody response in the early phase of infection in non-hospitalized patients, the number of cases is still modest. Our study describes the early antibody kinetics in a population based on probable exposure and not based on symptoms or hospitalized patients who are RT-PCR positive. Yet, this provides an unbiased view of the performance of the developed serological assay and the antibody response in patients with mild SARS-CoV-2 infection. In summary, this study demonstrates the use of a sensitive bridging assay to study seroprevalence in non-hospitalized COVID-19 patients, and provides insight into the early kinetics of the antibody response to SARS-CoV-2 in this population.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.21.214932: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were GeneTex 632604 anti-Spike antibody (mouse monoclonal) and anti-calnexin (C5C9) rabbit mAb (CST #2679) were detected with 2nd anti-Mouse IgG Alexa 488 (Life tech Cat# A11029) and anti-rabbit IgG Dylight 633 (Thermo Fisher #35563) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-calnexin</div><div>suggested: (Thermo Fisher Scientific Cat# MA3027A488, RRID:AB_2633337)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Molecular Probes Cat# A-11029, RRID:AB_138404)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG Dylight 633</div><div>suggested: (Thermo Fisher Scientific Cat# 35563, RRID:AB_1965953)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A stable Spike expressing 293T cell line was generated by infection with pBOB-CAG-SARS-CoV2-Spike-HA lentiviral vector https://www.addgene.org/141347/ followed by single cell cloning and screening by cell extract immunoblotting of individual clones with HA tag antibody (CST #3724).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence was performed following the Cell Signaling Technology protocol (https://www.cellsignal.com/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.cellsignal.com/</div><div>suggested: (Cell Signaling Technology, RRID:SCR_004431)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.25.217158: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: After this step, the pellets were placed on ice and resuspended with propidium iodide, which is a viability marker of cells and the cytotoxic activity of antibodies was determined by flow cytometry, after gating on lymphocytes, based on their morphology.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, bound FcγR molecules were revealed with peroxidase conjugated anti-tag antibody (Miltenyi, 120-003-811; 1/5000 in 2% bovine serum albumin) and tetramethylbenzidine (TMB) reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound pig IgG were revealed with a secondary anti-pig-HRP-conjugated antibody (Bethyl Laboratories, USA) diluted in washing buffer, at 1:1000, incubated 1h at RT and washed 3 times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-pig-HRP-conjugated</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human Fc tag was then revealed with a specific HRP-conjugated anti-human IgG secondary antibody (diluted in in PBS-Tween-0.05%-1% skimmed milk powder at 1:1000, incubated 1h at RT and washed 3 times).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins from SARS-CoV-2 have been manufactured from Hek-293 cells and were purchased from Interchim, Monluçon, France.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hek-293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Swine serum dilutions were mixed with equal volumes of SARS-CoV-2 (BetaCoV/Hong Kong/VM20001061/2020 [KH1], corresponding to the D614 variant) or SARS-CoV (strain HK39849, SCoV) at a dose of 200 plaque-forming units determined by Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding to human FcγR: The binding of IgG from DKO swine to the FcγRI, FcγRIIa and FcγRIIb human receptors was tested using an ELISA assay and BIAcore surface plasmon resonance (SPR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIAcore</div><div>suggested: (Biacore T100 System, RRID:SCR_019679)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">His-Tagged FcγRI, FcγRIIa and FcγRIIb receptors (CD64/32a/32b, R&D Systems; 100μL, 2.4 μg/mL in 2% bovine serum albumin) were then added and incubated for 2h at room temperature (RT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R&D Systems</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed on GraphPad Software (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04431219</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">First in Human Study: LIS1, an Induction Treatment in Kidney…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04453384</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Safety and Efficacy of XAV-19 in Patie…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.24.205583: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals: All animal studies were conducted at Oregon Health and Sciences University and approved by the Institutional Animal Care and Use Committee (IACUC, IP00001707).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In vivo Fluc mRNA transfection via intravenous administration: Female BALB/c mice (8-12 weeks) were sedated using isoflurane, and LNPs encapsulating Fluc mRNA were intravenously administered via tail vein.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies used were: rabbit monoclonal anti-V5 tag at 1:1,000 (Cell Signaling Technology, 13202), rabbit monoclonal anti-6x-His tag at 1:1,000 (Thermo Fisher Scientific, MA5-33032), and mouse monoclonal anti-β-actin at 1:10,000 (R&D Systems, MAB8929).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x-His</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-33032, RRID:AB_2810125)</div></div><div style="margin-bottom:8px"><div>MA5-33032</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-33032, RRID:AB_2810125)</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies used were goat polyclonal anti-rabbit HRP (Jackson ImmunoResearch, 111-035-003) and anti-mouse HRP (115-035-003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 111-035-003, RRID:AB_2313567)</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 115-035-003, RRID:AB_10015289)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used for pull-down were mouse monoclonal anti-His tag (sc-8036) or anti-V5 tag (sc-81594) antibody (Santa Cruz Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>sc-81594</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-81594, RRID:AB_1131162)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The collected BALF was incubated with Dynabeads having anti-V5 tag antibody for 20 min at room temperature with rotation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To probe hACE2, anti-ACE2 antibody (Santa Cruz Biotechnology, sc-390851) and anti-mouse HRP were used as the primary and secondary antibodies at 1:200 and 1:2,000, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-390851, RRID:AB_2861379)</div></div><div style="margin-bottom:8px"><div>sc-390851</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-390851, RRID:AB_2861379)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T/17 cell line was purchased from ATCC (CRL-11268).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were cultured in MEM supplemented with 10% heat-inactivated FBS, 1% penicillin/streptomycin, non-essential amino acids, and sodium pyruvate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro Fluc mRNA transfection assay: For in vitro Fluc mRNA transfection assays, cells were seeded on a white 96 well plate at 4×103 cells/well for 293T and Hep G2 cells or at 104 cells/well for Calu-3, followed by overnight incubation for cell attachment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Hep G2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: For neutralization assay, 293T-hACE2 cells were seeded into white 96-well plates at 2×104 cells/well and grown for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo hsACE2 mRNA transfection via intravenous administration: Female BALB/c mice (8-12 weeks) were sedated using isoflurane, and LNPs encapsulating hsACE2 mRNA were administered to animals via tail vein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33 and 34. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.29.227249: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the antibodies anti-ACE2 (1:100), S-RBD-His-tag (1:50), anti-LAMP1 (1:50) and anti-LC3b (1:50) were added and slides were incubated overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-RBD-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-LAMP1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-LC3b</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following blocking, membranes were incubated overnight at 4°C with the primary antibodies anti-ACE2 (1:1000), anti-LAMP1 (1:2000), anti-LC3b (1:1000) and anti-His-tag (1:1000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (AnaSpec; EGT Group Cat# 29673-1000, RRID:AB_11232932)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">immunofluorescence microscopy: For immunefluorescence, HUVEC cells were cultured into 8-well Lab-TekTM II Chamber Slides (NuncTM) and were then treated with either 17β-diol at 3nM or S-equol at 10nM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUVEC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band intensity was quantified using ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed, and graphs were prepared with Prism 6.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The OPLSAA based DoGlycans software was used for building all models35 (S-T1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DoGlycans</div><div>suggested: (doGlycans, RRID:SCR_015758)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To address the structural interactions, we performed molecular dynamics simulations using GROMACS (v.2019.4)46 with the OPLS/AA force field parameters47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PatchDock algorithm discard all unacceptable complex and results are assorted by geometry shape complementarity score.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PatchDock</div><div>suggested: (PatchDock, RRID:SCR_017589)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular interactions were analyzed with LigPlot software58 and the pdb files required was constructed with fortran based own computer programs and the statistical data results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LigPlot</div><div>suggested: (LigPlot+, RRID:SCR_018249)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 24, 32, 22 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.29.227595: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Vaccination of CD-1 mice with the hAd5 S-Fusion + N-ETSD vaccine candidate: CD-1 female mice (Charles River Laboratories) 7 weeks of age were used for immunological studies performed at the vivarium facilities of Omeros Inc. (Seattle, WA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The constructs created included: Transfection of HEK 293T cells with hAd5 constructs: To determine surface expression of the RBD epitope by vaccine candidate constructs, we transfected HEK 293T cells with hAd5 construct DNA and quantified surface RBD by flow cytometric detection using anti-RBD antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were harvested 1, 2, 3, and 7 days post transfection by gently pipetting cells into medium and labeled with an anti-RBD monoclonal antibody (clone D003 Sino Biological Catalog # 40150-D003) and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG-Fc</div><div>suggested: (Thermo Fisher Scientific Cat# H10104, RRID:AB_2536546)</div></div><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: (Thermo Fisher Scientific Cat# H10104, RRID:AB_2536546)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To label N, cells were then incubated with an anti-flag monoclonal (Anti-Flag M2 produced in mouse, Sigma cat# F1804) antibody at 1:1000 in phosphate buffered saline with 3% BSA overnight at 4°C, followed by washes in PBS and a 1 hour incubation with a goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 555 (Life Technologies, Cat# A32727) at 1:500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A32727, RRID:AB_2633276)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For co-localization studies, cells were also incubated overnight at 4°C with a sheep anti-Lamp1 Alexa Fluor 488-conjugated (lysosomal marker) antibody (R&D systems, Cat# IC7985G) at 1:10 or a rabbit anti-CD71 (transferrin receptor, endosomal marker) antibody (ThermoFisher Cat# PA5-83022) at 1:200.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Lamp1</div><div>suggested: (Rockland Cat# 200-301-G09, RRID:AB_2611215)</div></div><div style="margin-bottom:8px"><div>anti-CD71 (transferrin receptor, endosomal marker)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After removal of the primary antibody, two washes in PBS and three 3 washes in PBS with 3% BSA, cells were incubated with fluor-conjugated secondary antibodies when applicable at 1:500 (Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, Life technologies, A-11034) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11034, RRID:AB_2576217)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S2 (SinoBiological Cat #40590-T62) was used as the primary antibody and IRDye® 800CW Goat anti-Rabbit IgG (H + L) (Li-Cor, 925-32211) as the secondary antibody using the Ibind Flex platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S2</div><div>suggested: (Imported from the IEDB Cat# S2, RRID:AB_2833224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with ACE2-Fc for 20 minutes and, after a washing step, were then labeled with a PE conjugated F(ab’)2-goat anti-human IgG Fc secondary antibody at a 1:100 dilution, incubated for 20 minutes, washed and acquired on flow cytometer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent-conjugated antibodies against mouse CD8β antibody (clone H35-17.2, ThermoFisher), CD4 (clone RM4-5, BD), IFN-γ (clone XMG1.2, BD), and TNF-α (clone MP6-XT22, BD) and staining was performed in the presence of unlabeled anti-CD16/CD32 antibody (clone 2.4G2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse CD8β</div><div>suggested: (Bio X Cell Cat# BE0223, RRID:AB_2687706)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 391503, RRID:AB_2721611)</div></div><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α</div><div>suggested: (Leinco Technologies Cat# T798, RRID:AB_2832121)</div></div><div style="margin-bottom:8px"><div>anti-CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells (2-4 × 105 cells per well of a 96-well plate) were added to the ELISpot plate containing an immobilized primary antibodies to either IFN-γ or IL-4 (BD), and were exposed to various stimuli (e.g. control peptides, target peptide pools/proteins) comprising 2 μg/mL peptide pools or 10 μg/mL protein for 36-40 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-4 (BD)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for detection of antibodies: For antibody detection in sera from inoculated mice, ELISAs specific for spike and nucleocapsid antibodies, as well as for IgG subtype (IgG1, IgG2a, IgG2b, and IgG3) antibodies were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG subtype (IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the wells were washed with PBST and 100 μL of a 1/5000 dilution of anti-mouse IgG HRP (GE Health Care; Cat # NA9310V), or anti-mouse IgG1 HRP (Sigma; Cat # SAB3701171), or anti-mouse IgG2a HRP (Sigma; Cat # SAB3701178), or anti-mouse IgG2b HRP (Sigma; catalog# SAB3701185), or anti-mouse IgG3 HRP conjugated antibody (Sigma; Cat # SAB3701192) was added to wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calculation of relative μg amounts of antibodies: A standard curve of IgG was generated and absorbance values were converted into mass equivalents for both anti-S and anti-N antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The constructs created included: Transfection of HEK 293T cells with hAd5 constructs: To determine surface expression of the RBD epitope by vaccine candidate constructs, we transfected HEK 293T cells with hAd5 construct DNA and quantified surface RBD by flow cytometric detection using anti-RBD antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunocytochemical labeling of hAd5 infected HeLa cells: To determine subcellular localization of N after infection or transfection of HeLa cells with hAd5 N-wild type (WT) or hAd5 N-ETSD (each with a flag tag to allow labeling), 48 hours after infection or transfection cells were fixed with 4% paraformaldehyde (PFA) and permeabilized with 0.4% Triton X100, in PBS) for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant ACE2-IgG1Fc protein was produced using Maxcyte transfection in CHO-S cells that were cultured for 14 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cell neutralization assay: All aspects of the assay utilizing virus were performed in a BSL3 containment facility according to the ISMMS Conventional Biocontainment Facility SOPs for SARS-CoV-2 cell culture studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination of CD-1 mice with the hAd5 S-Fusion + N-ETSD vaccine candidate: CD-1 female mice (Charles River Laboratories) 7 weeks of age were used for immunological studies performed at the vivarium facilities of Omeros Inc. (Seattle, WA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: RRID:MGI:2686808)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were harvested 1, 2, 3, and 7 days post transfection by gently pipetting cells into medium and labeled with an anti-RBD monoclonal antibody (clone D003 Sino Biological Catalog # 40150-D003) and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Catalog</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent-conjugated antibodies against mouse CD8β antibody (clone H35-17.2, ThermoFisher), CD4 (clone RM4-5, BD), IFN-γ (clone XMG1.2, BD), and TNF-α (clone MP6-XT22, BD) and staining was performed in the presence of unlabeled anti-CD16/CD32 antibody (clone 2.4G2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry was performed using a Beckman-Coulter Cytoflex S flow cytometer and analyzed using Flowjo Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 14. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.01.31.929042: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After an incubation period of 1 h at 37 °C, the inoculum was removed and cells were washed with PBS before medium supplemented with anti-VSV-G antibody (I1, mouse hybridoma supernatant from CRL-2700; ATCC) was added (no antibody was added to cells expressing VSV-G).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following primary antibodies were used: Mouse anti-HA tag (Sigma-Aldrich, H3663, 1:2,500), mouse anti-ß-actin (Sigma-Aldrich, A5441, 1:2,000), mouse anti-VSV matrix protein (Kerafast, EB0011, 1:2,500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Sigma-Aldrich Cat# H3663, RRID:AB_262051)</div></div><div style="margin-bottom:8px"><div>anti-ß-actin</div><div>suggested: (RayBiotech Cat# 168-10656, RRID:AB_2885189)</div></div><div style="margin-bottom:8px"><div>A5441</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>anti-VSV matrix protein (Kerafast, EB0011</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibody we used a peroxidase-coupled goat anti-mouse antibody (Dianova, 115-035-003, 1:10000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (MBL International Cat# D292-3, RRID:AB_10795278)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T (human, kidney), BHK-21 (Syrian hamster, kidney cells), Huh-7 (human, liver), LLC-PK1 (pig, kidney), MRC-5 (human, lung), MyDauLu/47.1 (Daubenton’s bat [Myotis daubentonii], lung), NIH/3T3 (Mouse, embryo), RhiLu/1.1 (Halcyon horseshoe bat [Rhinolophus alcyone], lung), Vero (African green monkey, kidney) cells were incubated in Dulbecco’s’ modified Eagle medium (PAN-Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (human, lung), Caco-2 (human, colon), MDBK (cattle, kidney) and MDCK II (Dog, kidney) cells were incubated in Minimum Essential Medium (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 (human, lung), BEAS-2B (human, bronchus) and NCI-H1299 (human, lung) cells were incubated in DMEM/F-12 Medium with Nutrient Mix (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BEAS-2B</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NCI-H1299</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of 2019-nCoV-S expression and particle incorporation by SDS-PAGE and immunoblot: Preparation of whole cell lysates: 293T cells were transfected with expression vectors for HA-tagged 2019-nCoV-S or SARS-S, or empty expression vector (negative control).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: Phylogenetic analysis (neighbor-joining trees) was performed using the MEGA7.0.26 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA7.0.26</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all statistical analyses, the GraphPad Prism 7 software package was used (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.01.22.914952: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">And the virus were detected using SL-CoV Rp3 NP antibody followed by Cy3-conjugated mouse anti-rabbit IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rp3 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-Human IgG-HRP conjugated monoclonal antibody (Kyab Biotech Co., Ltd, Wuhan, China) was used at a dilution of 1:40000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was detected using mouse anti-S tag monoclonal antibody followed by FITC-labelled goat anti-mouse IgG H&L (Abcam, ab96879).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: (Abcam Cat# ab96879, RRID:AB_10687475)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab96879, RRID:AB_10687475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral replication was detected using rabbit antibody against the Rp3 NP protein (made in house, 1:100) followed by cyanin 3-conjugated goat anti-rabbit IgG (1:50, Abcam, ab6939).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rp3 NP protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Abcam Cat# ab6939, RRID:AB_955021)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following cells were used for virus isolation in this study: Vero, Vero E6, and Huh7 that were cultured in DMEM +10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells transiently expressing ACE2 were prepared by a lipofectamine 3000 system (Thermo Fisher Scientific) in 96-well plate, with mock-transfected cells as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">nCoV-2019 grown from Vero E6 cells was used for infection at multiplicity of infection 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following cells were used for virus isolation in this study: Vero, Vero E6, and Huh7 that were cultured in DMEM +10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw NGS reads were firstly processed by Cutadapt (v1.18) with minimum read length of 30bp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cutadapt</div><div>suggested: (cutadapt, RRID:SCR_011841)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BWA (v0.7.12-r1039) was utilized to align reads to local database with a filter hits parameter at 0.8 FMM value and minimum alignment score at 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NGS reads were assembled into genomes using Geneious (v11.0.3) and MEGAHIT (v1.2.9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignment and editing were conducted using ClustalW and GeneDoc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum Likelihood phylogenetic trees based on nucleotide sequences of full-length ORF1b and S genes were constructed using the Jukes-Cantor model with bootstrap values determined by 1000 replicates in the MEGA6 software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA6</div><div>suggested: (MEGA Software, RRID:SCR_000667)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.26.222026: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">29 Antibodies and reagents: Rabbit anti-DYKDDDDK Tag (D6W5B), rabbit anti-IRF3 (D83B9), rabbit anti-pIRF3 (4D46), rabbit anti-TBK1 (3031S), rabbit anti-pTBK1 (D52C2), and rabbit anti-TRAF3 were from Cell Signaling Technology (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DYKDDDDK</div><div>suggested: (Cell Signaling Technology Cat# 14793, RRID:AB_2572291)</div></div><div style="margin-bottom:8px"><div>anti-IRF3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-pIRF3 ( 4D46)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TBK1</div><div>suggested: (Cell Signaling Technology Cat# 14590, RRID:AB_2798527)</div></div><div style="margin-bottom:8px"><div>anti-pTBK1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TRAF3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor 488 goat anti-rabbit IgG secondary antibody, Alexa Fluor 568 goat anti-mouse IgG secondary antibody, Alexa Fluor 488 goat anti-mouse IgG secondary antibody, and Alexa Fluor 568 goat anti-rabbit IgG secondary antibody were from Thermo Fisher Scientific (USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Alexa Fluor 488 goat anti-rabbit IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coimmunoprecipitation and immunoblotting: For coimmunoprecipitation assays, HEK293T cells were collected 24 hours after transfection and lysed in lysis buffer [1.0% (v/v) NP-40, 50 mM Tris-HCl, pH 7.4, 50 mM EDTA, 0.15 M NaCl] supplemented with a protease inhibitor cocktail (Sigma, USA) and a phosphatase inhibitor cocktail (Sigma, USA) as described in our previous publications.30,31 After centrifugation for 10 min at 14,000 g, the supernatants were collected and incubated with the indicated antibodies, followed by the addition of protein A/G beads (Santa Cruz, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NP-40</div><div>suggested: (Covance Cat# MMS-503P-100, RRID:AB_291448)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: HEK293, HEK293T, HeLa, and Vero-E6 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) with 10% heat-inactivated fetal bovine serum (FBS, Gibco, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">32,35 Briefly, approximately 0.5 x 105 HEK293T cells were seeded in 48-well plates and transfected 12 hours later with the luciferase reporter plasmid and the expression vector plasmids of RIG-I, RIG-IN, MDA-5, MAVS, TBK1, IKKε, IRF3-5D, TRIF, and STING, alone or together with the plasmid expressing the SARS-CoV-2 M protein, as indicated in the experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and infection: VSV-enhanced green fluorescent protein (eGFP) and SeV were used to infect HeLa, HEK293, or HEK293T cells as described in our previous publications.30–32 Briefly, before infection, prewarmed serum-free DMEM medium at 37°C was used to wash the target cells, after which the virus was diluted to the desired multiplicity of infection (MOI) in serum-free DMEM and incubated with the target cells for 1-2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Confocal immunofluorescence microscopy: Confocal immunofluorescence microscopy studies were performed as described in our previous publications.30,31 Briefly, HeLa cells were grown on 12-well slides one day before transfection with the indicated plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">32 Briefly, Vero cells were seeded on 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For statistical analysis, two-tailed unpaired Student’s t-tests were performed by GraphPad Prism 8.0 and Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.13.248872: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were previously tested for mycoplasma contamination and incubated in Dulbecco’s modified Eagle’s medium at 37 °C under a humidified atmosphere with 5% CO2.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reagents and antibodies: His-tagged SARS-2-S (S1+S2 ECD; YP_009724390.1;Val16-Pro1213; 40589-V08B1), SARS-2-S1 (YP_009724390.1;Val16-Arg685; 40591-V08H), and SARS-2-S2 (ECD; YP_009724390.1; Ser686-Pro1213; 40591-V08B) proteins were from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1+S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ECD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>YP_009724390.1;Val16-Pro1213</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>40589-V08B1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-2-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>YP_009724390.1;Val16-Arg685</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>40591-V08H</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-2-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An antibody against ACE2 for FACS (21115-1-AP; 1:100 dilution) was from Proteintech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>21115-1-AP</div><div>suggested: (Proteintech Cat# 21115-1-AP, RRID:AB_10732845)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A PE anti-His antibody (362603, clone J095G46; 1;100 dilution) and an antibody against SR-B1 for FACS (363208, clone m1B9; dilution 1:100) were from Biolegend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (BioLegend Cat# 362603, RRID:AB_2563634)</div></div><div style="margin-bottom:8px"><div>SR-B1 for FACS ( 363208</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S1 antibody (40150-R007) for confocal microscopy was from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, anti-rabbit or anti-mouse HRP-conjugated antibodies were applied after 3 washes and the antigen-antibody complexes were visualized using chemilumines cence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP-conjugated</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry for surface SR-B1 or ACE2 expression analysis: Cells were washed with PBS 2 times and incubated with APC-conjugated (APC anti-SR-B1) antibody (1:100) or anti-ACE2 antibody (1:100) followed by a secondary incubation with donkey-anti-rabbit antibody (1:200) conjugated to Alexa Flour 488.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubating at RT for 30 min, the cells were washed two times with PBS containing 2% FBS and then incubated for 30 min at RT with a PE-conjugated antibody (PE anti-His tag).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking in 1% normal goat serum, the sections were incubated with ACE2 or SR-B1 monoclonal antibodies at 4□°C overnight in a humidified chamber, which was followed by an incubation with HRP-labeled goat anti-mouse IgG secondary antibody (Beijing ZSGB Biotechnology, ZDR-5307).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SR-B1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the sections were incubated with a goat anti-rabbit IgG secondary antibody (HRP) (Beijing ZSGB Biotechnology, PV9001) for 60 min and then visualized with 3,30-diaminobenzidine tetrahydrochloride (DAB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (ZSGB-Bio Cat# PV-9001, RRID:AB_2868452)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Vero E6 (CRL-1568), MDCK (CCL-34) and Hepa 1-6 (CRL-1830</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production: All pseudoparticles were generated in 293T cells transfected with the HIV backbone vector pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For chemicals and antibodies, Vero E6 or Huh-7 cells (1.6 ×105 cells/mL) were cultured in a 96-well plate at 37 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For SR-B1 expression, Vero cells (1.6 ×105 cells/mL) were transfected with a plasmid encoding SR-B1, while Huh-7 cells (1.6 ×105 cells/mL) were transfected with siRNA oligos for SR-B1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were fitted to saturation binding equations using GraphPad Prism 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acoustic Focusing cytometer using Flowjo V10.0.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical methods: In the present study, GraphPad Prism 8.0 was used for statistical calculations and data plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.15.252437: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were approved by the Institutional Animal Ethics committee (IAEC) No. RR/IAEC/72-2019, Invivo/GP/084.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Guinea Pig Immunizations: Groups of four, female, Hartley strain guinea pigs, (6-8 weeks old, approximately weighing 300 g) were immunized with 20 μg of purified antigen protein diluted in 50 μl PBS, (pH 7.4), and mixed with 50 μl of AddaVax™ adjuvant (vac-adx-10) (1:1 v/v Antigen: AddaVax™ ratio per animal/dose) (InvivoGen, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes for the heavy and light chain of the CR3022 antibody were obtained from Genscript (USA) and cloned into the pcDNA3.4 vector Purification of recombinant proteins expressed in Expi293F cells: Transfections were performed according to the manufacturer’s guidelines (Gibco, Thermofisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression levels were monitored by dot blot analysis with anti-His tag antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag antibodies .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this blot was washed and incubated with α-guinea pig ALP conjugated antibody (Sigma) at 1:5000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-guinea pig ALP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this, Rabbit ALP enzyme conjugated to anti-Guinea Pig IgG secondary antibody (diluted 1:5000 in blocking buffer) (50 μL/well) was added and incubated for 1 hour at 25 °C, 300 rpm (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Guinea Pig IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C56297-5000, RRID:AB_10379625)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, rabbit ALP enzyme conjugated to anti-Human IgG secondary antibody (diluted 1:5000 in blocking buffer) (50 μl/well) was added and samples incubated for 1 hour at 25°C, 300 rpm (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were incubated with anti-His Antibody (1:10000 dilution) conjugated with Horseradish peroxidase (HRP) enzyme for 1 hr at RT following which the reaction was visualized by adding 50μL of the chromogenic substrate, TMB (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (LSBio (LifeSpan Cat# LS-C67878-100, RRID:AB_1815148)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the plasmids pCAGGS-SARS2-S and pCAGGS-SARS-S were transiently expressed on HEK 293T cells using Polyethylenimine (PEI) (Polysciences, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the viruses were titrated in Vero E6 cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The unbound tag-free protein was collected and protein concentration was determined by absorbance (A280) using NanoDrop™2000c with the theoretical molar extinction coefficient calculated using the ProtParam tool (ExPASy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference-free 2D classification using single-particle analysis: The evaluation of micrographs was done with EMAN 2.1 (56).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMAN</div><div>suggested: (EMAN, RRID:SCR_016867)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference free 2D classification of different projections of particle were performed using simple_prime2D of SIMPLE 2.1 software (57</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SIMPLE</div><div>suggested: (SIMPLE, RRID:SCR_009389)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of Pseudotyped SARS-CoV-2 and pseudovirus neutralisation assay: The full-length synthetic construct of Spike glycoprotein of SARS-CoV-2 (GenBank: MN908947) was synthesized from Genewiz, UK.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.15.252395: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animal care and experimentation under protocol #4390, approved by the Institutional Animal Care and Use Committee (IACUC) at Kansas State University on April 8, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Following embedding, tissue sections were cut and stained with hematoxylin and eosin and evaluated by a board-certified veterinary pathologist who was blinded to the treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eighteen pigs (mix of males and females, five weeks of age) were used in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: To detect SARS-CoV-2 antibodies in sera, indirect ELISAs were performed using recombinant SARS-CoV-2 Receptor Binding Domain (RBD) expressed in HEK cells with a C-terminal Strep-Tag and the Nucleocapsid (N) protein expressed in E.coli with a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 μL anti-pig-IgG or IgM secondary antibodies, conjugated with peroxidase, were diluted 1:2,500 in blocking buffer and then incubated at room temperature for 1 hour, protected from light.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-pig-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optical density (OD) value was measured at 450 nm within 5 minutes of adding the stop solution to quantify the amount of antigenbinding antibody present in the sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigenbinding</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum from pigs infected with African Swine Fever Virus (ASFV) and the baculovirus-expressed ASFV-p54 antigen were used as a positive control for anti-pig-IgG or IgM secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was passaged three times in VeroE6 cells (ATCC® CRL-1586™), before being passaged two times in swine testicle (ST; ATCC CRL-1746™) and four times in porcine kidney (PK-15; ATCC® CCL-33™) cell lines to investigate suitability of these swine cell lines for propagation of SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: To detect SARS-CoV-2 antibodies in sera, indirect ELISAs were performed using recombinant SARS-CoV-2 Receptor Binding Domain (RBD) expressed in HEK cells with a C-terminal Strep-Tag and the Nucleocapsid (N) protein expressed in E.coli with a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.16.252973: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-Myc-tag (71D10), rabbit anti-IRF3 (D83B9), rabbit anti-pIRF3 (4D46), rabbit anti-TBK1 (3031S), rabbit anti-pTBK1 (D52C2) were purchased from Cell Signaling Technology; Mouse anti-MAVS was purchased from Santa Cruz; Mouse anti-actin, mouse anti-V5-tag, and rabbit anti-calnexin were purchased from proteintech; Mouse anti-Flag M2 was purchased from Sigma Aldrich; Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam; Rabbit anti-Tom20 antibody was purchased from Abclonal; Mouse anti-HA was purchased from MDL biotech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: (Cell Signaling Technology Cat# 2278, RRID:AB_490778)</div></div><div style="margin-bottom:8px"><div>anti-IRF3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-pIRF3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-TBK1</div><div>suggested: (Cell Signaling Technology Cat# 14590, RRID:AB_2798527)</div></div><div style="margin-bottom:8px"><div>anti-pTBK1 (D52C2)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAVS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-V5-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-calnexin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GM130</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Tom20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatants were transferred into new tubes after centrifugation for 10 min at 14,000g and further incubated with the indicated antibodies for 3 hours at 4 □ followed by the addition of protein A/G beads (Santa Cruz), or with Anti-Flag magnetic beads (Bimake), anti-Myc magnetic beads (Bimake).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Constructs and plasmids: Plasmids expressing RIG-I, RIG-IN, MDA-5, MAVS, TBK1, IKKε, IRF3-5D, TRIF, and STING were cloned into mammalian expression vectors and the luciferase reporter plasmids including pGL3-IFN-β-Luc (IFN-β luciferase reporter) and pGL3-IFN-λ1-Luc (IFN-λ1 luciferase reporter) were constructed by inserting the promoter region into pGL3-Basic (Promega, USA) by standard molecular cloning methods as described in our previous publications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK-293, HEK-293T, HeLa, and Vero E6 cells were obtained from the American Type Culture Collection (ATCC), and cultured according to the culture method provide by ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The luciferase reporter plasmids and the gene expression plasmids were co-transfected into HEK-293T cells as indicated in each figure legend.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral infection: VSV-enhanced green fluorescent protein (eGFP) and SeV were used to infect HeLa, HEK293, or HEK293T cells as described in our previous publications.30-32 Briefly, before infection, prewarmed serum-free DMEM medium at 37°C was used to wash the target cells, after which the virus was diluted to the desired multiplicity of infection (MOI) in serum-free DMEM and incubated with the target cells for 1-2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoblot analysis and immunoprecipitation: For Co-IP assay, HEK293T cells were first transfected with the indicated plasmids for 24 h and further lysed in lysis buffer [1.0% (v/v) NP-40, 50 mM Tris-HCl, pH 7.4, 50 mM EDTA, 0.15 M NaCl] complemented with a protease inhibitor cocktail (Sigma), and a phosphatase inhibitor cocktail (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays: Vero-E6 cells were used to perform plaque assays to determine the titer of VSV-eGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simply, Vero cells at approximately 100% confluency cultured in 24-well plates were infected with serial dilutions of VSV-eGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">34 Statistical analysis: Statistical analysis was performed using two-tailed unpaired Student’s t-tests by GraphPad Prism 8.0 and Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.14.251207: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Matrix processing and substrate scoring: The matrices were normalized by the sum of the 17 randomized amino acids (all amino acids expect for serine, threonine and cysteine), to yield a position specific scoring matrix.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of SRPK1, membranes were incubated with primary antibody (BD cat. no. 611072) at 0.025 µg/mL in PBST containing 5% milk overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SRPK1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of GAPDH, membranes were incubated with primary antibody (Cell Signaling, cat. no. 2118S) at a dilution of 1:10,000 in PBST containing 5% milk overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse (Invitrogen cat. no. A16072) and anti-rabbit (Thermo Scientific cat. no. A16104) secondary antibodies were used at 1:20,000 and 1:10,000 dilutions, respectively, in PBST containing 5% milk for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with either an anti-dsRNA antibody (J2, Sigma MABE1134) at a 1:125 dilution, or an anti-SARS-CoV-2 Spike RBD protein (ProSci #9087) at a 1:150 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (Millipore Cat# MABE1134, RRID:AB_2819101)</div></div><div style="margin-bottom:8px"><div>J2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike RBD protein ( ProSci #9087</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reactions were run phos-tag gel and blotted with monoclonal anti-N protein antibody (GeneTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were incubated with primary antibodies: Prosurfactant protein C (1:500, Milipore, cat# AB3786) and SARS-CoV-2 (1:500, Genetex cat# GTX632604) in blocking buffer at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture (Duke): All cells were obtained from ATCC and grown at 37°C in 5% CO2. 293T and A549 and Huh7 cells were grown in DMEM with 10% FBS, Glutamax, and Penicillin/Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were grown in EMEM with 10% FBS and Penicillin/Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-229E infections and titering: A stock of isolate HCoV-229E VR-740 (ATCC) was grown on Huh7 cells in complete media (DMEM supplemented with 10% FBS, 1% Pen/Strep, Glutamax).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For phosphoproteomic analysis, 6×107 Vero E6 or 6×107 A549-ACE2 cells were treated with 5 µM Alectinib or DMSO in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviruses were packaged as per standard protocols with a VSV-G envelope protein, A549 or A549-Cas9 cells were transduced and selected with puromycin at 2μg/mL. siRNA treatment of cells: A549-ACE2 cells were treated with 30μM siRNA (SRPK1: Horizon M-003982-02-0010; Non-targeting: Thermo 4390843) following the HiPerfect (Qiagen) Fast-Forward protocol and plated in 6 well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-Cas9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis: Differential expression analysis of proteins and phosphorylation sites was done using Limma v3.42 package in R (81).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A BLAST search was performed over each proteome using the SARS-CoV-2 nucleocapsid protein as the query; the top hit of each virus was taken to be the nucleocapsid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each designated nucleocapsid was then individually aligned to the SARS- CoV-2 nucleocapsid using MUSCLE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bacterial colonies were then selected and plasmid DNA isolated using the Genejet Plasmid Miniprep kit (Thermo Fisher Cat# K0503).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Cat#</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV2 primer/probe set were synthesized using IDT DNA based on the sequences provided by the CDC “Research Use Only 2019-Novel Coronavirus (2019-nCov) Real-time RT-PCR Primers and Probes” set N1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Probes”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reactions were cycled on the Applied Biosystems QuantStudio 3 Real-Time PCR System and analyzed using QuantStudio software version v1.4.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantStudio</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SRPIN340 and SPHINX were suspended in DMSO at 1000X the final concentration indicated, Alectinib at 500X.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPHINX</div><div>suggested: (SPHINX, RRID:SCR_000534)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.04.282558: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, wells were treated with goat-α-human HRP secondary antibody for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With rigorous washing steps in between the proteins were detected with mouse anti-strep-tag-antibodies (IBA) and goat anti-mouse IgG antibodies (Life Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantifying and plotting fluorescent image data: Image quantification was performed by measuring the intensity of gray pixels of the stained ferret and Syrian hamster lung tissue slides with ImageJ version 1.52p. For stained tissues, background correction was performed by subtracting the average signal intensity of the antibody control from the images stained with ACE2 antibody, SARS-CoV1, and SARS-CoV2 recombinant proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The adapted pCD5 expression vector with an N-terminal HA leader (MKTIIALSYIFCLVFA) peptide, ACE2, and Twin-Strep (WSHPQFEKGGGSGGGSWSHPQFEK); IBA, Germany) was purified from HEK293T cell culture supernatant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescent cell staining: Vero-E6, A549, and MDCK cells grown on coverslips were analyzed by immunofluorescent staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Micrographs were collected using Leginon [37] and then uploaded to Appion [38].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2D processing was undertaken using Relion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LAS Application Suite X was used as well as ImageJ for the addition of the scale bars.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plotting means ± standard deviation values were performed in GraphPad Prism v8.0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.08.284737: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (293T, ATCC, CRL-3216) and VERO-E6 cells (ATCC, CRL-1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS), 2.0 mM L-Glutamine, 110 mg/L sodium pyruvate, and 4.5 g/L D-glucose. l1-Hybridoma (CRL-2700) secreting a monoclonal antibody targeting against VSV glycoprotein was cultured in Minimum Essential Medium with Earle’s salts and 2.0 mM L-Glutamine (MEM; Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CRL-3216</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>l1-Hybridoma</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next they were incubated with the mouse monoclonal antibody targeting Flag tag (9A3, #8146S,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody targeting Flag tag ( 9A3</div><div>suggested: (Cell Signaling Technology Cat# 8146, RRID:AB_10950495)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three rounds of PBS washing, cells were subsequently incubated with 2 μg/ml of the secondary goat anti-rabbit antibody conjugated with Alexa Fluor 594 (A11032, Thermo Fisher Scientific, United States) diluted in 1% BSA /PBS at room temperature for 30 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A11032</div><div>suggested: (Molecular Probes Cat# A-11032, RRID:AB_2534091)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently incubated with a mouse monoclonal antibody SARS-CoV/SARS-CoV-2 Nucleocapsid Antibody (40143-MM05, Sino Biological, China) at 1:500 at 37°C for 1 hour, and then incubated with 2μg/ml of goat anti-mouse secondary antibody, Alexa Fluor 594 (A-11032, Thermo Fisher Scientific) at 37°C for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-11032, RRID:AB_2534091)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (293T, ATCC, CRL-3216) and VERO-E6 cells (ATCC, CRL-1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS), 2.0 mM L-Glutamine, 110 mg/L sodium pyruvate, and 4.5 g/L D-glucose. l1-Hybridoma (CRL-2700) secreting a monoclonal antibody targeting against VSV glycoprotein was cultured in Minimum Essential Medium with Earle’s salts and 2.0 mM L-Glutamine (MEM; Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coronavirus RBD-hFc binding assay: Recombinant SARS-CoV-RBD-hFc and SARS-CoV-2-RBD-hFc proteins were produced by transient transfection of 293T cells with Lipofectamine 3000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was amplified on Vero-E6 cells and stored at −150°C, and the titer was determined on Vero-E6 cells through a plaque assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, we aligned the deduced ACE2 protein sequences using the MUSCLE program (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence logo was generated with WebLogo (https://weblogo.berkeley.edu/logo.cgi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed selective pressure analysis on bat ACE2 using CodeML implemented in PAML (24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PAML</div><div>suggested: (PAML, RRID:SCR_014932)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homology-based structural modeling: Molecular models of different bat ACE2 were predicted by I-TASSER (Iterative Threading ASSEmbly Refinement) version 5.1 (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>I-TASSER</div><div>suggested: (I-TASSER, RRID:SCR_014627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structural alignment and visualization were implemented in PyMOL (33).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.14.295956: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: Recombinant SARS-CoV-2 S-RBD fused with Fc/His tag (S-RBD-His) was produced in 293T cells and purified with Protein A Agarose (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was transferred to 293T expressing human ACE2 stable cell line cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.29.068098: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of HCoV-19 spike ectodomain and hACE2: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extracellular domain of hACE2 (Gln18-Ser740, NP_068576.1) with C-terminal Fc tag was expressed in HEK 293 cells were purified by protein A sepharose beads (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MS and MS/MS spectra were recorded using the Xcalibur software 2.3 (Thermo Scientific, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics: The acquired MS raw files from deglycosylated peptides were searched by MaxQuant (version 1.6.10.43) against the human ACE2 sequence from UniProtKB and HCoV-19 S sequence (YP_009724390.1_3) from NCBI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The modified residues within each model were generated with Coot (Emsley et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All structural figures were performed by PyMOL (Schrödinger Inc. U.S.A.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.18.302901: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Equal portions of the cell lysate were run on a 15% SDS-PAGE gel and blotted onto a PVDF membrane, which was subsequently probed with HRP Anti-Strep tag antibody (Abcam) and developed with an ECL substrate (Amersham Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Strep tag antibody ( Abcam )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T, Expi293F and HeLa cells were purchased from the American Type Culture Collection (ATCC), and cultured in Dulbecco’s Modified Eagle medium (DMEM) or Expi293 Expression Medium (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco) at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were motion-corrected and dose-weighted using MotionCor2 (Zheng et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patch contrast transfer function (CTF) estimation was performed using cryoSPARC (Punjani et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inspection, model building, and manual adjustment were carried out in Coot (Emsley and Cowtan, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real-space refinement was performed using PHENIX (Adams et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All representations of densities and structural models were generated using Chimera, ChimeraX (Goddard et al., 2018), and Pymol (DeLano, 2002).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image data were analyzed and quantified using Image J (NIH) or MetaXpress software (Molecular Devices).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>MetaXpress</div><div>suggested: (MetaXpress, RRID:SCR_016654)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All graphs were plotted and analyzed with GraphPad Prism 5 software. p > 0.05 was considered statistically not significant, and the following denotations were used: **p < 0.001 and *p < 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 12 and 13. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.29.318196: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection: Adherent HEK293 cells were grown to ∼90% confluence in a 9 cm diameter cell culture dish at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The DNA coding for the IFNα2-eYFP-FLAGtag-PreScission_site-S_RBD-8xHis-tag-StopStop fusion protein was ordered from Genewiz, cloned into the HindIII and XbaI sites of pcDNA 4/TO (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.22.308965: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CR3022, a SARS-CoV-1 and SARS-CoV-2 spike binding antibody, and dengue antibody, DEN3, were used as positive and negative controls for the assay, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DEN3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA binding: 96-well half-area plates (Corning cat. #3690, Thermo Fisher Scientific) were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat. #MA1-21315-1MG</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the washes, a secondary antibody conjugated with alkaline phosphatase (AffiniPure goat anti-human IgG Fc fragment specific, Jackson ImmunoResearch Laboratories cat. #109-055-008) diluted 1:1000 in 1% BSA/PBS-T, was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AffiniPure goat anti-human IgG Fc fragment specific</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-005-008, RRID:AB_2337534)</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-008, RRID:AB_2337601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A mixture of fluorescently labeled antibodies to cell surface markers was prepared, including antibodies specific for the T cell markers CD3(APC Cy7, BD Pharmingen #557757), CD4(APC-Cy7, Biolegend #317418) and CD8(APC-Cy7, BD Pharmingen</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Fitzgerald Industries International Cat# 61R-CD3gHUCY5, RRID:AB_1283253)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 317418, RRID:AB_571947)</div></div><div style="margin-bottom:8px"><div>APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with plasmids encoding full-length coronavirus spikes including SARS-CoV-1, SARS-CoV-2, MERS-CoV, HCoV-HKU1, HCoV-OC43, HCoV-NL63 and HCoV-229E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay: Under BSL2/3 conditions, MLV-gag/pol and MLV-CMV plasmids were co-transfected into HEK293T cells along with full-length or variously truncated SARS-CoV1 and SARS-COV2 spike plasmids using Lipofectamine 2000 to produce single-round of infection competent pseudo-viruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 293T cells were plated in advance overnight with DMEM medium +10% FBS + 1% Pen/Strep + 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following the infection, HeLa-hACE2 cells were lysed using 1x luciferase lysis buffer (25mM Gly-Gly pH 7.8, 15mM MgSO4, 4mM EGTA, 1% Triton X-100)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">20µL of the supernatant was transferred to a 384-well plate seeded with 2E3 HeLa-ACE2 cells and incubated for an additional 24 hours at 34°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extend of biotinylation was evaluated by BioLayer Interferometry binding value using streptavidin biosensors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLayer</div><div>suggested: (Harvard Medical School Center for Macromolecular Interactions Core Facility, RRID:SCR_018270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After another two washes, stained cells were analyzed using flow cytometry (BD Lyrics cytometers), and the binding data were generated by calculating the percent (%) PE-positive cells for antigen binding using FlowJo 10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absorbance was measured after 8, 20, and 30 minutes, and was recorded at an optical density of 405 nm (OD405) using a VersaMax microplate reader (Molecular Devices), where data were collected using SoftMax software version 5.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SoftMax</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gibson assembly products were finally transformed into competent E.coli cells and single colonies were picked for sequencing and analysis on IMGT V-Quest online tool (http://www.imgt.org) as well as downstream plasmid production for antibody expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10µL of human polyclonal sera diluted 1:500 in Perm/Wash Buffer (BD Biosciences)was added to the plate and incubated at RT for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences)was</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PFU/mL of the monocyte plate supernatant was calculated and graphed using Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Leginon software 37 was used to automate data collection on a FEI Tecnai Spirit (120keV), paired a FEI Eagle 4k x 4k camera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RELION 3.0 40 was used to generate the 2D class averages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.29.175844: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal experiments are performed according to Swedish Animal Welfare Act SFS 1988:534 and were approved by the Animal Ethics Committee of Malmö/Lund, Sweden.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against the His-tag (1:2000, Invitrogen) were followed by secondary HRP conjugated antibody (1:2000, Dako, Denmark), for detection of S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In another set of experiments, 2 μg of SARS-Cov-2 S protein were incubated with 0.25 mg/ml of LPS and Lipid A from E. coli, LPS from P. aeruginosa, LTA and PGN from S. aureus, and zymosan from S. cerevisiae.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>P . aeruginosa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The image was obtained using a Gel Doc Imager (Bio-Rad Laboratories,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of the spectra was performed with Xcalibur v 2.0.7. software (from Thermo Fisher Scientific, San José, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis, as indicated in each figure legend, were performed using GraphPad Prism software v8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.09.195263: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-His-tag antibodies were loaded to a SA sensor chip by NHS to capture the His-tag labeled S trimer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>His-tag labeled S trimer.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies were in vitro expressed using HEK293 cells, and the binding specificities were quantity by ELISA against the Spike protein and the RBD protein, as described previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-mixed Huh-7 cells were added to all wells and incubated for 24 h at 37 °C and supplied with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Fabs of BD-236, BD-604, and BD-629 were obtained by transient transfection in HEK293F cells using polyethylenimine (Polysciences) when the cell density reached 1 million cells/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 and IC80 were determined by a four-parameter logistic regression using GraphPad Prism 8.0 (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All structures were solved by the molecular replacement method using the Phaser program (McCoy et al., 2007) in Phenix (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structural models were then manually adjusted in Coot (Emsley et al., 2010) and refined using Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were recorded on a K2 Summit direct electron detector (Gatan) using the SerialEM software (Mastronarde, 2005), in the super-resolution mode at a nominal magnification of 130,000, with an exposure rate of 7.1875 e-/Å2 per second.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw movie frames were aligned and averaged into motion-corrected summed images with a pixel size of 1.055 Å by MotionCor2 (Zheng et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using Pymol (Schrödinger) and UCSF Chimera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.15.340612: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were stained using primary antibodies against β-actin (1:10,000, AC-15, Sigma), strep II-tag (1:1,000, NBP2-43735, Novus), strep II-tag (1:2,000, ab76949, abcam), GAPDH (1:1,000, 607902, Biolegend), pSTAT1 (1:1,000, Y701, Cell Signaling Technology), STAT1 (1:1,000, 9172S, Cell Signaling Technology), pSTAT2 (1:1,000, Y690, Cell Signaling Technology), STAT2 (1:1,000, 4594S, Cell Signaling Technology), IFNAR1 (1:1,000, ab45172, abcam), p62 (1:1,000, GP62-N, ProGen), LC3a/β (1:200</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (BioLegend Cat# 607902, RRID:AB_2734503)</div></div><div style="margin-bottom:8px"><div>pSTAT1</div><div>suggested: (Fluidigm Cat# 3153003, RRID:AB_2661824)</div></div><div style="margin-bottom:8px"><div>Y701 , Cell Signaling Technology) , STAT1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>9172S , Cell Signaling Technology) , pSTAT2 ( 1:1,000 , Y690 , Cell Signaling Technology) , STAT2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFNAR1</div><div>suggested: (Abcam Cat# ab45172, RRID:AB_775764)</div></div><div style="margin-bottom:8px"><div>p62</div><div>suggested: (Progen Cat# GP62-N, RRID:AB_2801426)</div></div><div style="margin-bottom:8px"><div>GP62-N</div><div>suggested: (Progen Cat# GP62-N, RRID:AB_2801426)</div></div><div style="margin-bottom:8px"><div>LC3a/β</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, M2, Sigma), V5-tag (1:1,000, D3H8Q, Cell Signaling Technology), SARS-CoV-2 (COVID-19) spike antibody (1:1000, 1A9, Biozol), SARS-CoV/SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-tag</div><div>suggested: (Cell Signaling Technology Cat# 13202, RRID:AB_2687461)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were stained using primary antibodies against strep II-tag (1:200, NBP2-43735, Novus) and TGN46 (1:400, AHP500GT, Bio Rad), secondary antibodies fluorescently labelled with AlexaFluor568 targeting rabbit-IgGs (1:400, A10042, Invitrogen) and AlexaFluor647 targeting sheep-IgG (1:400, A21448, Invitrogen), and DAPI (1:1,000) to stain nuclei.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NBP2-43735</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TGN46</div><div>suggested: (Bio-Rad Cat# AHP500GT, RRID:AB_2203291)</div></div><div style="margin-bottom:8px"><div>A10042</div><div>suggested: (Thermo Fisher Scientific Cat# A10042, RRID:AB_2534017)</div></div><div style="margin-bottom:8px"><div>AlexaFluor647 targeting sheep-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A21448</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and cell culture and viruses: HEK293T cells were purchased from American type culture collection (ATCC: #CRL3216).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of stable THP-1 cells: THP-1 cell liens were generated by transduction with lentivirus generated with the indicated pLVX-EF1alpha vectors (kind gift from Nevan Krogan), as well as packaging vectors psPax2 and pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: CLS Cat# 300356/p804_THP-1, RRID:CVCL_0006)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence: HeLa GL cells were transfected using TransIT-LT1 and grown on coverslips in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa GL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inhibition of SARS-CoV-2 by immune modulation: 300,000 Calu-3 cells were seeded in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viruses were propagated by infecting 70% confluent Vero E6 in 75 cm2 cell culture flasks at a MOI of 0.003 in 3.5 ml serum-free medium containing 1 μg/ml trypsin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteome analysis: For the proteome analysis of infected cells, 0.6×106 Caco-2 cells were infected with SARS-CoV-2 BetaCoV/Netherlands/01/NL/2020 at an MOI of 0.5 and harvested 24 h and 48 h post infection with TM lysis buffer supplemented with 1:500 protease inhibitor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired using a Zeiss LSM710 and analyzed with Fiji ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD021899.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MaxQuant 1.6.15.0 was used to identify proteins and quantify by LFQ with the following parameters: Database, Uniprot_AUP000005640_Hsapiens_20200120.fasta supplemented with the sequences of NSP1_V5, NSP7_V5, NSP15_V5, NSP16_V5, E_V5, M_V5, N_V5, S_V5, ORF3_V5, ORF6_V5, ORF7_V5 and Spike protein from SARSCoV239; MS tol, 10ppm; MS/MS tol, 20ppm</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GO Analysis: From the proteome of the respective samples, proteins regulated more than 4-fold compared to the vector control were extracted and submitted to PANTHER (cellular component analysis).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PANTHER</div><div>suggested: (PANTHER, RRID:SCR_004869)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used MATLAB 2019b for the half-life analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using GraphPad PRISM 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.19.344713: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies used in this study were the following: rabbit anti-RBD polyclonal antibody (Sino Biological, #40592-T62), mouse anti-Actin monoclonal antibody (ProteinTech, 60008-1-Ig)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mouse anti-his tag monoclonal antibody (Abmart, M20001S), mouse anti-DDK/Flag tag monoclonal antibody (Abmart, M20008L), HRP Goat Anti-Rabbit IgG (ZSBIO, ZB-5301), HRP Goat anti-mouse IgG (ZSBIO, ZB-5305).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-DDK/Flag tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After treatment with 1% triton-100 for 15 min and blocking with unimmunized goat serum for 1 h, cells were incubated with the anti-his tag antibody overnight at 4°C, and then detected with donkey anti-mouse secondary antibody conjugated with alexa fluor plus 488nm (Invitrogen, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A32766, RRID:AB_2762823)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and transfection: Human kidney cell line HEK-293 and lung cancer cell line A549 were purchased from the Cell Bank of Type Culture Collection Committee of the Chinese Academy of Sciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to evaluate the effect of polydatin and lonidamine on virus replication, 2×105 A549 cells were seeded into 12-wells plates and infected with Ad11 virus (MOI=0.5) in serum-free medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Potential TFs on the promoter (upstream 1000bp) of TRL-TAA-4-1 were predicted with JASPAR software (relative profile score threshold was 80%) and Venny 2.1 software was used to performed the gene overlap analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>JASPAR</div><div>suggested: (JASPAR, RRID:SCR_003030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The signalling pathway and functional enrichment analysis of related genes were performed with Metascape.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.22.349951: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals and in vivo procedures: Animal husbandry and all experimental procedures were approved by the local animal ethics council and were performed in accordance with national and international laws and policies on the protection of animals used for scientific purposes (UE Directive 2010/63/UE; Italian Legislative Decree 26/2014).<br>Consent: SARS-CoV2 microneutralization assay: Human sera derived from post-convalescent COVID-19 patients after signing of an informed consent, in the frame of a project aimed at following up patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HA tag, derived from the human influenza hemagglutinin protein, and composed of a 9-amino acid peptide sequence, Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala, was fused downstream of the last SARS-CoV2 S aa (Thr1273) flanked at its 5’ and 3’ side by a Gly and a Ser, respectively, to facilitate antigen expression detection by the widely commercially available HA antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human influenza hemagglutinin protein ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cells were blocked at the indicated time points with ice-cold methanol, incubated with Anti-Hexon primary antibody (Abcam) followed by detection with secondary anti-Mouse IgG Peroxidase (Sigma) and Vector NovaRED substrate kit for peroxidase (Vectorlabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Hexon</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG Peroxidase ( Sigma )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50ug of clarified lysates were loaded onto 4-12% acrylamide gel (Thermo Fisher), transferred onto iBlot 2 NC Mini Stacks membranes (Invitrogen) and incubated with the anti-HA (Abcam) or anti-RBD (Sino Biological) primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of the SARS CoV-2 spike protein was achieved by incubation with an anti-rabbit (Sigma) secondary antibody, followed by ECL (Invitrogen) incubation, and images were taken using a Chemidoc (Biorad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with Live/Dead fixable dye (Invitrogen); recombinant human His-tagged ACE-2 protein (RayBiotech) was incubated on cells before adding any antibodies, then detected with anti-His antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was detected with goat anti-mouse IgG mAb conjugated with AlexaFluor 647 fluorochrome (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief: optimized amount of proteins in 100μl volume were bound to Ni-NTA plates/strips for 1h at 25°C in shaking (1 μg/ml for full length Spike, 2 μg/ml for R121, 0.5 μg/ml for RBD); plates were then incubated with serial dilutions of sera for 2h at 25°C in shaking, then binding was detected with specific alkaline phosphatase-conjugated secondary antibodies (anti-mouse total IgG and anti-monkey total IgG from Sigma and anti-mouse IgG1 and IgG2a from BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse total IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-monkey total IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot: For ELISpot assays, MSIP 96 well plates were from Millipore (Multiscreen filter plates) and anti-mouse or anti-monkey IFNγ or IL4 capture and detection antibodies were all from U-CyTech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-monkey IFNγ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were plated at 1×106 per well in a 96-well round bottom plate and stimulated with either SARS-CoV-2 peptide pool S1 or S2, or with DMSO as negative control, all in presence of anti-CD28 antibody, for 18h (mouse cells) or 5h (monkey cells) in the presence of Brefeldin-A (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD28</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse Antibodies: CD3 AlexaFluor647, CD4 BV421, CD8 BUV395, IL-17a PerCP-Cy 5.5, IFNγ BV650, IL2 APC-R700 (from BD Biosciences), IL-4 PE, IL-13 PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (BD Biosciences Cat# 563795, RRID:AB_2722501)</div></div><div style="margin-bottom:8px"><div>IL-17a</div><div>suggested: (BioLegend Cat# 506930, RRID:AB_2686975)</div></div><div style="margin-bottom:8px"><div>PerCP-Cy</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-13 PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NPH Antibodies: CD3 AF700, CD4 PerCP-Cy 5.5, CD8 PE (from BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (SouthernBiotech Cat# 8200-27, RRID:AB_2796424)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered material was inoculated into monolayers of A549 cultivated in DMEM completed with 10</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 8×104 HEK293 cells per well were seeded in 96 well plates the day before the assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells infection and S2/ACE2 staining: HeLa cells were plated at 5×105 cells/well in 6-well plates two days prior infection to allow adhesion, then infected with GRAd vectors at multiplicity of infection (MOI) of 150 for 48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA assay on mouse sera were performed with His-tagged SARS-CoV-2 full length Spike protein (produced in baculovirus, SinoBiological), while ELISA with monkey sera were performed with a trimeric his-tagged stabilized SARS-CoV-2 Spike protein produced in-house in Expi293 cells or with a commercial RBD (ACROBiosystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 1.5 × 106 HEK293T cells were seeded overnight in a 10 cm diameter Primaria-coated dish (Corning).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infectivity and neutralization assays, either 1.5×104 HuH7 cells or 2×104 VeroE6 cells/well were plated in white 96-well tissue culture plates (Corning) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HuH7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum from naïve BALB/c animals are routinely tested at 1:100 dilution as negative control in ELISA, and the resulting OD is nearly at the level of secondary Ab alone, therefore for mouse experiments baseline titers cannot be detected, calculated and plotted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Group C adenovirus assignment for GRAd32 was based on a phylogenetic analysis of aligned adenoviral polymerase sequences using a bootstrap-confirmed Maximum Likelihood tree (500 replicates) calculated with MEGA 10.1.7 (21)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polymerase sequences were aligned with MUSCLE (23).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample acquisition was performed on a LSR Fortessa-X20 cytofluorimeter (BD biosciences) and sample analysis was performed with FlowJo (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV2 microneutralization assay: Human sera derived from post-convalescent COVID-19 patients after signing of an informed consent, in the frame of a project aimed at following up patients.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">: GraphPad Prism version 8 for Windows (GraphPad Software, San Diego, California, USA) was used for graphs and statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04528641</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">GRAd-COV2 Vaccine Against COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.28.359836: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was reviewed and accepted by the animal study review committee (SRC) and conducted in accordance with IACUC guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster challenge experiments: Female Syrian golden hamsters were obtained from Charles River Laboratories at 6 weeks of age.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multi-Array 96-well plates (cat# L15XA-3, Meso Scale Discovery (MSD)) were coated with mouse anti-human IgG antibody (CH2 domain, cat# MA5-16929, ThermoFisher Scientific) at 2 μg/mL in 1X PBS (50μL/well), sealed, and incubated overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-16929, RRID:AB_2538406)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed 3X with 1X washing solution and 50 μL of Sulfo-Tag anti-human/NHP IgG antibody (cat no# D20JL-6, lot no# W0019029S, MSD), at 1/1,000 dilution in Blocker™ Casein in PBS was added to each well and plates were then incubated for 1-1.5 hours at room temperature on an orbital shaker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human/NHP IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody treatments were administered IV with monoclonal antibodies (mAbs) against SARS-CoV-2 Spike, or isotype control mAb in up to 350 μL of formulation buffer to anesthetized animals at 12 hours-post inoculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pharmacokinetic Study: Female CD-1-IGS (strain code #022) were obtained from Charles River Laboratories at 6-8 weeks of age.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1-IGS</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pharmacokinetic analysis of the collected ELISA data was performed with the Phoenix WiNnonlin suite of software (version 6.4, Certara) using a non-compartmental approach consistent with an IN bolus route of administration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phoenix</div><div>suggested: (Phoenix, RRID:SCR_003163)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.20.346916: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The use of human materials was approved by the local medical ethical committee (MEC approval: 2014-414).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Order of these peptides was randomized, when synthesized on mini-cards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the peptide arrays were incubated with a 1/1000 dilution of an appropriate antibody peroxidase conjugate (goat anti-human HRP conjugate, Southern Biotech, cat. no.: 2010-05 or goat anti-lama HRP conjugate, Abcore, cat. no. AC15-0354) for 1 h at 25°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human HRP</div><div>suggested: (SouthernBiotech Cat# 2010-05, RRID:AB_2795564)</div></div><div style="margin-bottom:8px"><div>anti-lama</div><div>suggested: (Acris Antibodies GmbH Cat# AM39052SU-N, RRID:AB_11216596)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding to the peptides was determined using a goat anti-human IgG HRP conjugate (ITK Southern Biotech) for 1 h at RT and tetramethylbenzidine substrate (BioFX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The potent neutralizing anti-MERS-S1 control antibody 7.7G6 43 and an isotype matched negative control mAb were taken along as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MERS-S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike ectodomains were stably produced in Drosophila S2 cell line, as previously described 28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antibodies were purified using Protein A sepharose (IBA) according to the manufacturer’s instruction. mAb 1.6C7 and 7.7G6 used in the animal experiments were produced in Chinese hamster ovary (CHO) cells as previously described 61.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chinese hamster ovary ( CHO )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, HEK-293T cells at 70~80% confluency were transfected with the pCAGGS expression vectors encoding full-length MERS-S, SARS-S, SARS2-S or OC43-S with a C-terminal cytoplasmic tail truncation to increase cell surface expression levels.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped VSV virus were titrated on monolayer African green monkey kidney VeroCCL81 cells (MERS-S pseudotyped VSV)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroCCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the virus neutralization assay, serially diluted mAbs were pre-incubated with an equal volume of virus at RT for 1 h, and then inoculated on Vero/HRT-18 cells, and further incubated at 37℃.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero/HRT-18</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was then added to Huh-7 cells (MERS-CoV) or VeroE6 cells (SARS-CoV and SARS-CoV-2) and incubated for 1 hr, after which the cells were washed and further incubated in medium for 8 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 cells were seeded one day before reaching a confluency of 70-80%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a second experiment, the prophylactic efficacy of mAb 28D9 was tested against MERS-CoV and SARS-CoV infection in the K18 TghDpp4 mouse model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TghDpp4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">proteins: Coronavirus spike ectodomains of MERS-CoV (residues 19–1262; strain EMC; GenBank accession number (GB): YP_009047204.1), SARS-CoV (residues 15–1182; strain Urbani; GB: AY278741.1), MHV (residues 15–1231; strain A59; UniProt accession number: P11224) and the S2 ectodomain of MHV (residues 718–1252; strain A59; UniProt accession number: P11224) fused with a C-terminal T4/GCN4 trimerization motif, a thrombin cleavage site and a Strep-tag purification tag were cloned in-frame into pMT\Bip\V5\His expression vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximum effective concentration (EC50) binding values were calculated by 4-parameter logistic regression on the binding curves using GraphPad Prism version 7.04.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were analysed by FlowJo (version 10) and percentage of GFP+Alexa Fluor 594+ cells over GFP+ cells were calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentrations (IC50) were determined using 4-parameter logistic regression (GraphPad Prism v7.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.30.177097: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD polyclonal antibody and monoclonal antibody (MAb) 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the corresponding secondary antibodies, horseradish peroxidase (HRP)-conjugated anti-human IgG1 (Abcam, USA) or HRP-conjugated anti-mouse IgG (Sigma, USA), were added and incubated at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vectors were transiently transfected into HEK293F cells using polyethylenimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD polyclonal antibody and monoclonal antibody (MAb) 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The movies were recorded on a K2 Summit direct electron detector (Gatan) operated in the super-resolution mode (yielding a pixel size of 1.02 Å after 2 times binning), under low-dose condition in an automatic manner using SerialEM (Mastronarde, 2005).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All images were aligned and summed using MotionCor2 software (Zheng et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For class 1, after further 2D classification, we refined the 24,502 cleaned up particles into a S-open map at 6.0 Å resolution using non-uniform refinement in CryoSparc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSparc</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 associated with the up RBD was subtracted and refined in Relion to obtain a more 8.4 Å map with better connectivity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the missing loop regions in S1 subunit, we either built the homology model based on SARS-CoV S structure (PDB: 6CRW) (Kirchdoerfer et al., 2018) through SWISS-MODEL webserver (Waterhouse et al., 2018), or built the loop manually according to the density in COOT (Emsley and Cowtan, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the FP region, we first built the homology model by Modeller tool within Chimera by using MERS-CoV S structure (PDB: 6NB3) as template (Pettersen et al.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then refined the combined model against our 3.8 Å resolution SARS-CoV-2 S-ACE2 map using Rosetta and Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interaction surface analysis was conducted by PISA server (Krissinel and Henrick, 2007).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.26.356048: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work relating to SCoV2 live virus and SCoV2-RNA was conducted in the BSL-3 facility of the Cleveland Clinic Florida Research and Innovation Center in accordance with institutional biosafety committee (IBC) regulations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and other reagents: Primary antibodies used in this study include anti-GST (1:5,000; Sigma-Aldrich), anti-V5 (1:5,000, R960-25; Novex), anti-FLAG (M2, 1:2,000; Sigma-Aldrich), anti-HA (1:3,000, HA-7; Sigma-Aldrich), anti-Phospho-IRF-3 (Ser396) (1:1,000, D6O1M; CST), anti-IRF3 (1:1,000, D6I4C; CST), anti-Phospho-STAT1 (Tyr701) (1:1,000, 58D6; CST), anti-IFIT1 (1:1,000, PA3-848; Invitrogen and 1:1,000, D2X9Z; CST), anti-IFIT2 (1:1,000; Proteintech), anti-ISG15 (1:500, F-9; Santa Cruz), anti-MAVS (1:1,000; CST), anti-RIG-I (1:2,000, Alme-1; Adipogen), anti-MDA5 (1:1,000, D74E4; CST), anti-Phospho-MDA5 (Ser88)7, anti-PP1α (1:2,000; Bethyl laboratories), anti-PP1γ (1:2,000; Bethyl laboratories), anti-USP18 (1:1000, D4E7; CST), anti-RSAD2 (1:1,000, D5T2X; CST), anti-PKR (1:1,000, D7F7; CST), anti-MX1 (1:1,000, D3W7I; CST), anti-IFITM3 (1:1,000, D8E8G; CST), anti-ISG20 (1:1,000, PA5-30073; Invitrogen), anti-ubiquitin (1:1,000, P4D1; Santa Cruz), anti-NS36, anti-PLpro (Nsp3) (1:1,000, GTX135589; GeneTex), anti-β-tubulin (1:1,000; CST), and anti-β-Actin (1:1,000, C4; Santa Cruz)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GST</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Phospho-IRF-3 ( Ser396 )</div><div>suggested: (Cell Signaling Technology Cat# 29047, RRID:AB_2773013)</div></div><div style="margin-bottom:8px"><div>anti-IRF3</div><div>suggested: (Cell Signaling Technology Cat# 11904, RRID:AB_2722521)</div></div><div style="margin-bottom:8px"><div>anti-Phospho-STAT1 ( Tyr701 )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFIT1</div><div>suggested: (Antibodies-Online Cat# ABIN485037, RRID:AB_10847629)</div></div><div style="margin-bottom:8px"><div>anti-IFIT2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ISG15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAVS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RIG-I</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Phospho-MDA5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PP1α</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PP1γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-USP18</div><div>suggested: (Cell Signaling Technology Cat# 4813, RRID:AB_10614342)</div></div><div style="margin-bottom:8px"><div>anti-RSAD2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PKR</div><div>suggested: (Cell Signaling Technology Cat# 12297, RRID:AB_2665515)</div></div><div style="margin-bottom:8px"><div>anti-MX1</div><div>suggested: (Cell Signaling Technology Cat# 37849, RRID:AB_2799122)</div></div><div style="margin-bottom:8px"><div>anti-IFITM3</div><div>suggested: (Cell Signaling Technology Cat# 59212, RRID:AB_2799561)</div></div><div style="margin-bottom:8px"><div>anti-ISG20</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-30073, RRID:AB_2547547)</div></div><div style="margin-bottom:8px"><div>anti-ubiquitin</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-8017, RRID:AB_628423)</div></div><div style="margin-bottom:8px"><div>anti-NS36</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PLpro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Nsp3</div><div>suggested: (GeneTex Cat# GTX135589, RRID:AB_2887501)</div></div><div style="margin-bottom:8px"><div>anti-β-tubulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-Actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-IFNAR2 neutralizing antibody (1:250, MMHAR-2) was obtained from PBL Assay Science.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFNAR2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-flavivirus E antibody (4G2) was purified from the mouse hybridoma cell line D1-4G2-4-15 (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Monoclonal anti-flavivirus E antibody</div><div>suggested: (Absolute Antibody Cat# Ab00230-2.0, RRID:AB_2715504)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse and anti-rabbit HRP-conjugated secondary antibodies (1:2,000) were purchased from CST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit HRP-conjugated secondary antibodies ( 1:2,000 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lysates were precleared with Protein G Dynabeads (Invitrogen) at 4°C for 2 h and then incubated with Protein G Dynabeads conjugated with the anti-MDA5 antibody or an IgG1 isotype control (G3A1; CST) at 4°C for 4 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MDA5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>an IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently permeabilized with 1× BD Perm/Wash buffer (BD Biosciences) for 15 min and incubated with an anti-flavivirus E antibody (4G2; 1:100 in 1× BD Perm/Wash buffer) at 4°C for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flavivirus E</div><div>suggested: (Absolute Antibody Cat# Ab00230-2.0, RRID:AB_2715504)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were further washed three times with 1× BD Perm/Wash buffer and incubated with a goat anti-mouse Alexa Fluor 488-conjugated secondary antibody (#A10667, 1:500 in 1× BD Perm/Wash buffer; Invitrogen) at 4°C for 30 min in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-10667, RRID:AB_2534057)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-hACE2 and Vero-E6-hACE2 were a gift from Jae U.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-hACE2 were kindly provided by Benjamin R. tenOever (Icahn School of Medicine at Mount Sinai)4. HEK293T, HEK293, HeLa, MEFs, NHLFs, Vero, A549-hACE2, and BHK-21 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-hACE2 and Vero-E6-hACE2 were maintained in DMEM containing 200 μg/mL hygromycin B and 2 μg/mL puromycin respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SVGA and HAP-1 cells were cultured in Eagle’s Minimum Essential Medium (MEM, Gibco) and Iscove’s Modified Dulbecco’s Medium (IMDM, Gibco), respectively, supplemented with 10% FBS and 100 U/mL penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HAP-1</div><div>suggested: RRID:CVCL_5G07)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C6/36 cells were cultured in MEM with 10% FBS and 100 U/mL penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C6/36</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jung (Cleveland Clinic Lerner Research Center) and was propagated in Vero E6-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, MDA5-2CARD and its K23R/K43R mutant were subcloned into pcDNA3.1(-) harboring an N-terminal 3×FLAG tag between NheI and NotI. pCR3-FLAG-MV-V (strain Schwarz) was a gift from Karl-Klaus Conzelmann (LMU, Munich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5-2CARD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-flavivirus E antibody (4G2) was purified from the mouse hybridoma cell line D1-4G2-4-15 (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>D1-4G2-4-15</div><div>suggested: BCRJ Cat# 0268, RRID:CVCL_J890)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transfected with GST or GST-MDA5-2CARD, and the cells were collected at 48 h post-transfection and lysed in Nonidet P-40 (NP-40) buffer [50 mM HEPES (pH 7.4), 150 mM NaCl, 1% (v/v) NP-40, 1 mM EDTA, and 1× protease inhibitor cocktail (Sigma)]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay (ELISA): Human or mouse IFN-β in the culture supernatants of NHLFs, HeLa, and MEFs was determined by ELISA using the VeriKine Human Interferon Beta ELISA Kit or VeriKine Mouse Interferon Beta ELISA Kit (PBL Assay Science) as previously described7. siRNA- and shRNA-mediated knockdown: Transient knockdown in NHLFs, HeLa, HAP-1, HEK293T, and HEK293 cells was performed using non-targeting or gene-specific siGENOME SMARTpool siRNAs (Dharmacon).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T or MDA5 KO HEK293 cells were transfected with IFN-β luciferase reporter construct and β-galactosidase (β-gal) expressing pGK-β-gal, along with GST-MDA5-2CARD (WT or mutants) or FLAG-MDA5 (WT or mutants).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5 KO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mock-RNA and SCoV2-RNA were produced by isolating total RNA from uninfected or SCoV2-infected (MOI 1 for 24 h) Vero-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The titers of ZIKV were determined by plaque assay on Vero cells as previously described6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: To quantify the percentage of DENV-infected cells, reconstituted HEK293 MDA5 KO cells were washed with PBS (Gibco) and fixed with 4% (v/v) formaldehyde in PBS at room temperature for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus protection assay: The culture supernatants from mutant or WT EMCV-infected NHLFs or RIG-I KO HEK293 cells were UV-inactivated in a biosafety cabinet under a UV-C lamp (30W) at a dose of 5,000 μJ/cm2 for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Complete inactivation of EMCV was confirmed by plaque assay on BHK-21 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transfected with GST or GST-MDA5-2CARD, and the cells were collected at 48 h post-transfection and lysed in Nonidet P-40 (NP-40) buffer [50 mM HEPES (pH 7.4), 150 mM NaCl, 1% (v/v) NP-40, 1 mM EDTA, and 1× protease inhibitor cocktail (Sigma)]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigma</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.31.363044: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Photoconjugation: Cardiac Troponin I antibodies 19C7 (4T21) and 4C2 (4T21), and C-reactive protein antibodies C6 (4C28cc) and C135 (4C28) were obtained from Hytest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C-reactive protein antibodies C6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C135</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-adalimumab/TNFα monoclonal antibody (HCA207) and anti-infliximab (HCA213) were obtained from BioRad.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-adalimumab/TNFα</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-infliximab (HCA213</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-COV-2 antibodies 47D11 and 49F1 were produced in HEK-293T cells and purified using Protein-A affinity chromatography as described previously44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-COV-2 spike trimer protein was expressed in HEK-293T cells with a C-terminal trimerization motif and Strep-tag using the pCAGGS expression plasmid, and purified from the culture supernatant by Strep-Tactin chromatography as described previously44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For lentiviral production of the two vectors, encoding either the RBD-LB or RBD-SB transgene, HEK293T cells (ATCC® CRL-3216™) were transiently co-transfected with the abovementioned transfer vectors, as well as the VSV-G envelope (pMD2.G) and packaging plasmids (pCMVR8.74), as previously described58.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.29.361287: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">CDR2 was randomized in stage one, PCR templates at this stage were equal molar mixtures of plasmids carrying DNA encoding frames, including three frame1 versions, one frame2, three frame3 versions and one frame4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) with anti-Flag antibody (Sigma-Aldrich, F1804), then incubating antibody-coated beads with cell lysate or cell media containing 3xFlag tagged target proteins at 4°C for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For anti-Myc selection, magnetic beads were coated by anti-Myc antibody (ThermoFisher Scientific, 13-2500) only.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with wash buffer, HRP conjugated anti-His tag secondary antibody (BioLegend, 652503) diluted 1:2000 in blocking buffer was then added to the plates and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag secondary antibody ( BioLegend , 652503</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T ACE2 were a kind gift of Michael Farzan.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed once with PBST (PBS, ThermoFisher Scientific, with 0.02% TritonX-100), a 1:1 mixture of HEK293T cell culture media containing secreted RBD-3xFlag and blocking buffer (PBST with 1% nonfat dry milk) was added to the plates and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medium was then removed from HEK293T ACE2/TMPRSS2 cells and replaced with 150 μl of the VHH + pseudotyped lentivirus solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">psPAX2 and pCMV-VSV-G were previously described 20. pTRIP-SFFV-EGFP-NLS was previously described 21 (a gift from Nicolas Manel; Addgene plasmid # 86677; http://n2t.net/addgene:86677; RRID:Addgene_86677). cDNA for human TMPRSS2 and Hygromycin resistance gene was obtained by synthesis (IDT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_86677)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CDR-directed clustering analysis: Computational analysis for CDR-directed clustering was performed using custom python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage GFP was quantified on a Cytoflex LX (Beckman Coulter) and data were analyzed with FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.11.09.374603: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Lung tissue samples from eight different healthy donors and nasal tissue samples from one healthy donor and one patient with chronic rhinosinusitis with nasal polyps were obtained under the approval of the ethical committee from the University Hospital Leuven (UZ Leuven Biobanking S51577 and S59864).<br>Consent: All patients were adult and provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies were mouse anti-V5 tag [Invitrogen, R960-25, 1:2000 (SARS-1-S, MERS-S and SARS-2-S) or 1:5000 (229E-S)] and mouse anti-β-actin (Sigma-Aldrich, A5447, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>SARS-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>229E-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A5447</div><div>suggested: (ABclonal Cat# A5447, RRID:AB_2766249)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibody, we used a peroxidase-coupled goat anti-mouse antibody (Dako, P0447, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Agilent Cat# P0447, RRID:AB_2617137)</div></div><div style="margin-bottom:8px"><div>P0447</div><div>suggested: (Agilent Cat# P0447, RRID:AB_2617137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were heated for 5 min at 95°C and subjected to SDS-PAGE and immunoblotting, as above, with mouse anti-V5 tag (Invitrogen, R960-25) and mouse anti-MLV p30 antibody (Abcam, ab130757) as primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R960-25</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>anti-MLV p30</div><div>suggested: (Creative Diagnostics Cat# DCABH-2412, RRID:AB_2476319)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, media and compounds: Calu-3 (ATCC HTB-55) cells were grown in minimum essential medium (MEM) supplemented with 10% fetal calf serum (FCS), 0.1 mM non-essential amino acids, 2 mM L-glutamine, and 10 mM HEPES.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells (HCL4517; Thermo Fisher Scientific) and Vero E6 (ATCC CRL-1586) were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FCS, 1 mM sodium pyruvate, 0.075% sodium bicarbonate and (only for Vero E6) 0.1 mM non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were then transduced into receptor- and TMPRSS2-transfected HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using GraphPad Prism (version 8.4.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04455815</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial Looking at the Use of Camostat to Reduce Progression…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04321096</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Impact of Camostat Mesilate on COVID-19 Infection</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04353284</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Camostat Mesylate in COVID-19 Outpatients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04355052</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Open Label Study to Compare Efficacy, Safety and Tolerabilit…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04374019</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Novel Agents for Treatment of High-risk COVID-19 Positive Pa…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.25.115618: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: Human ACE2 (his tag) (10108-H08H), ACE2 rabbit Antibody (10108-RP01), goat anti-Rabbit/HRP secondary antibody (SSA004, and SARS-CoV-2 (2019-nCoV) and RBD of spike glycoprotein (mFC tag)(40592-V05H) were purchased from Sino Biological (Beijing,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Rabbit/HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SSA004</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>2019-nCoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>40592-V05H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody/HRP (1:5000 dilution) in 5% BSA was incubated 37°C for 0.5 h followed by washing for three times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody/HRP</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.11.13.381533: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Donors: This study was approved by the Harvard Medical School Office of Human Research Administration Institutional Review Board (IRB20-0365) as was the use of healthy donor control blood (IRB19-0786).<br>Consent: We received informed, written consent from a healthy adult male participant (C1) who recovered from confirmed SARS2-CoV-2 infection, with mild illness not requiring hospitalization, five weeks before blood donation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We received informed, written consent from a healthy adult male participant (C1) who recovered from confirmed SARS2-CoV-2 infection, with mild illness not requiring hospitalization, five weeks before blood donation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times and resuspending the cells, we added anti-IgG-APC antibody (BD Biosciences), anti-CD19-FITC antibody (BD Biosciences), and streptavidin-PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-093-194, RRID:AB_1036183)</div></div><div style="margin-bottom:8px"><div>anti-CD19-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We detected bound antibody with horseradish peroxidase (HRP)-coupled anti-human (Fc) antibody (Sigma Aldrich catalog number A0170).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human (Fc)</div><div>suggested: (Sigma-Aldrich Cat# A0170, RRID:AB_257868)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: We maintained HEK293T cells (ATCC CRL-11268) in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A HEK293T-hACE2 stable cell line was a gift from Huihui Mou and Michael Farzan and an Expi293F-His6-tagged SARS-CoV-2 S2P stable cell line that expresses a gift from Bing Chen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2P</div><div>suggested: RRID:CVCL_2H49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A T225 flask of VeroE6 cells was inoculated with 90 μl starting material in 15 ml DMEM containing 2% (v/v) of heat inactivated FBS (HI-FBS) and incubated in a humidified incubator at 37 °C with periodic rocking for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For crystallography, we produced the protein by PEI transfection of GnTI-/- HEK293S cells grown in suspension or HEK293T cells grown in suspension and also in presence of kifunensine (5 μM), purified by nickel affinity purification, and removed the His6-tag by TEV digestion followed by reverse nickel affinity purification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times and resuspending the cells, we added anti-IgG-APC antibody (BD Biosciences), anti-CD19-FITC antibody (BD Biosciences), and streptavidin-PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used IMGT/V-QUEST31 (http://www.imgt.org) to analyze IgG gene usage and the extent of variable segment somatic hypermutation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diffraction data were indexed and integrated using XDS (build 202 00131)36 and merged using AIMLESS (v0.5.32)37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIMLESS</div><div>suggested: (AIMLESS, RRID:SCR_015747)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structure of C1A-B12 Fab:RBD (space group P212121) was determined by molecular replacement using Phaser (v2.8.3)38, with coordinates for the B38 Fab variable domain, constant domain and RBD (PDB ID: 7BZ5) (Wu et al., 2020) used as search models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed iterative model using O39 and refinement in Phenix (v1.18.2-3874)40 and Buster (v2.10.3)41, during which we also built alternative conformations where density was apparent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During refinements, we updated TLS groups calculated using Phenix40 and a python script, as well as occupancy restraints calculated in Buster.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural Analysis: We analyzed the structures and generated figures using PyMOL (Schrödinger)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.11.06.370676: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five fields for microscopic analysis were randomly selected in each treated group, the numbers of fused and unfused EGFP positive cells were counted.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of recombinant SARS-CoV-2 spike RBD, human ACE2 and antibodies: The DNA sequences of codon-optimized SARS-CoV-2 spike Receptor Binding Domain (S-RBD) and human ACE2 extracellular domain (hACE2-ECD) were cloned into a pFuse-Fc expression vector (Invivogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human ACE2 extracellular domain ( hACE2-ECD )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA sequences for the variable regions of the combinatorial antibodies were cloned into a full-length human IgG4 mutant construct (S228P) and expressed in HEK293F cells for 4 days and further purified by Mabselect chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S228P</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A solution containing the secondary antibody, anti-M13 bacteriophage antibody conjugated with HRP (dilution factor 1 : 5000; Sino Biological, #11973-MM05T-H), was added into the above plates (150 μL/well) and incubated at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M13</div><div>suggested: (LSBio (LifeSpan Cat# LS-C71922-5000, RRID:AB_10636908)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant hACE2-ECD was coated in PBS buffer at 2 ng/μL, 100 μL per well at 4 °C overnight, washed with PBS once, then blocked with 3% BSA in PBS. Biotinylated S-RBD (hFc tag removed by thrombin digestion) at a final concentration of 50 nM was incubated with 2-fold serial diluted S-B8, S-D4, and S-E6 antibodies (from 1 - 133 nM) at 4 °C for 30 min, in which an IgG4e1 isotype antibody was used as the negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-D4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interaction of antibodies with cell surface expressed spike by FACS: In a flow-cytometry binding experiment, the spike protein of either full-length SARS-CoV-2 or SARS, which was conjugated with P2A-EGFP, was transiently transfected into a HEK293T cell.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P2A-EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike protein expressing cells (50000 cells per tube) were then incubated with different anti-S-RBD antibodies for 20 min at 4 °C, and washed with 1 mL ice-cold FACS buffer, spun, and re-suspended in a 100 μL ice-cold FACS buffer containing the Alexa555 conjugated secondary antibody that recognizes human Fc (1 : 800 v/v dilution, Life technology, # A21433).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The co-cultures of cells were cultivated in a DMEM medium with 10% FBS, and treated with or without anti-SARS-CoV-2 spike antibodies at indicated concentrations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Autoreactivity assay: The autoreactivity assay was performed using a HEp-2 anti-nuclear antibodies (ANA) kit (Medical & Biological Laboratories Co., Ltd, #4220-12CN) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nuclear</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>#4220-12CN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing twice (5 min each), the FITC-conjugated secondary anti-human antibody was incubated with the cells for 20 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: The Vero cell line (ATCC® CCL-81™) was maintained in a DMEM/F-12k media (Gibco, #C11330500CP) containing 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For establishing the HEK293T/hACE2 stable cell line, HEK293T cells (ATCC® ACS-4500™) were transiently transfected with hACE2 fusion BFP encoding PB510 plasmid using PiggyBac Transposon System (System Biosciences, PB210PA-1), followed by addition of 2 μg/mL puromycin 6 h post-transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# ACS-4500, RRID:CVCL_4V93)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S-RBD-hFc and hACE2-ECD-mFc proteins were heterologously expressed in HEK293F cells by transient transfection and cultured for 4 days, then purified by Mabselect columns (Cytiva, #17-5199-01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HEK293T/hACE2 cells were first seeded into 96-well white bottom plates at a density of 1×104/well, and cultivated overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 35 μL of 0.1 mg/mL antibodies were loaded to the wells in a slide pre-seeded with fixed and permeabilized HEp-2 cells and incubated for 20 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEp-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">http://www.imgt.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org/</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using four-parameter logistic regression (Hill equation) in GraphPad Prism 8.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (47) and PHENIX (48), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epitope and paratope residues, as well as their interactions, were identified by using PISA program (49) with buried surface area (BSA >0 Å2) as the criterion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.11.21.392753: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines: VeroE6 and A549 cells were obtained from American Type Culture Collection (ATCC) and tested at regular intervals for mycoplasma contamination.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three times washing with PBS, bound primary antibody was detected with a secondary antibody (anti-mouse IgG), conjugated to horseradish peroxidase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This Heidelberg strain was passaged in VeroE6 cells, aliquoted and stored at −80° C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: VeroE6 and A549 cells were obtained from American Type Culture Collection (ATCC) and tested at regular intervals for mycoplasma contamination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus stocks were produced by transfection of HEK293T cells with a pWPI plasmid encoding for TMPRSS2 and the pCMV-Gag-Pol and pMD2-VSV-G packaging plasmids (kind gifts from D. Trono, Geneva).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all other assays, A549+ACE2 cells were cultured in Roswell Park Memorial Institute (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549+ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PLpro expression and purification: For cloning of PLpro with an N-terminal 6xHis-SUMO1 tag, synthetic fragments of the Nsp3 coding sequence derived from the original Wuhan strain were purchased from BioCat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analyzed using GraphPad Prism (v8.4)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Densitometric analysis of protein bands on gels was performed using ImageJ (v1.52p)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The LC-MS systems used was either a Thermo Fisher Finnigan Surveyor Plus equipped with an Agilent Zorbax 300SB-C18 column (3.5 μm, 3.0 × 150 mm) coupled to a Finnigan LTQ mass spectrometer or an Agilent 1100 Series HPLC equipped with a Luna 4251-E0 C18 column (3 μm, 4.6 x 150 mm) coupled to a PE SCIEX API 150EX mass spectrometer (wavelengths monitored = 220, 254 and 646 nm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Finnigan Surveyor Plus</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04535167</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">First-In-Human Study To Evaluate Safety, Tolerability, And P…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.01.406934: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Donors & Ethics: Donors were recruited in accordance with the laws of Switzerland and under ethics approval BASEC-2016-01260 of the Cantonal Ethics Commission of Zurich.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were weighed prior to the start of the study and randomly distributed in the different cohorts.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In Vivo experiments (hamster): A total of 56 Golden Syrian hamsters, 36 male and 20 female, weighing between 80g and 130g were used in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of antibodies was detected using a fluorescence labeled anti human IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound ACE2 was then detected using a fluorescence labeled anti His Tag antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti His Tag antibody.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative control/isotype control antibody (mAb24C3) is a human-derived antibody specific for tetanus toxoid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mAb24C3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This sort yielded RBD-specific-antibody-expressing HEK cell clones.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of SARS-CoPsV-2: HEK293T cells stably expressing full length huACE2 (aa1-805) were seeded and left to adhere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of wild type SARS-CoV-2: At day 0, Vero E6 cells were seeded with a concentration of 1*105 cells/well in 300 μl medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As control cells non-transfected HEK293T and Raji B cells were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Raji B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were expressed in HEK293 cells after gene synthesis of the variable regions and linkage to the same constant region derived from human IgG1 (Trastuzumab) as COVAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed and IC50 values were determined using the “log [Inhibitor] vs. normalized response -- Variable slope” fitting model of GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A caveat for this is the fact that the target cells we used were stably transfected cells that may or may not mimic the in vivo situation in an infected individual. The only experimental evidence for ADCC against corona virus infected cells that we could identify is described in Holmes et al. Br. J. exp. Path. I986. Comparison to benchmark antibodies currently in the clinic: In an attempt to benchmark the virus neutralizing activity of MTX-COVAB to one of its peers, we compared it side-by-side with the two antibodies that form Regeneron’s cocktail (Hansen et al. Science 2020) using our pseudovirus assay. As shown in Figure 5, MTX-COVAB shows a neutralization capacity that is on par with that obtained with the better of the two antibodies as well as with the cocktail.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.13.420406: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For quantification of cell-cell fusion, three fields were randomly selected in each well to count the fused and unfused cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigens and antibodies: The RBD domain of SARS-CoV-2 S protein (His-tag) were synthesized by Prof. Xuefei Cai at Key Laboratory of Molecular Biology for Infectious Diseases (Ministry of Education), Chongqing Medical University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigens</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were incubated with mouse anti-RBD monoclonal antibody (1:1000 dilution) for 1 hour at 37°C, and then washed with PBST five times and incubated with Horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (Abmart, Shanghai, China) for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and cell culture: HEK 293T, A549, and Calu3 cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were co-transfected with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-cell fusion assay: HEK 293T effector cells were transfected with plasmid pAdTrack-TO4-GFP encoding green fluorescent protein (GFP) or pS-G614 encoding the corresponding SARS-CoV-2 S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional analysis of Ca2+ in pseudovirus infectivity: 293T-ACE2 cells were seeded in 96-well plate (2×104 cells/well) and incubated at 37 °C for 8h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In short, HEK 293T-ACE2 cells were assigned to 96-well plates (4×104 cells/well) and cultured for 24 hours at 37 °C with 5 μM compounds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytopathic effect (CPE) assay and quantification of SARS-CoV-2 infection: Vero E6 cells were dispensed into 96-well plate (4.0×104 cells/well), pre-treated with medium containing compounds or DMSO for 1 hour at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Data were analyzed using GraphPad Prism version 6.0 software and were presented as means ± SD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.18.423418: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a parallel experiment, the wells were washed and then incubated with polyclonal rabbit anti-human SP-D primary antibody (0.5 μg/ml) (1:5000) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human SP-D</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next day, the wells were washed and then incubated with anti-sheep IgG-HRP antibodies or anti-His antibodies (Genetex, GTX628914, 0.5 μg/ml) (1:2000) for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-sheep IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of RBD binding, the wells were further incubated with anti-mouse IgG antibody (Abcam, ab6728, 0.5 μg/ml) (1:2000) for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab6728, RRID:AB_955440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following PBS washes, the cells were probed with goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody linked to Alexa Fluor 647 (Thermo Fisher Scientific) (0.6 μl/100 μl per tube) for 1 h at room temperature in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For binding experiments using rfhSP-D, SARS-CoV-2 S1 protein containing a C-terminal His-tag (Acro; S1N-C52H3) (5 μg/ml) was tagged with anti-His antibody (Genetex; GT395) (1:100) at 4°C for 1h and followed by pre-incubation with a series of two-fold dilutions of rfhSP-D (10 μg/ml) or mock (cells only) at 4°C for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, coverslips were blocked with 2% w/v BSA for 1h and incubated with ACE2 antibody [SN0754] (1:250) (GeneTex, GTX01160), followed by Goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody (1:500) (Thermo Fisher Scientific) for 1 h at room temperature in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-32307, RRID:AB_2809589)</div></div><div style="margin-bottom:8px"><div>GTX01160</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and treatments: Human embryonic kidney (HEK) 293T or HEK293T cells overexpressing ACE2 receptor (HEK293T-ACE2) were cultured in complete Gibco Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% v/v fetal bovine serum (FBS), 100 U/ml penicillin (Sigma-Aldrich) and 100 μg/ml streptomycin (Sigma-Aldrich), and left to grow at 37°C in the presence of 5% v/v CO2 for approximately 48 h before passaging.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were seeded one day before, and then transfected with the indicated plasmids using TransIT®-LT1 transfection reagent (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2 cells (HEK293T cells overexpressing ACE2 receptor) (0.5×105 cells) were preincubated with rfhSP-D (0, 5, 10 and 20 μg/ml) for 24 h and then washed twice with PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: GraphPad Prism 6.0 software was used to generate all the graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.21.423721: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human myocardial samples (right ventricle or atrium) were discarded material from surgical repair of congenital heart defects (ethical approval number 15/LO/1064 from the North Somerset and South Bristol Research Ethics Committee).<br>Consent: Adult patients and paediatric patients’ custodians gave informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies (ACE2, dilution 1:100; CD147, 1:500, 6x-HIS-tag (Invitrogen MA1-21315), 1:1000) were incubated for 16 hrs at 4°C. β-Actin was used as a loading control (Sigma, A5441, 1:10000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>6x-HIS-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>β-Actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>A5441</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where required, cells were incubated with the anti-CD147 neutralizing antibody (20 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD147</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCs were pre-incubated with anti-ACE2 (20 μg/mL, as described before5) or anti CD147 (20 μg/mL) antibodies for 1 hat 37 °C and then exposed to the S protein (500 ng/mL - 2·9 nM) for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti CD147</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot data were analyzed using the ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Data were analyzed using Prism version 8.0 and expressed as individual values and as means ± standard error of the mean.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.19.423584: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, endogenous human NPC1 and HSP90 were purified using immobilized Recombinant Protein G Resin (Generon) and 4 µg of specific antibodies against NPC1 (Abcam, ab108921) or HSP90 (Enzo Life Sciences, ADI-SPA-835) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSP90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After that, plates were washed with PBST (PBS 0.1%Tween20) and the binding of NPC1 to SARS-CoV-2 N protein was detected with a rabbit anti-NPC1 antibody (1:2000), revealed with an anti-rabbit-horseradish peroxidase (HRP) (1:2000) using a colorimetric substrate (OPD) and finally, quantified by absorbance at 492 nm in the EnSight multimode plate reader of PerkinElmer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NPC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit-horseradish peroxidase (HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and viruses: Human embryonic kidney cells 293T/17 (HEK 293T; ATCC-CRL-11268) were cultured in Dulbecco modified Eagle medium (DMEM) at 37 °C and 5% CO2 atmosphere, supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 1X GlutaMAX (Thermo Fisher) and 10% heat-inactivated fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 Lunet C3 cells, a gift from T. Pietschman (Twincore, Germany), were cultured at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 10mM HEPES, 1X NEAA and 10% of heat-inactivated fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lunet C3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of tagged-N protein and EGFP in HEK 293T cells: To transfect HEK 293T cells, four 60mm dishes were seeded with 2.5 ×106 cells each 24 hours prior to transfection in DMEM complete medium described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 cells were pre-treated with compounds at the indicated concentrations in growth medium for 1 h at 33 °C, followed by infection with 229E-GFP at a multiplicity of infection (MOI) of 1 pfu/cell for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the SARS-CoV-2 N with N-terminal EGFP tag (EGFP-N), a codon optimized cDNA sequence for the ORF of SARS-CoV-2 N (NCBI reference sequence number: NC_045512) was cloned into the pEGFP-C1 (by GeneArt-Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneArt-Thermo Fisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of SARS-CoV-2 N protein in the baculovirus system: The sequence of the N protein published in the NCBI database was selected (GenBank accession number: 43740575 / NCBI reference sequence number: NC_045512).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant SARS-CoV-2 N protein produced in pupae was measured by band densitometry with the ChemiDoc™ XRS Gel Imaging System using Image Lab™ software (Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Lab™</div><div>suggested: (Image Lab Software, RRID:SCR_014210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50s values and dose-response curves were estimated using GraphPad Prism v6.0 with a 99% confidence interval.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to determine the percentage of infected cells per condition, 8,000 cells/time point were scored using FACS Canto II flow cytometer (BD Sciences) and analyzed using the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.30.424801: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the cells were washed three times with PBS, incubated with serum free media with primary antibody anti-ACE2 (1:100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Enzo Life Sciences Cat# ALX-804-722-C100, RRID:AB_11180102)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CSNPs-binding, hACE2-overexpressed Hek293 cells were incubated with 10 uM peptide for 1 hour and then treated and incubated with 5 uM SARS-CoV-1 S1 protein-His Tag (AcroBiosystems, S1N-C52H3-100UG, USA) for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hek293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As g_mmpbsa tool is compatible with older versions of GROMACS (versions 5 or lower), the “tpr” files created by GROMACS 2019.6 were recreated through GROMACS 5.1 and used for binding energy calculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Computational tools used in this study: For simple visualization and collecting structural insights of the SARS-CoV-2 spike and ACE2 proteins, free available packages of VMD (61), Pymol (https://pymol.org), and Chimera (62) were utilized.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CSNPs-binding, hACE2-overexpressed Hek293 cells were incubated with 10 uM peptide for 1 hour and then treated and incubated with 5 uM SARS-CoV-1 S1 protein-His Tag (AcroBiosystems, S1N-C52H3-100UG, USA) for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To overcome this limitation, two research groups have stabilized the α1 helix by increasing the helical bundles and designed peptide biologics that could effectively inhibit SARS-CoV-2 cell entry (44, 45). However, this modification increases the size of these peptides by ~3-4 folds, increasing the cost of synthesis and formulation. We and others have previously used peptide stapling to enhance the target specificity of therapeutic peptides (28, 51). In fact, Fiarlie and his co-workers found that the helical-constrained compounds hold comparatively similar biological potencies in PPI as their parent proteins. They constructed four such compounds and proposed that downsized-constrained peptides could be of great value in biological PPIs and medicine (52). Unfortunately, we could not synthesize the CSNP1 to compare its potency with CSNP2; however, CSNP3 (a relatively shorter version of CSNP1) was unable to bind SARS-CoV-2 S1 (Figure 5). This notion suggests that in addition to the structural integrity, optimum length and the featured pharmacophores are vital for CSNP to bind RBD. Together, we suggest that structure guided computational medicinal chemistry and click chemistry approaches might be useful in designing CSNPs to enhance tethering to their targets. Collectively, we suggest that CSNP2 and CSNP4 are stable peptide that deter the binding of ACE2 and S1 subunit of SARS-CoV-2 and could be potent antidote for COVID-19.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.24.20248821: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Human samples and ethical declaration: Anonymized samples from blood donors (n=100/sampling week) and pregnant women (n=100/sampling week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Human samples and ethical declaration: Anonymized samples from blood donors (n=100/sampling week) and pregnant women (n=100/sampling week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary HRP-conjugated anti-human antibodies were diluted in blocking buffer and incubated with samples for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (from Southern Biotech) and dilutions used: goat anti-human IgG (2014-05) at 1:10,000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2014-05, RRID:AB_2795580)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, we used a logistic regression over anti-RBD and -S training data (from n=595 historical blood donor controls and n=138 SARS-CoV-2 PCR+ individuals across the clinical spectrum) to model the relationship between the ELISA measurements and the probability that a sample is antibody-positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-positive</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD domain (RVQ – QFG) of SARS-CoV-2 was cloned upstream of a Sortase A recognition site (LPETG) and a 6xHIS tag, and expressed in 293F cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro virus neutralisation assay: Pseudotyped viruses were generated by the co-transfection of HEK293T cells with plasmids encoding the SARS-CoV-2 spike protein harboring an 18 amino acid truncation of the cytoplasmic tail2; a plasmid encoding firefly luciferase; a lentiviral packaging plasmid (Addgene 8455) using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped neutralisation assays were adapted from protocols validated to characterize the neutralization of HIV, but with the use of HEK293T-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.29.424482: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h, infected cells were washed four times with DMEM before medium supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant diluted 1 to 50, from CRL-2700, ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, all ectodomains were produced in HEK293F cells grown in suspension using FreeStyle 293 expression medium (Life Technologies) at 37 °C in a humidified 8% (v/v) CO2 incubator rotating at 130 r.p.m.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus was produced by transient transfection of HEK293T cells (ATCC) using linear 25 kDa polyethyleneimine (PEI; Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70∼80% confluency were transfected with the pCAGGS expression vectors encoding full-length OC43 S with a truncation of the 17 C-terminal residues (to increase cell surface expression levels) along with fusion to a flag tag and the Fc-tagged bovine coronavirus hemagglutinin esterase protein at molar ratios of 8:1. 48 h after transfection, cells were transduced with VSVΔG/Fluc (bearing the Photinus pyralis firefly luciferase) (Kaname et al., 2010) at a multiplicity of infection of 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral neutralization, Huh7 cells (for MERS-CoV S pseudotyped virus) or stable 293T cells expressing ACE2 (Crawford et al., 2020) (for SARS-CoV S and SARS-CoV-2 S pseudotyped viruses) in DMEM supplemented with 10% FBS, 1% PenStrep were seeded at 40,000 cells/well into clear bottom white walled 96-well plates and cultured overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_H376)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification of the B6 broadly neutralizing mAb: Ten-week-old CD-1 mice were injected twice with 50 µg of MERS-CoV S formulated with Adjuplex at weeks 0 and 2 and once with 50 µg of SARS-CoV S formulated with Adjuplex at week 8 at the Fred Hutchinson Cancer Research Center Antibody Technology Resource.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MERS-CoV S EM structure in complex with 5-N-acetyl neuraminic acid (PDB 6Q04, residue 18-1224) and the B6-MERS-CoV11 (residue 1230-1240) crystal structure were fit into the cryoEM map.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6-MERS-CoV11</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage of infectivity was calculated as the ratio of luciferase readout in the presence of mAbs normalized to luciferase readout in the absence of mAb, and half maximal inhibitory concentrations (IC50) were determined using 4-parameter logistic regression (GraphPad Prism v8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the high resolution map, particle images were subjected to Bayesian polishing (Zivanov et al., 2019) before performing non-uniform refinement, defocus refinement and non-uniform refinement again in cryoSPARC (Punjani et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CryoEM model building and analysis: UCSF Chimera (Pettersen et al., 2004) and Coot (Emsley et al., 2010) were used to fit atomic models into the cryoEM maps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were analyzed using MolProbity (Chen et al., 2010), EMringer (Barad et al., 2015), Phenix (Liebschner et al., 2019) and privateer (Agirre et al., 2015) to validate the stereochemistry of both the protein and glycan components.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.29.424711: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antigen and control antibodies: For expression of the RBD subdomain of the SARS-CoV-1 (residues Arg306 to Phe527) and SARS-CoV-2 (residues Arg319 to Phe541) spike protein and human ACE2, genes encoding the proteins were synthesised and cloned upstream of either an Fc tag or rCD4-Avi tag, both with an additional 6 × His tag in mammalian expression vectors (37).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phe527</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Phe541</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH and VL sequences of SARS-CoV-2 control antibodies (COV2-2196, COV2-2130, S309, B38, H4, and CR3022) were obtained from the CoV-AbDab database (25) and cloned into pINT3/pINT54 IgG expression vectors (4) as synthetic gene fragments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2-2130</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify unique combinations of heavy CDR3 and light CDR3, antibody frameworks and CDR regions were annotated and analysed using Geneious Biologics (Biomatters).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>light CDR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD-ACE2 blocking assay: Black 96-well immune plates (Thermo Scientific, 10030581) were coated with mouse anti-rCD4 antibody (Bio-Rad, MCA1022R) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rCD4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify antibodies that could block the interaction between RBD and ACE2, the anti-SARS-CoV-2 antibodies were pre-incubated with 2 nM of recombinant ACE2-Fc-His-Biotin for 30 minutes before transferring to the RBD-coated plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification for crystallography studies: The Fab fragments for anti-SARS-CoV-2 antibodies ION_300 and ION_360 and SARS-CoV-2 receptor binding domain (RBD) were expressed in Expi293F™ cells (Thermo Fisher, A14527).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 receptor binding domain ( RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody:RBD complexes were mixed and co-purified by size exclusion chromatography in 20 mM Tris-HCl (pH 7.5) and 50 mM NaCl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody:RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both complex crystal structures were solved by molecular replacement using Phaser (46) utilising the coordinates from the SARS-CoV-2 RBD domain (PDB: 7JMP) and using homology models for ION_300 and ION_360 antibodies generated using SWISSMODEL (47) to model the heavy and light chains.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ION_360</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detailed materials and methods for library construction, neutralisation assays and biophysical characterisation of anti-SARS-CoV-2 antibodies. Fig. S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Superposition of antibody and nanobody structures targeting the SARS-CoV-2 RBD. Fig. S7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH germline usage in convergent antibody response. Fig. S9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralisation assays and combination testing: Briefly, a lentiviral pseudotyped virus was used for the infection of HEK293T/17 cells transiently expressing human ACE2 and TMPRSS2 for the pseudoviral assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reagents cat. no. 100980) was used to infect VERO CCL-81 cells for the authentic virus neutralisation assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For single concentration pseudovirus assay, SPR, and cross-reactivity evaluation, the antibodies expressed in 96 well plates (Expi293 cells) were purified by protein-A affinity chromatography (Generon, PC-A100), using 96 well filter plates (Whatman Polystyrene Unifilter Microplates, GE Healthcare, 11313535)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Atomic models were built using Coot (48) and refined with Refmac (49).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.12.07.414706: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Intravenous viral administration in vivo: The animal protocol was approved by the University of South Carolina IACUC committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male wild type C57BL/6J mice (5-6 weeks old) were intravenously administered 100 μl of Spp or VSV-G lentivirus (8×108 of viral particles) via tail venous or retro-orbital injection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S1 subunit, anti-low density lipoprotein receptor (LDLR), anti-mannose receptor C-type 1 (MRC1), anti-CD68 and anti-human immunodeficiency viruses (HIV)-1 p24 antibodies were obtained from Novus Biologicals (Littleton, CO, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S1 subunit, anti-low density lipoprotein receptor (LDLR), anti-mannose receptor C-type 1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD68</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human immunodeficiency</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV)-1 p24</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-His tag antibodies were obtained from Proteintech (Rosemont, IL, USA) and Thermo Fisher (Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>The anti-His tag antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S1 subunit, anti-HIV-1 p24 antibody, or anti-His antibodies were used to detect the expression of viral proteins and followed by HRP-labeled secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S1 subunit,</div><div>suggested: (Active Motif Cat# 91345, RRID:AB_2847847)</div></div><div style="margin-bottom:8px"><div>anti-HIV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RAW264.7 cell culture, viral uptake and electroporation: Macrophage-like RAW264.7 (RAW) cells (ATCC® TIB-71™) were cultured in DMEM (10% FBS) medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW264.7</div><div>suggested: ATCC Cat# TIB-71, RRID:CVCL_0493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a parallel experiment, RAW cells (5×106) were electroporated with pcDNA3.1, EGFP-N2 or pcDNA-Spike plasmids (10 μg) using the following parameters: 2 mm gap cuvette, 250 ul sample volume and 120V (BTX Harvard Bioscience, Inc., Holliston, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild type C57BL/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired using ImageXpress Pico System (Molecular Device, San Jose, CA, USA) or confocal microscopy system (Carl Zeiss AG, Oberkochen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageXpress Pico System</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.06.20249035: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Data and samples were collected only from voluntary, non-remunerated, adult donors as described previously [27], and who provided written informed consent as part of routine donor selection and blood collection procedures, that were approved by the Ethics Advisory Council of Sanquin Blood Supply Foundation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For anti-RBD IgG1 and IgG3, the calibrator consisted of recombinantly expressed IgG1 and IgG3 monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 was produced in HEK cells with a HAVT20 leader peptide, 10xhis-tag and a BirA-tag as described by Dekkers et al., [28].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">African green monkey (Vero-E6) cells were added in a concentration of 2 × 104 cells per well and incubated for 3 days at 35°C in an incubator with 5% carbon dioxide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the remaining 676 samples collected between March 30 and August 14, the longitudinal changes in IgG antibody levels were analyzed by linear mixed effects modeling in R (v3.6.0) using the LmerTest package (v3.1.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LmerTest</div><div>suggested: (R package: lmerTest, RRID:SCR_015656)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis were carried out using Graphpad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation is the substantial uncertainty in the individual half-life estimates especially at the low end, since the available data will sometimes only cover a fraction of a half-life. Long-term maintenance of antibody production is provided by a pool of long-lived plasma cells and memory B-cells that can last a lifetime [35]. Several time scales may be identified, of which the longest-lasting can have half-lifes in the order of many years, and thus beyond scope of the current study [36]. It will be interesting to continue following the decline of anti-RBD IgG in time and investigate whether the longevity of the antibody response is similar to other coronaviruses, such as SARS-CoV that can still be detected in most individuals 3-years after recovery [37]. The antibody titer required for protection against re-infection in humans is not yet known, and has to be evaluated also in the context of a recall response upon re-infection. Recent studies provide evidence that upon infection, individuals develop SARS-CoV-2 specific memory B and memory T cells that can be detected for up to 240 days, with numbers of IgG memory B cells increasing over time and plateauing after ca. 150 days [20, 38]. The relationship between long-lasting antibody production and the T and B cell memory compartments requires more investigation. We also quantitatively examined the IgG1 and IgG3 subclass response and found that in our study population IgG1 appeared to be by far the dominant IgG subtype. This i...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.13.426436: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals received free access to food and water and were handled according to the approved protocols of the Animal Committee of Osaka University (Suita, Osaka, Japan) as No.28-021-028, the Ethics Committee for Animal Experiments of the Safety Research Institute for Chemical Compounds Co. Ltd. (Sapporo, Hokkaido, Japan) as No. AN20200617-03 and the Animal Committee of KAC Co. Ltd. (Kusatsu, Shiga, Japan) as No. 20–0508.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: The rat study was performed using 7-week-old male Crl:CD (SD) rats (Charles River Laboratories Japan Inc., Kanagawa, Japan).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All wells were washed with PBST (200 μl/well) seven times, and incubated with 1:1000 diluted Amersham ECL anti-rat IgG horseradish peroxidase-linked species-specific whole antibody (NA935, GE Healthcare UK Limited, UK) or Amersham ECL anti-mouse IgG horseradish peroxidase-linked species-specific whole antibody (NA931, GE Healthcare UK Limited, UK) in the blocking buffer for 3 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat IgG</div><div>suggested: (GE Healthcare Cat# NA935, RRID:AB_772207)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (GE Healthcare Cat# NA931, RRID:AB_772210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After serum incubation, the serum samples were removed and IgG subtypes were detected using the following HRP-conjugated antibodies for 3 h at room temperature; anti-IgG1 H&L (ab106753; Abcam), anti-IgG2a H&L (ab106783; Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG1</div><div>suggested: (Abcam Cat# ab106753, RRID:AB_10859102)</div></div><div style="margin-bottom:8px"><div>anti-IgG2a</div><div>suggested: (Abcam Cat# ab106783, RRID:AB_10866498)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 binding inhibition assay: To analyze the binding inhibition of S1+S2 and ACE2 by neutralizing antibodies in the immunized rat and mouse serum, 96-well plates were coated with human ACE2 recombinant protein (1μg/ml, mFc tag; #83986, Cell Signaling Technology), and then blocked using PBS containing 5% skim milk for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed with PBST and then incubated with anti-His antibody conjugated with HRP (GTX21187, GeneTex, Inc., Irvine, CA) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sixteen weeks after the first administration, sera were collected from immunized mice and tested for antibody induction against 2019-nCoV spike protein (S1+S2) and the RBD region of the spike protein, as well as for the inhibition of binding to the recombinant hACE2 protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>2019-nCoV spike protein (S1+S2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells stably expressing TMPRSS2 were seeded on 96-well plates and incubated at 37 °C for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The homogenate solution was serially diluted 10 folds in DMEM containing 2% FBS and loaded on VeroE6/TMPRSS2 cells to determine the value.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mouse study was performed using 8-10 weeks old C57BL/6NCrSlc mice (C57BL/6N) (Japan SLC,Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6NCrSlc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6N</div><div>suggested: RRID:MGI:5651595)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: Precisely 1 μg/ml of recombinant 2019-nCoV spike protein (S1+S2) (ECD, His tag) (BLPSN-0986P, BETA Life Sciences, Fairfield, NJ, USA) was immobilized on a 96-well plate (442404, MAXISORP F96 NUNC Immuno-plate, Thermo Fisher Scientific, Roskilde, Denmark) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BETA</div><div>suggested: (BETA, RRID:SCR_007556)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage inhibition of immunized blood serum at various time points was calculated and plotted using GraphPad Prism software, from which the neutralization titer at ID75 was derived.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.07.425806: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Yeast scFv display levels were evaluated prior to sorting (data not shown) by incubating the yeast with a 1:1000 dilution of Chicken anti C-MYC Epitope Tag Primary Antibody from Exalpha Biologicals Inc. (Catalog No. ACMYC), followed by incubation with a 1:1000 dilution of Goat anti-Chicken IgY (H+L) Cross Adsorbed Secondary Antibody, Alexa Fluor Plus 647 from Thermo Fisher Scientific (Catalog No. A32933) RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti C-MYC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Chicken IgY</div><div>suggested: (Thermo Fisher Scientific Cat# A32933, RRID:AB_2762845)</div></div><div style="margin-bottom:8px"><div>anti-His FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a baseline step in assay buffer, RBD-coated biosensors were dipped in a 300 nM solution of ACE2 or assay buffer for 5 min before being dipped in a 100 nM solution of a given antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant protein expression and purification: IgGs, ACE2-huFc-Avi, and coronavirus RBDs were expressed and purified from Expi293F cells cultured in 33% Expi293 Expression / 66% FreeStyle Expression medium (Thermo Fisher Scientific) and grown in baffled polycarbonate shaking flasks (Triforest) at 37 °C and 8% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 6 x 106 HEK293T cells cultured in D10 medium (DMEM, 10% fetal bovine serum (Gemini Bio-Products), 2 mM L-glutamine, 1% penicillin/streptomycin, and 10 mM HEPES [pH 7.0]) were transfected at ~50-70% confluency using calcium phosphate transfection20 with 5 lentiviral production plasmids: pHAGE_Luc packaging vector (10 μg), full-length SARS-CoV-2 spike (3.4 μg), HDM-Hgpm2 (2.2 μg), PRC-CMV-Rev1b (2.2 μg), and HDM-tat1b (2.2 μg)30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells overexpressing ACE219 were plated at 5,000 cells per well in clear-bottom white-walled 96-well plates 1 day prior to infection in D10 medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medium was removed from HeLa/ACE2 cells and replaced with virus/inhibitor mixtures which were then incubated for 48 h at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa/ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding curves were fit using the “association then dissociation” equation in GraphPad Prism 8.4.1 to calculate KD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.09.426032: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: For use of patient serum ethical approval was granted by the Ethics Committee at the Medical Faculty of LMU Munich (vote 20-225 KB) in accordance with the guidelines of the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Vaccination experiments in mice: Female BALB/c mice (6 to 10 week-old) were purchased from Charles River Laboratories (Sulzfeld, Germany).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blots were blocked in a phosphate buffered saline (PBS) buffer containing 5% Bovine Serum Albumin (BSA) (Sigma-Aldrich, Taufkirchen, Germany) and 0.1% Tween-20 (Sigma-Aldrich, Taufkirchen, Germany) and incubated for 60 min with primary antibody, monoclonal anti-HAtag antibody (1:8000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) or COVID-19 patient serum (1:200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HAtag</div><div>suggested: (InvivoGen Cat# ab-hatag, RRID:AB_391833)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Permeabilized cells were probed with a monoclonal antibody against the HA-tag epitope (1:1000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) to detect SARS-2-S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-tag epitope</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-permeabilized cells were stained with a mouse monoclonal antibody obtained against the S protein of SARS-CoV-1 (SARS-1-S; 1:200; GeneTex) before fixation with PFA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-1-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polyclonal goat anti-mouse secondary antibody (1:1000; Life Technologies, Darmstadt, Germany) was used to visualize S-specific staining by red fluorescence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surrogate virus neutralization assay (sVNT): To test for the presence of neutralizing anti-SARS-CoV-2-S serum antibodies we used surrogate virus neutralization test as described before with slight modifications (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were extensively washed with phosphate-buffered saline/0.05% Tween-20 (PBST), followed by incubation for 1h at 37°C with an HRP-conjugated anti-His-tag antibody (1.2 μg/ml; clone HIS 3D5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (MBL International Cat# M136-3, RRID:AB_11125943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To remove background effects, the mean percentage of inhibition from non-specific mouse serum (Invitrogen) was deducted from sample values and neutralizing anti-SARS-CoV2-S antibodies titres were determined as serum dilution that still had binding reduction > mean + 2 SD of values from sera of vehicle-treated mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, we fixed the cells with 4% formaldehyde/phosphate-buffered saline (PBS) and stained the cells with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological, https://www.sinobiological.com) and a secondary peroxidase-labeled goat anti-rabbit IgG (Dako, https://www.agilent.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human A549 cells (ATCC® CCL-185™) (LGC standards) were maintained in DMEM with high glucose and 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The replicative capacity of recombinant MVA was tested in multi-step-growth experiments on monolayers of DF-1, HaCat, HeLa or A549 cells grown in 6-well-tissue-culture plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HaCat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blot analysis of recombinant protein: To monitor production of the recombinant SARS-2-S protein, DF-1 cells were infected at MOI 10 with recombinant or non-recombinant MVA or remained uninfected (mock).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DF-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining of recombinant SARS-2-S protein: Vero cells were infected with 0.05 MOI MVA-SARS-2-S or non-recombinant MVA and incubated at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then added 50 μL of virus suspension (400 plaque-forming units) to each well and incubated at 37°C for 1 h before placing the mixtures on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytopathic effects (CPE) on VeroE6 cells (ATCC CRL1586) were analyzed 4 days after infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination experiments in mice: Female BALB/c mice (6 to 10 week-old) were purchased from Charles River Laboratories (Sulzfeld, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, we fixed the cells with 4% formaldehyde/phosphate-buffered saline (PBS) and stained the cells with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological, https://www.sinobiological.com) and a secondary peroxidase-labeled goat anti-rabbit IgG (Dako, https://www.agilent.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.sinobiological.com</div><div>suggested: (Sino Biological, RRID:SCR_003697)</div></div><div style="margin-bottom:8px"><div>https://www.agilent.com</div><div>suggested: (Agilent Technologies, RRID:SCR_013575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, cells were permeabilized using Intracellular Staining Permeabilization Wash Buffer (Perm Wash buffer; Biolegend; dilution 1:10), and stained intracellularly in 100 μl/well of anti-mouse IFN-γ (clone XMG1.2, 1:200, Biolegend) plus anti-mouse TNF-α (clone MP6-XT22, 1:200, Biolegend) diluted in Perm Wash buffer for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biolegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each antibody, single colour controls were prepared using OneComp eBeads™ Compensation Beads (eBioscience, Thermo Fisher Scientific) and cells for the viability dye Zombie Aqua.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneComp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was acquired by the MACSQuant VYB Flow Analyser (Miltenyi Biotec) and analyzed using FlowJo (FlowJo LLC, BD Life Sciences, Ashland, OR, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were prepared using GraphPad Prism version 5 (GraphPad Software Inc., San Diego CA, USA) and expressed as mean ± standard error of the mean (SEM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.04.20248897: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Approval: This study was approved by the Ethics Committees of Centro Hospitalar e Universitário de Coimbra (CHUC-084-20).<br>Consent: Participants signed an informed consent form, according to the Helsinki principles, the Oviedo Convention and according to the General Data Protection Regulation – Regulation (EU) 2016/679.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The investigators were blinded to sample allocation during experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Among the negative subjects, the median cohort age was 37.5 years (21-60 years), 9/19 (47%) were male, and 10/19 (53%) were female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a washing step, 100 μL anti-human IgG antibody conjugated with horseradish peroxidase (Sigma-Aldrich) diluted at 1:5000 was added and the plates were incubated at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>100 μL anti-human IgG antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleocapsid-His recombinant Protein (YP_009724397.2(335Gly/Ala)) (Met1-Ala419) expressed in Baculovirus-Insect Cells with a polyhistidine tag at the C-terminus (Reference 40588-V08B); Spike protein S1 Subunit (YP_009724390.1) (Val16-Arg685) expressed in HEK293 Cells with a polyhistidine tag at the C-terminus (Reference 40591-V08H); Spike protein Receptor Binding Domain (RBD) (YP_009724390.1) (Arg319-Phe541) expressed in HEK293 Cells with a polyhistidine tag at the C-terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative SARS-CoV-2 group (n=19) included subjects with a negative qRT-PCR performed following risk-contact tracking and monitored by IgG serology (Alinity i, Abbott).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired in a LSRFortessa™ flow cytometer (BD Biosciences CA, USA) using the FACSDiva™ software v8.0 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsoft Excel v.14.1.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.13.426537: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) anti-mouse antibody was used to recognize VHH (4A12E6: Invitrogen Rockford, USA) followed by probing with anti-mouse IgG raised in goat (A3562: 1ml Sigma, USA) and conjugated with alkaline phosphatase for the development of the blot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Sigma-Aldrich Cat# A3562, RRID:AB_258091)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blocked PVDF membrane was probed with the sdAb (having both 6x(HIS)-tag and biotin-tag) and then monoclonal anti-6x(HIS)-tag antibody was probed followed by detection with anti-mouse IgG conjugated with alkaline phosphatase (A3562: 1ml Sigma, USA) was used for developing the blots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x(HIS)-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since the spike construct contains the Flag tag, immunoblotting was performed to detect the presence of spike protein in supernatant collected 24 hours post transduction as well as in cell lysate of 72 hours post transduced Vero E6 cells using anti-flag mouse antibody (F1804-50UG, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A secondary antibody anti-mouse IgG raised in goat and conjugated with alkaline phosphatase was used for the development of the blot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of sdAb, anti-6x(HIS) antibody was incubated for 1 hr at RT followed by washing and incubation with anti-mouse antibody conjugated with alkaline phosphatase for 1.5 hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x(HIS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biolayer interferometry (BLI): BLI was performed to determine the binding kinetics of anti-CS and anti-RBD antibody with the purified spike protein produced from transfected HEK293T cells (S construct with 3x FLAG-tag) using BLltz System.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Different concentrations of S protein were incubated for 5 minutes to measure the binding affinity with the immobilised anti-CS and anti-RBD antibodies, and their dissociation kinetics was measured in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TG1 cells were then infected with helper phage M13K07 under static conditions at 30°C for 40 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Above mixture was kept at RT for 15 minutes and co-transfected in HEK239T cells (Human Embryonic Kidney).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK239T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modified Vero cells (Vero E6) originated from kidney epithelial cells of African green monkey were used for measuring the internalization using concentrated pseudoviruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells infected with bald particles or the LV (VSV-G) pseudovirus particles served as a control for such experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: After 72 hrs of transduction, Vero-E6 cells were treated with 1mM PBS-EDTA for 15 minutes at 37°C in CO2 incubator and the cells were removed from 96 well (flat bottom) plates by reverse pipetting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biolayer interferometry (BLI): BLI was performed to determine the binding kinetics of anti-CS and anti-RBD antibody with the purified spike protein produced from transfected HEK293T cells (S construct with 3x FLAG-tag) using BLltz System.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prediction of B cell epitopes: Linear B cell epitopes were predicted by IEDB database using BepiPred 2.0 server.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BepiPred</div><div>suggested: (BepiPred-2.0, RRID:SCR_018499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The available data was analysed using flowJo X software (TreeStar)44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>flowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis and scaling of all the taken images were done using ImageJ software44</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Scanning electron microscopy: Field Emission Scanning Electron Microscope (FESEM) was used to measure the surface topography of LV(CoV2-S) and LV(VSV-G).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Field Emission Scanning</div><div>suggested: (Hitachi S4700 Field Emission Scanning Electron Microscope, RRID:SCR_020019)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis were done using Graphpad prism 8.0.2(263).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.13.21249429: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from the patient, or next of kin if the patient was unable to give consent.<br>IACUC: All animal experiments were approved by the Uppsala Committee of Ethics of Animal Experiments (approved permit 5.8.18-04862-2020), in accordance with the Swedish Animal Protection Act (SFS 1988:534), and were conducted according to guidelines established by the Swedish Board of Agriculture.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All experiments were performed in both female and male mice.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lung lysates were immunoprecipitated with a rabbit anti-mouse thrombomodulin antibody (ab230010, Abcam) attached to protein G conjugated Dynabeads (10004D, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse thrombomodulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were blocked with 5% BSA for 1 h and incubated overnight with mouse anti-6X His tag antibody (27E8, 2366, Cell Signaling).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6X</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing and incubating with anti-mouse HRP conjugated secondary antibody (NA931, Sigma), proteins were visualized using ECL plus detection reagents (GERPN2232, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GERPN2232</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were stripped with Re-Blot Plus Strong solution (2504, Millipore), blocked, and probed with anti-thrombomodulin antibody followed by anti-rabbit HRP conjugated secondary antibody (711-035-152, Jackson Immuno Research).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-thrombomodulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 711-035-152, RRID:AB_10015282)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total thrombomodulin in lung lysates was done as above and correlated to loading control, anti-Gapdh HRP conjugated antibody (ab9482, Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Gapdh HRP</div><div>suggested: (Abcam Cat# ab9482, RRID:AB_307272)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice for other experiment came from in house breeding on a C57BL6/J background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL6/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band density was quantified with ImageJ (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was done in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of our assay is that the measured APC levels were close to the detection limit, hence, possible differences between groups would not be detected. In contrast, a recent study did not find changes in APC in critically ill COVID-19 patients (36). However, reduced levels of APC are found in a majority of patients in sepsis and are associated with increased risk of death (42-45). APC formation may be impaired because of down-regulation or shedding of thrombomodulin induced by inflammatory cytokines (46), and, as we hypothesize herein, by ANGPT2 binding to thrombomodulin. Recent data show that circulating thrombomodulin was elevated in critically ill COVID-19 patients, suggesting shedding of thrombomodulin from the endothelium (15, 36). Furthermore, Goshua et al, reported that soluble thrombomodulin correlates with mortality in critically ill COVID-19 patients (36). In the current study, we noted that injection of ANGPT2 in mice resulted in the loss of thrombomodulin in lung tissue (Fig. 3). Further studies are needed to investigate if this is a direct or indirect effect of ANGPT2. To investigate if ANGPT2 can directly affect coagulation in vivo, we performed several experiments in mice. One simple but highly relevant experiment to evaluate coagulation is tail bleeding time (47). In these experiments, recombinant ANGPT2 and ANGPT1 fragments corresponding to the thrombomodulin and TIE2 binding region were injected before the measurement of tail bleeding time. These ex...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.19.427256: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike S1 antibody (40150-R007), SARS-CoV-2 (2019-nCoV) Spike S1-His Recombinant Protein (40591-V08B1), MERS-CoV Spike/S1 Protein (S1 Subunit, aa 1-725, His Tag) (40069-V08H) were purchased from Sino Biological (China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>40069-V08H</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 5 and 7. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.19.427324: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase (HRP) (Southern Biotech, cat. 2040-05, lot B3919-XD29, 1:5,000 dilution) and a 3,3′,5,5′-tetramethylbenzidine (TMB) substrate (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were incubated sequentially with 1 μg/mL of rCR3022 anti-S antibody or an murine anti-SARS-COV-2 mAb, SARS2-16 (hybridoma supernatant diluted 1:6,000 to a final concentration of ∼20 ng/mL) and then HRP-conjugated goat anti-human IgG (Sigma-Aldrich, A6029) in PBS supplemented with 0.1% (w/v) saponin (Sigma) and 0.1% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant human ACE2 with a C-terminal Flag tag peptide was added to wells at 2 μg/mL in a 5 μL per well volume (final 0.4 μg/mL concentration of human ACE2) without washing of antibody and then incubated for 40 min at ambient temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and bound human ACE2 was detected using HRP-conjugated anti-Flag antibody (Sigma-Aldrich, cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To verify escape from antibody selection, isolated viruses were assessed in a subsequent RTCA experiment in the presence of 10 μg/mL (COV2-2676) and 100 µg/mL (COV2-2489) of mAb as used for the escape virus selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2-2676</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero-E6 cells in 50 μL of cell culture medium was seeded in each well, and the plate was placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate wells containing virus only (maximal CPE in the absence of mAb) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was added to pre-chilled Vero or Vero+ACE2+TMPRSS2 cells at an MOI of 0.005 and incubated at 4°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero+ACE2+TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding cDNA for each spike protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero E6 cells in 50 μL of cell culture medium was seeded per each well, and plates were placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then analyzed by Eve Technologies Corporation (Calgary, AB, Canada).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values for binding were determined using Prism v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50 μL of cell culture medium (DMEM supplemented with 2% FBS) was added to each well of a 96-well E-plate using a ViaFlo384 liquid handler (Integra Biosciences) to obtain background reading.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integra Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed using the cryoSPARC software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed twice and fixed with 4% PFA prior to detection of fluorescence signal by flow cytometry (MacsQuant) and analysis using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific primers and probe were used: Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACTGCCGCCTCTGCTC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of mouse studies, the comparison of weight-change curves was performed using a one-way ANOVA with Dunnett’s post hoc test using Prism v.9.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.01.15.426463: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polyclonal rabbit anti-S1 antibody (Sinobiological, Cat: 40592-T62) and anti-S2 antibody (Abcam, Cat: ab272504) were used as primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed 3 × with PBS-BSA-0.5% then incubated for 1h at RT with secondary antibodies conjugated with Alexafluor488 diluted at 1:1000 in PBS-BSA 0.5% (for ChAdOx1 nCov-19 serum staining Goat Anti mouse AlexaFluor 488 (Life Tech A11029)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11029, RRID:AB_2534088)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolation of human monoclonal antibodies from peripheral B cells by spike-specific single B cells sorting: To isolate Spike-specific B cells, PBMCs were labelled with recombinant trimeric spike-twin-Strep and stained with antibody cocktail consisting of CD3-FITC, CD14-FITC, CD56-FITC, CD16-FITC, IgM-FITC, IgA-FITC, IgD-FITC, IgG-BV786, CD19-BUV395 and Strep-MAB-DY549 (iba) to probe the Strep tag of spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG-BV786</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19-BUV395</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot analysis: Protein pellets from the HEK293F cell lysates were loaded onto an SDS-PAGE gel, then transferred to a PVDF membrane.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FACS analysis for cell surface spike expression: Hela S3 cells at 4 ×105 cell/ml were infected with 10 MOI ChAdOx1 nCoV-19 and incubated at 37°C for 40-48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela S3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding heavy and light chains were then co-transfected into the 293T cell line by the polyethylenimine method (408727; Sigma), and antibody were harvested for further study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.6×105 of U2OS or HeLa cells resuspended in 2 ml of DMEM 10% FBS, Pen/Strep were seeded on top of the grids in, in 6 well plate wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo v9 (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tilt series were acquired using SerialEM (44) at a pixel size of 2.13 Å.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were subsequently gain normalised during motion correction and Fourier cropped back to physical pixel size with MotionCor2 (46).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A representative glycoform presented at each site was modelled on to the N-linked carbohydrate attachment sites in Coot (50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometry raw files have been deposited in the MassIVE proteomics database (DOI: XXX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassIVE</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.21.053017: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis was performed on 8% SDS-PAGE and PA antibody GTX125932 (GeneTex) FluPol in vitro activity assays: The subunits of the A/WSN/33 (H1N1) influenza virus FluPol with a Tandem Affinity Purification (TAP)-tag at the C-terminus of PB2 (pcDNA3-PB1, pcDNA3-PB2-TAP, pcDNA3-PA) were expressed in HEK 293T cells and purified as heterotrimeric complex using IgG sepharose chromatography as described previously(29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PA</div><div>suggested: (GeneTex Cat# GTX125932, RRID:AB_11175740)</div></div><div style="margin-bottom:8px"><div>H1N1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-PB1 , pcDNA3-PB2-TAP , pcDNA3-PA </div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-PB2-TAP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays were performed on MDCK cells in MEM containing 0.5% FCS with a 1% agarose overlay and grown for 2 days at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis was performed on 8% SDS-PAGE and PA antibody GTX125932 (GeneTex) FluPol in vitro activity assays: The subunits of the A/WSN/33 (H1N1) influenza virus FluPol with a Tandem Affinity Purification (TAP)-tag at the C-terminus of PB2 (pcDNA3-PB1, pcDNA3-PB2-TAP, pcDNA3-PA) were expressed in HEK 293T cells and purified as heterotrimeric complex using IgG sepharose chromatography as described previously(29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FAV00A-treated A549 cell extracts: Approximately 106 A549 cells treated with FAV00A in DMEM containing 10% FCS were lysed through sonication in 40 μl buffer A (10 mM HEPES-NaOH, pH 7.5, 0.1% NP-40, 150 mM NaCl, 5% glycerol, and 1 mM DTT) for 10 seconds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using ImageJ and Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.18.20038059: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation, the cells were fixed and stained with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibodies were detected using peroxidase-labeled rabbit anti– human IgG (Dako, https://www.agilent.com) and TMB as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum Samples: Protein expression: The spike ectodomains of SARS-CoV-2 (residues 1–1,213; strain Wuhan-Hu-1; GenBank: QHD43416.1), SARS-CoV (residues 1–1,182; strain CUHK-W1; GenBank: AAP13567.1) and MERS-CoV (residues 1-1262; strain EMC; GenBank: YP_009047204.1) were expressed in HEK-293T cells with a C-terminal trimerization motif and Strep-tag using the pCAGGS expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Likewise, the SARS-CoV-2 S1 subunit or its subdomains (S;S1, residues 1-682; S1A, residues 1-294; RBD, residues 329-538; GenBank: QHD43416.1) were expressed in 293T cells as described in (Chunyan Wang et al., submitted manuscript;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, the mixtures were added on Vero-E6 cells and incubated at 37°C for 1 more hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PRNT for the German sera was done as described previously using Vero E6 cells (Wölfel et al submitted manuscript, doi:https://doi.org/10.1101/2020.03.05.20030502) (10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibodies were detected using peroxidase-labeled rabbit anti– human IgG (Dako, https://www.agilent.com) and TMB as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.agilent.com</div><div>suggested: (Agilent Technologies, RRID:SCR_013575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The correlations between antibody responses detected by different ELISAs were and those detected by PRNT, as the gold standard for CoV serology, were analyzed using GraphPad Prism version 8 (https://www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.17.302232: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To calculate the technical variance, we normalized the UMI count by converting it to UMIs per million, then randomly chose 400 cells from each fixation method and used the 1,000 most highly expressed non-mitochondrial genes to calculate the mean and squared coefficient of variation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing and blocking the cells in PBS supplemented with 4% BSA, staining was performed with an anti-KSHV K8.1 antibody (sc-65446, Santa Cruz, 1:50 dilution) and an Alexa Fluor 488-conjugated goat-anti-mouse secondary antibody (A10667, Life Technologies, 1:4000 dilution) in PBS/1% BSA supplemented with RNase inhibitor, murine (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-KSHV K8.1</div><div>suggested: (Advanced Biotechnologies Cat# 13-213-100, RRID:AB_1929220)</div></div><div style="margin-bottom:8px"><div>goat-anti-mouse</div><div>suggested: (Electron Microscopy Sciences Cat# 815.022, RRID:AB_2629849)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T (ATCC) cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T.rKSHV.219 cells were generated by infecting HEK293T cells with rKSHV.21924, and selecting with 1 μg/mL puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T.rKSHV.219</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The KSHV-positive human PEL cell line BC3 was cultured in Roswell Park Memorial Institute (RPMI) supplemented with 20% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BC3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of A549 cells: OC43 (ATCC) were grown and titrated on A549 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T.rKSHV219 cells were reverse transfected with 0.8 μg plasmid DNA using Lipofectamine2000 (Life Technologies) following the manufacturer’s instructions and seeded in 12 or 24-well plates for analysis by live-cell imaging or qRT-PCR as indicated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T.rKSHV219</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 3T3 cells (p65−/− 3T3 mouse embryonic fibroblast cells expressing p65-DsRed and H2B-GFP nucleus marker32) were cultured in DMEM supplemented with 10% (v/v) fetal bovine calf serum (HyClone), 1% (v/v) GlutaMAX and 1x P/S. Optimization of RNA extraction condition for fixed and permeabilized cells: BC3 cells were harvested, centrifuged at 300g for 3 min to remove the cell media, and washed once with PBS and 1% BSA (molecular biology grade, Gemini Bio-Products).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p65−/− 3T3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment was performed using STAR aligner (version 2.7.3a) and counted using featureCounts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_015899)</div></div><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read subsampling and read mapping: In the FD-seq and methanol fixation comparison experiment, we used samtools view command34 to subsample the output BAM file from Drop-seq tools version 2.3 DetectBeadSynthesisErrors command.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate the proportion of reads mapped to different genomic regions, we used Picard CollectRnaSeqMetrics command on the output BAM file directly from the STAR aligner.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To find the enriched KEGG pathways, we uploaded the list of genes that were upregulated in TMEM119 overexpression versus GFP overexpression (log2 fold change > 1, FDR < 0.05) to g:Profiler26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA velocity analysis: The output files of Drop-seq tools DetectBeadSynthesisErrors function were processed with the dropEst pipeline40 to tag spliced and unspliced transcripts, and the results were analyzed with Python velocyto package33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dropEst</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data availability: The raw data, metadata and count data are deposited in NBCI’s Gene Expression Omnibus (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.26.20042184: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Serum samples for assay: The protocols were approved by the institutional ethical committee of Beijing You An Hospital, Capital Medical University.<br>Consent: Informed consent was obtained from all the human subjects who participated in the study after the nature and possible consequences of this study had been fully explained and the protocols were approved by the institutional ethical committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293F cells and CHO cells and culture media were provided by Zhenge Biotech.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293F</div><div>suggested: RRID:CVCL_6642)</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: The full length SRARS-CoV-2 S1 gene (GenBank: QIC53204.1) with C terminal were synthesized by GENEWIZ, China, and inserted into mammalian cell expression vectors with either 6* His tag or fused with human IgG Fc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.21.990770: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: This study received approval from the Research Ethics Committee of Shenzhen Third People’s Hospital, China (approval number: 2020-084).<br>Consent: The Research Ethics Committee waived the requirement informed consent before the study started because of the urgent need to collect epidemiological and clinical data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA analysis of plasma and antibody binding to RBD, trimeric Spike, and NP proteins: The recombinant RBDs and trimeric Spike derived from SARS-CoV-2, SARS-CoV and MERS-CoV and the SARS-CoV-2 NP protein (Sino Biological, Beijing) were diluted to final concentrations of 0.5 μg/ml or 2μg/ml, then coated onto 96-well plates and incubated at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 NP protein (Sino Biological, Beijing)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The third staining at 4 °C for 30min involved either: Streptavidin-APC (eBioscience) and/or Streptavidin-PE (BD Biosciences) to target the Strep tag of RBD, or anti-his-APC and anti-his-PE antibodies (Abcam) to target the His tag of RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-101-322, RRID:AB_2800415)</div></div><div style="margin-bottom:8px"><div>anti-his-PE</div><div>suggested: (Miltenyi Biotec Cat# 130-092-691, RRID:AB_1103227)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single B cell PCR, cloning and expression of mAbs: The IgG heavy and light chain variable genes were amplified by nested PCR and cloned into linear expression cassettes or expression vectors to produce full IgG1 antibodies as previously described 29,41.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>full IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR products were purified and cloned into the backbone of antibody expression vectors containing the constant regions of human IgG1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV antibodies (S230 and m396) previously isolated by others 42 were synthesized and sequences verified before expression in 293T cells and purification by protein A chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HIV-1 antibody VRC01 was a broadly neutralizing antibody directly isolated from a patient targeting the CD4 binding site of envelope glycoprotein 40.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4 binding site of envelope glycoprotein 40</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then stained with PE labeled anti-human IgG Fc secondary antibody (Biolegend) at a 1:20 dilution in 50 μl staining buffer at room temperature for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV antibodies (S230 and m396) previously isolated by others 42 were synthesized and sequences verified before expression in 293T cells and purification by protein A chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T cells without transfection were also stained as background control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7 cells (ATCC) (approximately 1.5 × 104 per well) were added in duplicate to the virus-antibody mixture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isolate was amplified in Vero cell lines to make working stocks of the virus (1 × 105 PFU/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To analyze the mAb neutralizing activities, Vero E6 cells were seeded at 104/well in 96-well culture plates and cultured at 37 °C to form a monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genes encoding the heavy and light chains of isolated antibodies were separately cloned into expression vectors containing IgG1 constant regions and the vectors were transiently transfected into HEK293T or 293F cells using polyethylenimine (PEI) (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the cells were re-suspended and analyzed with FACS Calibur instrument (BD Biosciences, USA) and FlowJo 10 software (FlowJo, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentrations (IC50) of the evaluated mAbs were determined by luciferase activity 48h after exposure to virus-antibody mixture using GraphPad Prism 6 (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG heavy and light chain variable genes were aligned using Clustal W in the BioEdit sequence analysis package (https://bioedit.software.informer.com/7.2/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioEdit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analyses were performed by the Maximum Likelihood method using MEGA X (Molecular Evolutionary Genetics Analysis across computing platforms).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.29.20085068: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study Approval and Informed Consent Process: The study was conducted under the ethical principles that have their origins in the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was incubated with the secondary antibody (1:2000 dilution of Goat Anti-Human IgG HRP and Goat Anti-Human IgM HRP and Goat Anti-Human IgA HRP individually) for 15 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant antigens were expressed in HEK293 cell lines using full length cDNA coding for the respective antigens fused with a hexa histidine purification tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      When it comes to serological tests the main limitations that make them suboptimal tools for diagnosing those who are sick is that it takes time for the development of antibodies after infection. Thus, they may produce a false negative result in individuals who are acutely infected. On the other hand, they can be useful to indicate exposure in individuals who are asymptomatic or were symptomatic but PCR negative or were never tested. Nevertheless, it is important to note that the serological testing should not be used as the sole basis for diagnosis of an acute COVID19 infection. Technology developments truly enable testing for multiple antibodies from small volumes of collected blood. The potential convenience and cost savings that it would bring to laboratory testing cannot be understated. Remote sampling such as with DBS cards, along with telemedicine would help providers to order tests not only in pandemic settings but also can be a great enabler in bringing healthcare costs down. Immediate application of such a platform to do multiplex testing would be in the monitoring of exposure to upper respiratory tract infections. A subset of the NP swab positive individuals are being monitored for antibody levels and symptoms at regular intervals from the time they tested positive. Initial results show that the seroconversion from IgM to IgG which is marked by a reduction in IgM titer might be co-related with recovery since it is accompanied by a negative result in the subsequent N...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.20.213249: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Serum Samples: Serum samples for sensitivity analyses were obtained from Great Ormond Street Children’s Hospital NHS Foundation Trust (GOSH) and came from three sources; (i) healthcare workers who tested SARS-CoV-2 RT-PCR positive following signs or symptoms of COVID-19 and who gave written consent for participation in the service evaluation of SARS-CoV-2 serological assays, (ii) staff enrolling in a prospective longitudinal cohort study of SARS-CoV-Serology (COSTARS, IRAS 282713, ClinicalTrials.gov Identifier: NCT04380896) who tested positive in a commercial screening assay for anti-Nucleocapsid IgG (Epitope Diagnostics Inc, San Diego, USA) (iii) a small number of RT-PCR positive sera from hospitalised children (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This serum was calibrated against research reagents NIBSC 20/130 and NIBSC 20/124 distributed by the National Institute for Standards and Biological Control (NIBSC, Potters Bar, UK, https://www.nibsc.org/) for the purpose of development and evaluation of serological assays for the detection of antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation for 2 hours with shaking at 700rpm, the plates were washed three times and detection antibody was added at 2 µg/mL (MSD SULFO-TAG™ Anti-Human IgG Antibody).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using MSD Discovery Workbench and GraphPad Prism version 8.0 (GraphPad, San Diego, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04380896</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Staff Testing of Antibody Responses Study (Co-Stars…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.15.992883: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess antibody competition, either 240CD or CR3022 or a non-specific control antibody CR1-07 was incubated with the SARS-CoV-2 RBD prior to assessment of binding to CR3022 or 240CD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid, and protein was expressed by transient transfection in 293F cells for six days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.15.991844: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100μl of HRP anti-His Tag Antibody (BioLegend, USA) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These two constructs were transfected into HEK293 cells using polyethyleneimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells, at about 70-90% confluence, were co-transfected with 9 ug of the transfer vector (pLv-CMV), 6 ug packaging plasmid (psPAX-lentiviral), and 6 ug envelope plasmid (pCB-spike or pCB-spikeV367F).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">spike-mediated pseudovirus entry assay: To detect S variants mediated viral entry, VERO E6 and Caco2 cells (5×104) grown in 24-well plates were respectively infected with either 20 MOI of S-V367 or S-F367-bearing pseudovirus (1×107</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of S protein sequences from different sources and comparison of ACE2 proteins among different species were performed using MAFFT version 7, with default parameters (https://mafft.cbrc.jp/alignmeloadnt/server/) and Bioedit[33,34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular dynamics simulation was performed using GROMACS 2019 with the following options and parameters: explicit solvent model, system temperature 37°C, OPLS/AA all-atoms force field, and LINCS restraints.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.13.093658: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was detected using mouse anti-S-tag monoclonal antibody (Kyab Biotech Co. Ltd., Wuhan, China), followed by FITC-labelled goat anti-mouse IgG H&L (Abcam, Cambridge Biomedical Campus, Cambridge, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6, HeLa, and HEK 293T/17 cells (ATCC) were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers of all viruses used in this study were determined by plaque assays on Vero E6 cells, as previously described (17).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells were transfected with the same amount of human or R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were built by the maximum likelihood method implemented in RAxML program in CIPRES Science Gateway (https://www.phylo.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.01.278630: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics Statement: Animal studies and related experimental procedures were approved by the University of Melbourne Animal Ethics Committee (#1714193, #1914874).<br>IRB: Human clinical study protocols were approved by the University of Melbourne Human Research Ethics Committee (#2056689), and all associated procedures were carried out in accordance with approved guidelines.<br>Consent: All participants provided written informed consent in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eight male macaques (Macaca nemestrina) (6-15 years old) were vaccinated with 100μg of SARS-CoV-2 spike or RBD immunogens formulated with 200μg of Monophosphoryl Lipid A (MPLA) liposomes (Polymun) (Baldrick et al., 2002) intramuscularly in the right quadriceps.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolated cells were stained with Aqua viability dye (Thermofisher) and Fc-blocked with a CD16/32 antibody (93; Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then surface stained with S/RBD probes and the following antibodies: B220 BUV737 (RA3-6B2), IgD BUV395 (11-26c.2a), CD45 Cy7APC (30-F11), SA BV786 (BD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45</div><div>suggested: (BD Biosciences Cat# 564225, RRID:AB_2716861)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then surface stained with S/RBD probes and the following antibodies: IgD AF488 (polyclonal; Southern Biotech), IgM BUV395 (G20-127), IgG BV786 (G18-145) (BD), CD14 BV510 (M5E2), CD3 BV510 (OKT3), CD8a BV510 (RPA-T8), CD16 BV510 (3G8), CD10 BV510 (HI10a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD10</div><div>suggested: (BioLegend Cat# 312220, RRID:AB_2563835)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For intracellular transcription factor staining, cells were first stained with Aqua viability dye (Life Technologies), followed by S/RBD probes and surface antibodies: IgD AF488 (polyclonal; Southern Biotech), IgG BV786 (G18-145) (BD), CD14 BV510 (M5E2), CD3 BV510 (OKT3), CD8a BV510 (RPA-T8), CD16 BV510 (3G8), CD10 BV510 (HI10a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OKT3</div><div>suggested: (BD Biosciences Cat# 566779, RRID:AB_2869862)</div></div><div style="margin-bottom:8px"><div>CD8a</div><div>suggested: (Meridian Life Science Cat# MAL10-078, RRID:AB_1070001)</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric detection of ex vivo and antigen-specific TFH: For ex vivo TFH quantification from mice, freshly isolated LN single cell suspensions were stained with the following antibodies: Live/dead Red (Life Technologies), CD3 BV510 (145-2C11; Biolegend), PD-1 BV786 (29F.1A12; Biolegend), CXCR5 BV421 (L138D7; Biolegend), CD4 BUV737 (RM4-5; BD), B220 BV605 (RA3-6B2; BD), and F4/80 PE-Dazzle 594 (T45-2342; BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific TFH</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PD-1 BV786</div><div>suggested: (BD Biosciences Cat# 563789, RRID:AB_2738425)</div></div><div style="margin-bottom:8px"><div>B220</div><div>suggested: (BD Biosciences Cat# 563708, RRID:AB_2738383)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-human primate LN suspensions and PBMC were stained with the same protocol, using the following antibodies: Live/dead Aqua (Life Technologies), CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7; Biolegend), CXCR5 PE (MU5UBEE; ThermoFisher), CD4 BV605 (L200; BD), CD20 BV510 (2H7; BD), CD8 BV650 (RPA-T8; Biolegend), CD95 BUV737 (DX2; BD), ICOS PerCP-Cy5.5 (C398.4A; Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: (BD Biosciences Cat# 563105, RRID:AB_2738008)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (Leinco Technologies Cat# C666, RRID:AB_2829809)</div></div><div style="margin-bottom:8px"><div>CD95</div><div>suggested: (BD Biosciences Cat# 564710, RRID:AB_2738907)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NHP cells were stained with the following antibodies: CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7; Biolegend), CXCR5 PE (MU5UBEE; ThermoFisher), CD4 BV605 (L200; BD), CD20 BV510 (2H7; BD), CD8 BV650 (RPA-T8; Biolegend), CD95 BUV737 (DX2; BD), CCR6 BV785 (G034E3; Biolegend), CXCR3 Pe-Dazzle594 (G02H57; Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BioLegend Cat# 302356, RRID:AB_2566316)</div></div><div style="margin-bottom:8px"><div>CCR6</div><div>suggested: (BioLegend Cat# 353422, RRID:AB_2563660)</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed prior to incubation with HRP-conjugated secondary antibodies for mouse (1:10000; anti-mouse IgG; KPL), macaque (1:10000; anti-macaque IgG; Rockland) or human (1:20000; anti-human IgG; Sigma) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG; KPL</div><div>suggested: (SeraCare KPL Cat# 5450-0011, RRID:AB_2687537)</div></div><div style="margin-bottom:8px"><div>anti-macaque IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-RBD inhibition ELISA: An ELISA to measure the ability of plasma antibodies to block interaction between recombinant human ACE2 (kindly provided by Merlin Thomas) and SARS-CoV-2 RBD was performed as previously described (Juno et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-75453, RRID:AB_2719181)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the ectodomain of SARS-CoV-2 (isolate WHU1; residues 1 – 1208) with furin cleavage site removed and P986/987 stabilisation mutations36, a C-terminal T4 trimerisation domain, Avitag and His-tag, was expressed in Expi293 cells and purified by Ni-NTA size-exclusion chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">%Inhibition was plotted against plasma dilutions and the area under curve (AUC) was calculated using Graphpad Prism. Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/2020 (Caly et al., 2020) was passaged in Vero cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 or BALB/c mice were anesthetised by isoflurane inhalation prior to intramuscular injection of 50 μL vaccine in each hind quadriceps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B cell receptor sequencing and analysis: B cell receptor sequences were recovered from GC B cells (B220+IgD-GL7+) in the draining iliac lymph node of C57BL/6 mice (n=3) 14 days after a single immunisation with S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">%Inhibition was plotted against plasma dilutions and the area under curve (AUC) was calculated using Graphpad Prism. Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/2020 (Caly et al., 2020) was passaged in Vero cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Prism (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data was analysed in FlowJo v9 or v10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.19.104117: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The overall study was reviewed and approved by the SHAPHC Ethics Committee (approval no.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescently labeled S1 bait was previously prepared by incubating 5 μg of His tag-S1 protein with Anti His tag antibody-PE for at least 1 hr at 4 °C in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti His tag antibody-PE for at least 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR products were then purified using DNA FragSelect XP Magnetic Beads (SMART-Lifesciences) and cloned into human IgG1, lambda or kappa expression plasmids for antibody expression by seamless cloning method (see below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated anti-human IgG Fab antibody (Sigma) was added at the dilution of 1:10,000 in PBST containing 3% BSA (Sangon Biotech) and incubated at 37 C for 0.5 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated anti-human IgG Fab antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 10 thousand cells in 100 μl were incubated with indicated antibodies for 30 min at room temperature, after twice washes then PE-labeled goat anti-human IgG-Fc antibody was added (1:5,000; Abcam) for 30 min, followed by flow cytometry analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Figure S3, to test S protein expression on cell membrane, recombinant ACE2-Cter-6XHis labeled by rabbit anti-His-PE antibody in 1.2:1 (n:n) ratio was added to 10 thousand cells expressing S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-PE</div><div>suggested: (Miltenyi Biotec Cat# 130-092-691, RRID:AB_1103227)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and Viruses: Vero E6, A549-Spike (A549 expressing SARS-CoV-2 S protein), and A549-ACE2 (A549 expressing human ACE2) cell lines were supplied by Shanghai Public Health Clinical Center, Fudan University</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293E cells were transfected using polyethylenimine (PEI, Sigma), after 4-5 days of cell culture, antibodies purification was processed from supernatants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293E</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry assays: For Figure 4, flow cytometry analyses were performed to detect the binding abilities of antibodies to Spike protein in HEK293T cells freshly expressing of SARS-CoV-2, SARS-CoV and MERS-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudovirus were generated by co-transfection of 293T cells with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were analyzed using IMGT/ V-QUEST (http://www.imgt.org/IMGT_vquest) and IgBlast (IgBLAST, http://www.ncbi.nlm.nih.gov/igblast).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of human monoclonal antibodies: The antibody VH/VL and constant region genes were then amplified and cloned into expression vector pcDNA3.4 using SMART Assembly Cloning Kit (SMART-Lifesciences), subsequently antibodies plasmids were amplified in competent cells (SMART-Lifesciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SMART</div><div>suggested: (SMART, RRID:SCR_005026)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The curves and EC50 were analyzed by GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 28 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.25.006569: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ModelTest-NG [6] was used to select the best-fit evolutionary model of nucleotide substitution, that is, GTR + G + I.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ModelTest-NG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The complete coding genomic sequences of 30 coronaviruses were downloaded from the National Center for Biotechnological Information (NCBI) (available at https://www.ncbi.nlm.nih.gov/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/</div><div>suggested: (GENSAT at NCBI - Gene Expression Nervous System Atlas, RRID:SCR_003923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate these values we use an in-house Python script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this case, the three stop codons (TAA, TAG, or TGA) and the three codons for isoleucine (ATT, ATC, and ATA) were excluded in calculation of GC3, and two single codons for methionine (ATG) and tryptophan (TGG) were excluded in all three (GC1, GC2, GC3) (Sueoka 1988).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein sequences were aligned using Biopython.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting multiple sequence alignment was used to build a phylogenetic tree by employing a maximum-likelihood (ML) method implemented in the software package MEGA version 10. 1 [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.11.147363: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Samples analyzed in this study received ethical clearance for immunological evaluation and/or inclusion as controls in immunoassays, and the protocols and informed consent forms were approved by the Institutional Review Board (IRB) at HCB (Refs.<br>IRB: Samples analyzed in this study received ethical clearance for immunological evaluation and/or inclusion as controls in immunoassays, and the protocols and informed consent forms were approved by the Institutional Review Board (IRB) at HCB (Refs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-coupled beads were validated by incubating them with serial dilutions of anti-histidine-Biotin antibody for antigens with a histidine-tag (Abcam, ab27025).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-histidine-Biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the first option, 100 µL of biotinylated secondary antibody diluted in PBS-BN (anti-human IgG, B1140,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Sigma-Aldrich Cat# B1140, RRID:AB_258513)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Seropositivity threshold (cutoff) for optimization tests was calculated as 10 to the mean plus 3 standard deviations of log10-transformed MFIs of the negative controls for each antibody isotype and antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen.</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.16.099317: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot: Western blot was performed either using an anti-strep tag antibody or anti-SARA-COV-2 S antibody following a protocol described previously50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARA-COV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked with 5% skimmed milk in PBS for 1 hour and incubated either with anti-strep tag antibody (IBA Lifesciences) or anti-SARS-COV-2 polyclone antibody (Sino Biological Inc.) for another hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-strep tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alkaline phosphatase conjugated anti-Rabbit IgG (1:5000) (Sigma) was used as a secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Varying amount of the full-length SARS-CoV2 S protein expression construct (0.1-10 µg) and the α fragment of β-galactosidase construct (10 µg), or the full-length ACE2 expression construct (10 µg) together with the ω fragment of β-galactosidase construct (10 µg), were mixed with DMEM medium (Gibco) containing PEI (80 µg) and added to HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated data collection was carried out using SerialEM version65 at a magnification of 105,000× and the K3 detector in counting mode (pixel size, 0.825 Å) at a dose rate of ∼1.1 electrons per physical pixels per second.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the S1 fragment data set, CrYOLO53 was used for particle picking, RELION 3.0.8 was used for 2D classification, 3D classification and refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural biology applications used in this project were compiled and configured by SBGrid56 Model building: The initial templates for model building used the stabilized SARS-CoV-2 S ectodomain trimer structure (PDB ID 6vxx) for the prefusion conformation, and a homology model, calculated by I-TASSER, of S2 postfusion trimer structure from mouse hepatitis virus (MHV) (PDB ID: 6b3o) for the postfusion confirmation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>I-TASSER</div><div>suggested: (I-TASSER, RRID:SCR_014627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several rounds of manual building were performed in Coot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 26 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.24.169334: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: K18-hACE2 mouse experiments: Mouse experiments are approved by the QIMR Berghofer MRI Biosafety Committee and Animal Ethics Committee (project P3600), and are conducted in accordance with the “Australian Code for the care and use of animals for scientific purposes” as defined by the National Health and Medical Research Council of Australia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pixatimod was randomly placed in the box.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female 6-8 week old K18 hACE2 mice (n=4 per group) were treated once with 16 mg/kg of pixatimod in 200 µl saline i.p. on the day before infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of His-tagged S1-RBD was detected with Alexa Fluor 488 anti-his tag antibody (clone J095G46, Biolegend, UK) 1:5000 in 25 μL PBST + 0.1% BSA per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 100 mL of HEK293-6E cells were seeded at a cell density of 0.5 × 106 cells/ml 24hr before transfection with polyethyleneimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-6E</div><div>suggested: RRID:CVCL_HF20)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-compound mixture was transferred onto the wells of a washed 24-well plate that had been seeded with Vero E6 cells [ECACC 85020206] the previous day at 1.5 × 105 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A cytopathic effect assay was performed with the SARS-CoV-2 DE-Gbg20 isolate and Vero cells (ATCC) plated at 2 × 104 per well in 96-well plates the day prior to the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_ZW93)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCi-NS1.1 cells were grown at an Air Liquid Interface (ALI) in PneumaCult-ALI Basal Medium supplemented with Pneumacult ALI supplement hydrocortisone, PneumaCult ALI maintenance supplement, heparin, nystatin and penicillin–streptomycin (all from Stemcell Technologies) at 37°C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BCi-NS1.1</div><div>suggested: RRID:CVCL_T029)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Age and gender matched C57BL/6J mice (n=4) were included as a drug toxicity control and received 16 mg/kg of pixatimod in 200 µl saline i.p., but were not infected with virus. hCoV-19/Australia/QLD02/2020 (QLD02) (GISAID Accession ID; EPI_ISL_407896) virus was used to inoculate K18 hACE2 mice (n=4 per group) intranasally with 104 CCID50 of virus in 50 μl medium while under light anaesthesia; 3% isoflurane (Piramal Enterprises Ltd., Andhra Pradesh, India) delivered using The Stinger, Rodent Anesthesia System (Advanced Anaesthesia Specialists/Darvall, Gladesville, NSW, Australia).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Collected data were analysed with Spectral Manager II software prior to processing with GraphPad Prism 7, using second order polynomial smoothing through 21 neighbours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tm values were calculated using MatLab softaware (R20018a, MathWorks) and ΔTm values determined from the difference between the Tm of RBD alone or in the presence of heparin or pixatimod.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MatLab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were maintained at 50-75% confluence in DMEM supplemented with 10% foetal bovine serum, 20 mM L-glutamine, 100 U/mL penicillin-G and 100 U/mL streptomycin sulfate (all purchased from Gibco/ThermoFisher, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco/ThermoFisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using analysis of a two-tailed Student’s t test with GraphPad Prism (GraphPad Software) unless otherwise noted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis for the K18-hACE2 mouse work was performed using IBM SPSS Statistics for Windows, Version 19.0 (IBM Corp., Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02042781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Safety and Tolerability of IV Infused PG545 in …</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 28 and 5. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.15.152157: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were performed using sex- and age-matched controls and approved by the Institutional Animal Care and Use Committee of Tulane University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with IgG-HRP-conjugated anti-human antibody, membranes were washed and incubated with SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Production: Pseudoviruses for antibody screening were generated using the following plasmids: S-Tag of SARS (pcDNA3.1(+)-SARS-S), S-Tag of SARS2 (pcDNA3.1(+)-SARS2-S), vesicular stomatitis virus (pcDNA3.1(+)-VSV-G), and the HIV-1 pro-viral vector pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-Tag of SARS (pcDNA3.1(+)-SARS-S), S-Tag of SARS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used purified anti-human IgG Fc antibody (Biolegend) as a capture antibody and anti-Human IgG Fc, Multi-Species SP ads-HRP (SouthrenBiotech) as a detection antibody and the other procedure is same as mentioned above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissues were blocked with 10% normal goat serum (NGS) for 40 minutes, followed by a 60 minute incubation with polyclonal guinea pig anti-SARS-CoV1 antibodies (1:1000) (NR-10361, BEI Resoruces).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coated plates were washed with washing buffer (0.05% Tween 20 in PBS), blocked for 2 h at room temperature with blocking buffer (1% BSA and 0.1% Tween 20 in PBS), and washed before the addition of the supernatants or cell lysates from transfected 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human ACE2 neutralization of SARS-CoV2 by plaque assay: Vero E6 cells were plated in a 6 well plate at 8 × 105 cells per well and incubated overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female wild type C57BL/6J mice 6-10-week-old were used for in vivo studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this study, we utilized the murine model of SARS-CoV2 were C57Bl/6 mice were first inoculated with adenovirus encoding human ACE2 (Vector Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57Bl/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed with GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.02.16.951723: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, transfection reagent Sinofection (Cat: STF02), mammalian expression plasmids of full length S or RBD protein of SARS-CoV-2 (Cat: VG40589-UT, Wuhan/IVDC-HB-01/2019) and SARS-CoV (Cat: VG40150-G-N, CUHK-W1), ACE2 (Cat: HG10108-UT), polyclonal antibodies against SARS-CoV RP01 (Cat: 40150-RP01) and T52 (Cat: 40150-T52) were purchased from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RP01</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T52</div><div>suggested: (Rockland Cat# 600-401-W94, RRID:AB_2614544)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV neutralizing antibodies were generated from mice (M103, M127) or rabbits (R314, R301, R325, R302, R258, R348) immunized with recombinant S1 protein of SARS-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R302</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing away the unbound proteins, cells were incubated withPE labelled anti-his-tag antibody for 20 min and went through flow cytometer for detection of cellular binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 100μL/well of the antibody-PSV mixture was added onto the 293T/ACE2 cell wells and incubated for 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-PSV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both 293T and 293T-ACE2 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production in 293T adherent cells: 6-8 hours before transfection, 293T cells were pre-plate on T75 flask in DMEM+10% FBS at 100,000 cells/cm2. 13μg of Luciferase-expressing HIV-1 lentiviral transfer genome (pWPXL-luc), 13μg of packaging plasmid (PSD) and 13μg of expression plasmid encoding either SARS-CoV-2-S protein (pCMV-whCoV-Spike) or SARS-S protein (pCMV-SARS-Spike) were co-transfected into pre-plated 293T cells using Sinofection transfection reagent according to the procedure recommended by manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 100μL/well of the antibody-PSV mixture was added onto the 293T/ACE2 cell wells and incubated for 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flowjo and Graphpad softwares were used for data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software PyMol was used for preparing structural figures39.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of 111 SARS-CoV RBD sequence, used for the generation of sequence conservation, was collected by BLAST via NCBI website34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.01.971499: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Bioethical Committee of the Medical University of Silesia in Katowice, Poland (approval no: KNW/0022/KB1/17/10 dated 16.02.2010).<br>Consent: Written consent was obtained from all patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A mouse monoclonal anti-TMPRSS2 antibody (clone P5H9-A3; 1:500 dilution; Sigma-Aldrich, Poland), followed by incubation with a horseradish peroxidase-labeled anti-mouse IgG (65 ng/ml; Dako, Denmark) diluted in 5% skimmed milk / TBS-Tween (0.1%).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-101847, RRID:AB_2205599)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A horseradish peroxidase-labeled anti-His tag antibody (1:25000 dilution; Sigma-Aldrich, Poland) diluted in 5% skimmed milk / TBS-Tween (0.1%) was used to detect the His-tagged HmuY proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag antibody</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A horseradish peroxidase-labeled anti-His tag antibody (1:25000 dilution; Sigma-Aldrich, Poland) diluted in 5% skimmed milk / TBS-Tween (0.1%) was used to detect the His-tagged HmuY proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag antibody</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RD cells grown in 90% confluency were infected with HCoV-HKU1 (108 RNA copies per ml) in Dulbecco’s MEM (Thermo Fisher Scientific, Poland</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus production and transduction: 293T cells were seeded on 10 cm2 dishes, cultured for 24 h at 37°C with 5% CO2 and transfected with psPAX, pMD2G and third transfer plasmid (pWPI/KLK13, pLKO.1-TRC/shrnaKLK13 or Lego-G2) using polyethyleneimine (Sigma-Aldrich, Poland). psPAX</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      As CleavEx technique is a convenient surrogate system allowing for precise mapping of the cleavage site, it has some limitations. To ensure the reliability of results, purified full-length HCoV-HKU1 S protein was subjected to the proteolytic cleavage. Also here we observed efficient cleavage of the HCoV-HKU1 S protein by KLK13. While the results presented here show that KLK13 is able to process the HCoV-HKU1 S protein, one may question whether the cleavage is sufficient for HCoV-HKU1 entry. It was previously presented for MERS-CoV that two consecutive enzymatic scissions are required for activation of the S protein. In this scenario, KLK13 would prime the HCoV-HKU1 S at S1-S2 site, enabling scission at S2-S2’ site by the TMPRSS2 or another host protease (38, 40, 93). This may be one of the factors limiting the HCoV-HKU1 replication in RD_KLK13 cells, as only minimal replication is observable. Summarizing, we show that KLK13 is a key determinant of HCoV-HKU1 tropism. This may explain why, since its first identification in 2004, all efforts to culture HCoV-HKU1 in standard cell lines have failed. We believe that this study increases our knowledge of HCoV-HKU1 and may promote the future in-depth investigation of coronaviruses. Considering the increasing number and diversity of coronaviruses, and the proven propensity of coronaviruses to cross the species barrier and cause severe diseases in humans, further research on the role of different proteases in coronaviral infections is ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.28.013920: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Crystals of the His-tag samples grew with rectangular morphology in space group P4122, however if the His-tag was removed the crystals grew in space group P6122 form with hexagonal morphology.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequent rounds of manual building and refinement were performed in Coot (Casanal et al., 2019) and PHENIX (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amax and KD were used as fitting parameters and nonlinear regression was performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.24.20112300: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided verbal and / or written informed consent and provided saliva and blood specimens for analysis.<br>IRB: Participation in these studies was voluntary and the study protocols have been approved by the respective Institutional Review Boards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coupling of antigens to beads was confirmed using antibody against the antigen or against the tag (e.g. anti-His(6) tag antibody), if present (Table 1), followed by a species-specific R-phycoerythrin (PE)-labelled antibody and was considered successful if the median fluorescence intensity (MFI [a.u.]) was >10,000 at 1 μg/mL of antigen-specific antibody (except the BSA-conjugated bead set).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against the antigen or against the tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His(6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the MFI of each bead set was measured on a Bio-Plex® immunoassay instrument (Bio-Rad Laboratories, Hercules, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. First, our collection of saliva and serum samples was predominantly obtained from independent cohorts, and it contained 28 matched saliva and serum samples collected from the same participants at the same time. In future studies, the performance of this assay should be compared between saliva and serum in a large sample of matched saliva and serum samples. Second, all saliva data was cross sectional and we were not able to evaluate the temporal kinetics of saliva SARS-CoV-2 antibody responses using repeated measures within the same individual. Longitudinal analysis would allow us to evaluate the temporal kinetics and magnitude of SARS-CoV-2 IgG, IgA, and IgM responses, resolve synchronous vs. classical isotype responses (IgM followed by IgA followed by IgG) following SARS-CoV-2 infection.42 Additional investigation with convalescent phase saliva and sera are needed to determine the stability of SARS-CoV-2-specific IgG responses. Third, we did not have information on severity of SARS-CoV-2 disease from each participant in this study, and thus were not able to determine the impact of severity of infection on antibody responses.29 Prior studies suggest that antibody responses are slightly elevated among individuals with severe infection.29,30,42 Future analysis should determine how severity of infection, and infectious dose, modifies antibody responses. Fourth, we did not determine receiver operating characteristic (ROC)-optimized MFI cut offs...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.03.074781: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Although values greater than 100% were observed in the experimental binding assay (and are valid)10, the assay is bounded above by an unknown quantity that in our estimation should correspond to the inverse of the ratio of immunoprecipitated ACE2 by the C-terminal tag antibody to the total amount of ACE2 in the sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C-terminal tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average overlap per residue was pulled into Jalview as features from Chimera with the Fetch Chimera attributes function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative results were extracted from figures in Li et al.10 with WebPlotDigitizer 4.240.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebPlotDigitizer</div><div>suggested: (WebPlotDigitizer, RRID:SCR_013996)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We transcribed data for additional mutants from Li et al.10 that were not reported in UniProt.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wild-type and mutant models were downloaded from the server as PyMol sessions and detailed structural comparisons were conducted with PyMol20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enumerating possible ACE2 missense SNPs: The ACE2 gene (ENSG00000130234) was retrieved from Ensembl in Jalview14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biopython was used to process sequence data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses were coded in Python in Jupyter Notebooks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Numpy, Pandas and Scipy were used for data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>Scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matplotlib and Seaborn were used to plot data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04287686</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recombinant Human Angiotensin-converting Enzyme 2 (rhACE2) a…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.14.202028: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were routinely tested for mycoplasma and found negative.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Mouse monoclonal antibodies (mAb): IFITM1 (#60074-1-Ig, Proteintech) 1:250 for FACS, and IF; IFITM2/3 (#66081-1-Ig, Proteintech) 1:250 for FACS, and IF; ACE2 (AC18F) (#AG-20A-0032-C100 – adipogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFITM1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IF</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit polyclonal antibodies: FLAG-Tag DYKDDDDK (D6W5B) (#14793, Cell Signaling) 1:800 for FACS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG-Tag DYKDDDDK</div><div>suggested: (Acris Antibodies GmbH Cat# AP08111PU-N, RRID:AB_1616157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat polyclonal antibodies: ACE2 (AF933 – R&D).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS_Ssd3 702 antibody was used at 0.5 μg/ml for FACS and IF. Human Mab: Anti-SARS-CoV2 monoclonal antibodies 48 and 71 recognize the S1 and S2 domains of the S protein, respectively (Planchais et al, manuscript in preparation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were diluted in WB-buffer (PBS, 1% BSA, 0.05% Tween, 0.01% Na Azide): goat anti-human ACE2 (R&D cat#AF933, 1:2000), mouse anti-human ACE2 (Adipogen AC18F cat #AG-20A0032-C100, 1:1000), rabbit anti-human TMPRSS2 (Atlas antibodies cat# HPA035787, 1:1000), mouse anti-Flag tag (Sigma cat# F1804, 1:1000), rabbit anti-human actin (Sigma cat#A2066, 1:2000), mouse ascite anti-SARS S, (1:1000) (Siu, 2008 #4573).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: (Enzo Life Sciences Cat# ALX-804-715B-C050, RRID:AB_2050611)</div></div><div style="margin-bottom:8px"><div>anti-human TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Flag tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human actin</div><div>suggested: (AMSBIO Cat# MA1000, RRID:AB_10920236)</div></div><div style="margin-bottom:8px"><div>anti-SARS S,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral and Retroviral vectors: For lentiviral production, 293T cells were co-transfected with pLenti6 or pLV derived vectors, packaging plasmid R8-2 and VSV-G plasmid as previously described 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GFP-Split fusion assay: For fusion assays with S-expressing cells, 293T-GFP1-10 and 293T-GFP11 cells (6×104 cells/well cells mixed at a 1:1 ratio) in 96 well plates (μClear, #655090) were transfected in suspension using Lipofectamine2000 (Thermo) with 100 ng of DNA. 10 ng of phCMV-SARS-CoV2-S, 25 ng of pCDNA3.1-hACE2, 25 ng of pCSDest-TMPRSS2 and 40 ng of pQCXIP-Empty or pQCXIP-IFITM-N-FLAG were used and adjusted to 100 ng DNA with pQCXIP-Empty.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-GFP11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For donor cells, 293T-GFP1-10 cells were transfected with 10 ng of phCMV-SARS-CoV2-S, ±10 ng pCSDest-TMPRSS2, ±20 ng pQCXIP-IFITM-N-FLAG and adjusted to 50 ng with pQCXIP-Empty.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-GFP1-10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">U2OS viral mediated cell-cell fusion, video microscopy and immunofluorescence: U2OS-ACE2 GFP1-10 or GFP11 stably expressing TMPRSS2, IFITM1, 2, 3 or control cells were mixed (1:1 ratio) and plated at 8×103 cells per well in a 96 well plate (μClear, #655090), 24 h before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titration of viral stocks was performed on Vero E6, with a limiting dilution technique allowing a calculation of DCP50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: pQCXIP-Empty control plasmid and pQCXIP-IFITM1-N-FLAG, pQCXIP-IFITM2-N-FLAG, pQCXIP-IFITM3-N-FLAG plasmids were described 42. pQCXIP-BSR-GFP11 and pQCXIP-GFP1-10 were from Yutaka Hata 51 (Addgene plasmid #68716; http://n2t.net/addgene:68716; RRID:Addgene_68716 and Addgene plasmid #68715; http://n2t.net/addgene:68715; RRID:Addgene_68715).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68716)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68715)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.1-hACE2 was from Hyeryun Choe 52 (Addgene plasmid # 1786; http://n2t.net/addgene:1786; RRID:Addgene_1786).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_1786)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCSDest-TMPRSS2 was from RogerReeves 53 (Addgene plasmid # 53887; http://n2t.net/addgene:53887; RRID:Addgene_53887).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_53887)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pLenti6-H2B-mCherry was from Torsten Wittmann 54 (Addgene plasmid # 89766; http://n2t.net/addgene:89766; RRID:Addgene_89766).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_89766)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GFP area was quantified on ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were quantified and processed using ImageStudioLite software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageStudioLite</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Flow cytometry data were analyzed with FlowJo v10 software (TriStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were drawn on Prism 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was conducted using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 13, 14, 16, 22, 23 and 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.14.150607: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After obtaining informed consent, serum was obtained by venipuncture (BD Vacutainer, serum), centrifuged, aliquoted and stored at -80°C prior to use.<br>IRB: Protocol approval was obtained by the Institutional Review Board (protocol IRB# 2016-6137) of the Albert Einstein College of Medicine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVID-19 convalescence sera samples (2, 3, 5, 6, 7) were previously validated to be negative with RT-PCR for SARS-CoV-2 and positive ELISA for antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The arrays were rinsed with 5% milk-PBST briefly and incubated for 1 hour at room temperature with a fluorescently labeled secondary antibody (Alexa Fluor 647 labeled goat anti-human IgG (H+L) cross-adsorbed secondary antibody, Thermo Fisher Scientific, Cat # A21445) diluted 1:150 in 5% milk-PBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Molecular Probes Cat# A-21445, RRID:AB_2535862)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with a PE-labeled anti-6x His tag antibody (Abcam Cat # ab72467), to detect Spike protein binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x</div><div>suggested: (Abcam Cat# ab72467, RRID:AB_1267596)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 45 minutes, cells were pelleted and washed twice, and then incubated with an anti-HIS PE antibody, washed twice, and analyzed on a SONY Spectral Analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIS PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of hACE2, mACE2, CD147, CD26, Siglec9, Siglec10, Ceacam1, and Ceacam5 were confirmed by antibody staining of transfected HEK293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD147</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Siglec10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ceacam1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ceacam5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used: hACE2 and mACE2 (RND Cat # AF933-SP), CD147 (Biolegend Clone HIM6), CD26 (Biolegend Clone BA5b), Siglec9 (Biolegend Clone K8), Siglec10 (Biolegend Clone FG6), Ceacam1 and Ceacam5 (Biolegend Clone ASL-32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD26</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Siglec9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293F Transient Transfections and Culture: HEK 293 suspension cells were cultured in HEK Freestyle Media (Invitrogen) at 37 C in a humidified shaking platform incubator (Kuhner) with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-throughput Screening of Human Plasma Membrane Protein Library: The human plasma membrane protein library was transfected into HEK293F cells in 48-well format.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nickel eluates were concentrated by centrifugation in 100K concentrator (ThermoFisher Cat # 88533) by spinning at 1100 g for intervals of 8 minutes (if necessary) and further purified by gel filtration on a HiLoad™ 16/600 Superdex™ 200 column (GE) equilibrated with 50 mM TRIS, 100 mM ArgCl, 150 mM NaCl, 10% Glycerol, pH 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentration was determined using an extinction coefficient (1468500 M-1cm-1) estimated from amino acid sequence by Expasy online ProtParam tool[20]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentration was determined using an extinction coefficient (33350 M-1cm-1), estimated from amino acid sequence by Expasy online ProtParam, and was further analyzed by SDS-PAGE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expasy online ProtParam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting supernatant was purified on an AKTA FPLC (GE Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was exported in Excel, and then analyzed and graphed by GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The program Prism v8 was used to generate the AUC figures shown in the text and supplement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Absorption was measured at OD450 using a Synergy4 plate reader (Biotek), and data was analyzed using GraphPad Prism7.0 to calculate IC50 values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      It is important to note the limitations of the current platform. In particular, we stress that at present this is a qualitative approach, as a number of variables can impact the ability to detect antibody reactivity, including patient titers for specific antigens and the relative affinities of an antigen-specific pool. Furthermore, it should be appreciated that the current platform is programmed to detect the capture of IgG antibodies; thus, the resultant signal (or lack thereof) for a particular antigen could be the consequence of prevalences between different isotypes (IgA, IgD, IgE, IgG, IgM), which are known to evolve during the course of infection and subsequent resolution. Although currently focused on three antigens, this platform can be readily expanded to study differential antibody responses to different SARS-CoV-2 antigens and subdomains of those antigens amongst individuals, which are actively being investigated by others [52-55]. We are currently working to include not only other antigens from SARS-CoV-2 (E protein, M protein, etc.), but also antigens from other coronaviruses that may be cross reactive with SARS-CoV-2 antibodies. The analysis of antibody reactivity to multiple SARS-CoV-2 and related antigens will provide broad insight into the humoral immune response to SARS-CoV-2. Collectively, we provide standards and metrics for high quality protein reagents that can yield comparable clinical, biological and structural data as we continue to combat the global ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.09.141580: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The experiments were carried out using the protocols approved by the Scientific Ethics Committee of Huazhong Agricultural University (permit number: HZAUSW-2018-009).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal immunization: Female BALB/c mice aged 6 weeks were immunized with different proteins at 0 and 3 weeks.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, horseradish peroxidase (HRP)-conjugated goat anti-mouse/rabbit IgG (1:10,000 diluted in PBST with 1% BSA (w/v), Boster) was used as the secondary antibody, and 3,3’,5,5’-tetramethylbenzidine (TMB) (Beyotime) was used as the substrate for detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse/rabbit IgG</div><div>suggested: (Biorbyt Cat# orb27530, RRID:AB_10954533)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the mouse anti-Strep-tag II antibody (SAB, 1:3,000 diluted in PBST with 1% BSA (w/v)) and HRP-conjugated goat anti-mouse IgG (1:5,000 diluted in PBST with 1% BSA (w/v), Boster) was used for detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep-tag II</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three days after the last injection, spleen cells were collected and fused with SP2/0 cells with PEG1450 (Sigma-Aldrich, P7181) to generate hybridoma cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SP2/0</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production and entry assay of pseudoviruses: Pseudo-typed viruses were produced as previously described (50), 293T (ATCC, CRL-3216), Huh-7 and Vero (ATCC, CCL-81) cells were maintained in high glucose DMEM (Gibco, USA) supplemented with 10% FBS (FBS; Natocor, Argentina), penicillin (100 IU/ml) and streptomycin (100 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal immunization: Female BALB/c mice aged 6 weeks were immunized with different proteins at 0 and 3 weeks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, structure-based B-cell epitope prediction was performed by DiscoTope 2.0 with a positive cutoff greater than −3.7 (corresponding to a specificity greater than or equal to 0.75 and a sensitivity less than 0.47) using the following protein structures: the HCoV-229E S-trimer and RBD (PDB IDs: 6U7H and 6ATK, respectively), the SARS-CoV S-trimer and RBD (PDB IDs: 5X5B and 2AJF, respectively), the SARS-CoV-2 S-trimer and RBD (PDB IDs: 6VYB and 6M0J, respectively), the PEDV RBD (PDB ID: 6U7K), the FIPV RBD (PDB ID: 6JX7), the PRCoV RBD (PDB ID: 4F5C), and the transmissible gastroenteritis virus (TGEV) RBD (PDB ID: 4F2M).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DiscoTope</div><div>suggested: (DiscoTope, RRID:SCR_018530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the predicted residues were then labeled in corresponding structures using PyMOL (Schrödinger).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, the amino acid sequences of alpha-CoVs RBDs were aligned using ClustalW2 (52).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW2</div><div>suggested: (ClustalW2, RRID:SCR_002909)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.13.149930: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of S protein, the membrane was incubated with anti-HA tag mouse monoclonal antibody (bimake, USA, 1:2000), and the bound antibodies were detected by Horseradish Peroxidase (HRP)-conjugated goat anti-mouse IgG (Abbkine, China, 1:5,000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of HIV-1 p24 in supernatants, monoclonal antibody against HIV p24 (p24 MAb) was used as the primary antibody at a dilution of 1:8,000, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of 20 ACE2s in HeLa cells, Mouse anti-His tag monoclonal antibody (Bioworld, USA, 1:5000) was used as the first antibody, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and plasmids: HEK293T and HeLa cells were obtained from the American Tissue Culture Collection and cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) in a humidified 5% CO2 incubator at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of 20 ACE2s in HeLa cells, Mouse anti-His tag monoclonal antibody (Bioworld, USA, 1:5000) was used as the first antibody, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: Multiple sequence alignment was performed for the whole aa sequences of ACEs using MAFFT with a local alignment strategy FFT-NS-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The phylogenetic tree was constructed by MEGA7 using the neighbor-joining (NJ) method with 1,000 bootstrap replicates and visualized using FigTree.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.29.013490: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A primary anti-spike rabbit monoclonal antibody (40150-R007, Sino Biological, 1:100) and a goat anti-rabbit secondary antibody (Alexa Fluor 488, Invitrogen, Thermo Fisher Scientific) were employed to stain 2019-nCoV S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: (Sino Biological Cat# 40150-R007, RRID:AB_2827979)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A primary anti-His-tag mouse monoclonal antibody (AF5060, Beyotime, 1:1000) and a goat anti-mouse secondary antibody (A0216, Beyotime, 1:2000) were employed to detect S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (AnaSpec; EGT Group Cat# 29673-1000, RRID:AB_11232932)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Beyotime Cat# A0216, RRID:AB_2860575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">β-actin determined by a mouse monoclonal antibody (AA128, Beyotime, 1:1000) was used as a reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AA128</div><div>suggested: (Beyotime Cat# AA128, RRID:AB_2861213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence microscopy: Caco-2 and HK-2 obtained from the cell bank of Chinese Academy of Sciences (CAS, Shanghai) and cultured in Dulbecco’s modified Eagle medium (DMEM, Gibco, Thermo Fisher Scientific, Shanghai</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.23.165415: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Periplasmic extracts were transferred to a microtiter plates, previously coated with Protein A (Sigma), blocked in TBS-BSA buffer and subsequently incubated with anti-myc antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Suspension adapted HEK293-F cells were grown in 600-ml Bioreactors in 250 ml of serum free FreeStyle medium in an incubator at 37°C with humidified atmosphere at 8% CO2 on an orbital shaker platform rotating at 220 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization Assay: Pseudotyped neutralization assays were adapted from protocols previously validated to characterize the neutralization of HIV 38, but with the use of HEK293T-ACE2 cells as previously described 25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudotyped lentiviruses displaying the SARS-CoV-2 spike protein (harboring an 18 amino acid truncation of the cytoplasmic tail 39) and packaging a luciferase reporter gene were generated by the co-transfection of HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene for RBD expression comprises residues (319 − 566) of 2019-nCoV RBD-SD1 and was cloned into a pαH mammalian expression vector containing a secretion signal, a C-terminal Sortase recognition motif and a non-cleavable Histidine tag 25</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-SD1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biophysical methods: Small angle X-ray scattering measurements (SAXS): The SAXS data were collected at the EMBL P12 beamline of the storage ring PETRA III (DESY, Hamburg, Germany) using a robotic sample changer 41.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBL</div><div>suggested: (ChEMBL, RRID:SCR_014042)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The radial average was performed and solvent scattering was subtracted using the SASFLOW pipeline 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SASFLOW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The distance distributions were computed by GNOM 43 and the overall parameters were determined from the reduced data using relevant programs from the ATSAS suite 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATSAS</div><div>suggested: (ATSAS, RRID:SCR_015648)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hybrid models of the sybodies and of the RBD were constructed by CORAL 45 using the available high-resolution portions as rigid bodies and amending them by chains of dummy residues to represent the fragments not present in the crystal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CORAL</div><div>suggested: (Coral, RRID:SCR_011849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracted particles were imported into cryoSPARC v2.15.0 49 for 2D classification, heterogenous refinement and non-uniform 3D refinement 50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was extended and manually adjusted in COOT 51.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.29.20116004: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent under the Western IRB approved IRB protocol #20180015 to Enable Biosciences.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the testing, the eluent was assayed using a modified Antibody Detection by Agglutination-PCR (ADAP) protocol12–14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ADAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">If present, the SARS-CoV-2 antibodies in the specimen engage with S1-DNA conjugate to agglutinate into a dense immune complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: The SARS-CoV-2 spike protein (S1) containing amino acids 1–674 with an Fc-tag at the C-terminus (#31806), expressed in HEK293 cells, was purchased from the Native Antigen Company (Oxford, United</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>