SciScore for 10.1101/2021.12.07.471597: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated on ice for 15 minutes with anti- HA antibody (Invitrogen HA Tag Mouse anti-Tag, DyLight® 650 conjugate, Clone: 2-2.2.14; 1:100 dilution) and Streptavidin-PE (Thermo Fisher scientific; catalog number S866; 1:100 dilution).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti- HA</div><div>suggested: (Claes Örvel lab; Karolinska Institute Cat# anti-MuV rabbit 144, RRID:AB_2747378)</div></div><div style="margin-bottom:8px"><div>anti-Tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Competitive indirect enzyme linked immunoassay (competitive ELISA): Nunc™ MaxiSorp 96-well Immuno-Plates (Thermo Fisher Scientific, Illkirch, France) were coated with 200 μL/well of AffinityPure goat anti-mouse IgG+IgM (H+L) antibody (Jackson Immuno Research Laboratories Inc., Pennsylvania, USA) at 10 μg/mL in 50 mM potassium phosphate buffer, and incubated overnight (16h) at 22 ± 2 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG+IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 Freestyle™ were transiently transfected at a density of 2.5 106 cells/mL in 100mL Freestyle medium (Thermo-Fisher) by addition of 150 μg plasmid and 1.8 mL of linear polyethylenimine (PEI, 0.5 mg/ml) (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the culture medium of each plate containing the VERO E6 cells is removed and 500 μL of each VHH/virus mixture is added to each well in duplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gap repair transformations were made in plasmid pNT VHH72 between restriction sites NheI and NotI with 1 μg of digested vector and a molar ratio of 12:1 (library/digested vector).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes coding for the various RBD domains were cloned in the pCAGGS RBD-SARS-CoV-2 plasmid, which was a kind gift from Florian Krammer lab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS RBD-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were demultiplexed and each sample was processed separately using the Galaxy platform (https://usegalaxy.org/) using the functions described in Blankenberg et al 45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Galaxy</div><div>suggested: (Galaxy, RRID:SCR_006281)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After seven days at 37°C, 120 rpm, 8% CO2, supernatant was purified using HiTrap Protein A for VHH-Fc constructs or HisTrap Excel for RBD constructs, following the manufacturer’s instructions (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HisTrap Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Affinity measurement by BioLayer Interferometry: Binding kinetics were determined using an Octet RED96 instrument (ForteBio).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLayer</div><div>suggested: (Harvard Medical School Center for Macromolecular Interactions Core Facility, RRID:SCR_018270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial structure of VHH72 was built by homology modelling using the MODELLER software 46 and the coordinates of VHH72 in PDB structure 6WAQ as template 18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the trajectories was achieved using in-house scripts written in the macrolanguage of CHARMM v42b153.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHARMM</div><div>suggested: (CHARMM, RRID:SCR_014892)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were produced with PyMol [PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.] and Gnuplot 5.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div><div style="margin-bottom:8px"><div>Gnuplot</div><div>suggested: (Gnuplot, RRID:SCR_008619)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

As a result, a second generation of antibodies might be required to overcome these limitations and could be obtained by reshaping the initial sequences by conferring them the necessary properties, such as affinity and selectivity, to have optimal therapeutic efficacy for treatment in humans. From this perspective, many teams have proposed a wide range of methods to generate candidates with the expected properties, mostly increased affinity.29-32 Affinity maturation aims at improving biological activity by adjusting the kinetic parameters of the binding to the target, which in turn may confer greater therapeutic efficacy.25,33 However, the magnitude of this effect depends largely on the epitope recognized by the antibody and the initial affinity along with the format of the antibody and its valence.25 In the context of the current COVID-19 pandemic, several studies have described affinity maturation of VHH or conventional antibodies to enhance their binding to SARS-CoV-2 antigens, by CDR-swapping approaches 34, saturation mutagenesis in CDRs 35,36 or light-chain shuffling36. In recent years, Deep Mutational Scanning (DMS) approaches have emerged as a powerful tool for understanding protein/protein interactions. Deep Mutational Scanning (DMS) explores in a selected protein all possible unique substitutions, i.e. all unique mutations for each position. DMS defines mutational landscape of the protein and helps to understand the interaction modalities as recently shown for the RBD...

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

enlaces crean redes "fisicas"; tags crean redes "logicas"

"siguiendo la pista": referencia externa link

"fuente original (secundaria)"; now, come back to esfinge

citation needed

SciScore for 10.1101/2021.12.05.471263: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absence of the polyhistidine tag in the purified protein was verified by western blot using antihistidine antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antihistidine</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 96-hr culturing (27°C, orbital shaking at 125 rpm) and centrifugation, the high-titre baculovirus supernatant produced was collected and used to infect Sf9 cells at a density of 3 × 106 Sf9 cells/ml by 1:8 dilution of the supernatant virus stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The [S:A222V + S:D614G]-1-up, [S:A222V + S:D614G]-2-up, [S:A222V + S:D614G]-3-down, S:D614G-1-up and S:D614G-2-up cryo-EM density maps were deposited in the EM Data Bank with codes EMD-13916, EMD-13917, EMD-13918, EMD-13919 and EMD-13920, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S:A222V + S:D614G]-1-up, [S:A222V + S:D614G]-2-up</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid pSPIKE (a generous gift from Cesar Santiago, CNB-CSIC) was designed to include the region encoding the SARS-CoV-2 protein S ectodomain (residues 15-1213) with substitutions to proline at residues 986 and 987 and of 668RRAR671 furin cleavage site to alanine, with a N-terminal gp67 signal peptide for secretion, and C-terminal foldon trimerization motif, a thrombin protease recognition site and 9x His and Myc tags, into the insect expression plasmid pFastBac.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSPIKE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFastBac</div><div>suggested: RRID:Addgene_1925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid pACE2TEV was prepared from that previously used to express the N-terminal peptidase domain of human ACE2 (Lan et al. 2020), by including a cleavage site for TEV protease, to allow removing the C-terminal 6×His tag in an additional purification step.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACE2TEV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plots, curve fittings and numerical calculations were performed with the program GraphPad Prism 5 (GraphPad Software, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2D classification was performed in cryoSPARC (Punjani et al. 2017) and 310,162 and 165,304 particles were selected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After several rounds of refinement in Refmac and model building in Coot, acceptable refinement metrics were obtained.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Point mutations at position 222 (A-->V) of the S1-NTD domain (residues 13-305) and 614 (D-->G) of the S1/S2 furin cleavage site were introduced by using the mutagenesis tool of PyMol 2.0 (glycan-free) or an in-house topology editing tool (glycosylated; see gitlab.com/KomBioMol/gromologist).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a protocol registration statement.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

DOI: 10.1016/j.isci.2021.103484

Resource: (MBL International Cat# M180-3, RRID:AB_10951811)

Curator: @Naa003

SciCrunch record: RRID:AB_10951811

Curator comments: anti-HA-tag antibody MBL International Cat# M180-3

---

What is this?

• If a file contains only PHP code, it is preferable to omit the PHP closing tag at the end of the file;
• but if you are embedding php with html then enclose php code with opening and closing tag;
• The type of a variable is not usually set by the programmer; rather, it is decided at runtime by PHP depending on the context in which that variable is used;

SciScore for 10.1101/2021.11.29.21267000: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All methods and procedures were performed following the relevant guidelines and regulations approved by the Ethics Committee of the Universidad de Santiago of Chile.<br>Consent: Informed consent was obtained from all participants and/or their legal guardians.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Taq DNA Polymerase (pET-28a_6H-TAQ_E602D) was obtained from Dr. Robert Tjian</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a_6H-TAQ_E602D</div><div>suggested: RRID:Addgene_166944)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, NdeI and BamHI were used to clone it in a pET-19 vector with N-terminal 10x His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analysis was performed using GraphPad Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.12.06.21267328: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by Thomas Jefferson University Institutional Review Board as minimal risk, and each participant provided written consent.<br>Consent: This study was approved by Thomas Jefferson University Institutional Review Board as minimal risk, and each participant provided written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cohort Selection: This is a prospective cohort of pregnant patients consented for collection of samples at delivery, including maternal blood on admission and cord blood at delivery as part of an ongoing delivery cohort biorepository.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The detection antibody, SULFO-TAG either with anti-human IgG (or anti-human IgM antibody (was diluted to 2 μg/ml in Diluent 100 (MSD) and added to the wells and incubated at RT for 1h on a plate shaker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (RevMAb Biosciences Cat# 31-1019-MK, RRID:AB_2783627)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional serological outcomes included: correlation between epitope levels, relation between antibody epitopes and latency to delivery Statistical Analysis: Statistical analysis conducted using SPSS v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were generated using the stats, ggplot2, and corrplot packages in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

The limited positive serology reported (65-70% of PCR+ mothers) demonstrates the limitations of examining isolated antibody epitopes, and specifically of RBD only epitope. SARS CoV-2 Immunity: While prior studies have focused on SARS-CoV-2 spike protein, we evaluated a range of epitopes. Our results demonstrated high sensitivity of our platform with detection of spike (full length)- IgM and IgG in ∼90% of documented PCR infection. We found that, as in non-pregnant patients, high levels of N-IgG and IgM titers in those with a history of COVID-1923. Studies in non-pregnant individuals identified IgM peaks in N and S epitopes in second week of infection24. We found that maternal nucleocapsid antibodies demonstrated the highest specificity for documented COVID-19 infection and were highly expressed in both maternal and cordblood samples. Nucleocapsid proteins of many coronaviruses are highly immunogenic and highly expressed during acute infection25. While the focus of vaccine and monoclonal antibody therapeutics have been on spike antigen, these results, consistent with other studies in non-pregnant adults, highlights the potential import of N-antibodies in SARS-CoV-2 immunity and target for therapy. Finally, similar to the reports cited above18,19,22, we found a high degree of correlation and a linear fit with a slope of 1.0, between maternal and cordblood IgG with cordblood IgG concentrations, indicating highly efficient transfer of CoV-2 IgG antibodies. Finally, in examining s...

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.12.05.471310: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and pseudotype assay: 293T, Huh-7 (human liver cells), and BHKs were maintained under standard cell culture conditions in DMEM with L-glutamine, antibiotics, and 10</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Westernblot: Viral pseudotypes were concentrated and 293T producer cells were lysed in 1% SDS and clarified as described previously1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike sequences from HCoV-229E (AB691763.1), MERS-CoV (JX869059.2), and SARS-CoV-1 (AY278741) were codon-optimized, appended with a carboxy-terminal FLAG tag sequence separated by a flexible poly-glycine linker and cloned into pcDNA3.1+ as previously described1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1+</div><div>suggested: RRID:Addgene_117272)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amino acid sequences for the receptor binding domain of the spike glycoprotein were aligned using ClustalW multiple sequence alignment with default parameters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A maximum likelihood phylogenetic tree was inferred with PhyML v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyML</div><div>suggested: (PhyML, RRID:SCR_014629)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final tree was then visualized as a cladogram with FigTree v1.4.4 (https://github.com/rambaut/figtree).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• No funding statement was detected.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

Linking to a New York Times tag archive would not be considered evidence by any self-respecting conspiracy theorist.

SciScore for 10.1101/2021.12.04.471219: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Soluble detergent extracts were incubated with Glutathione resins for 2 hr at 4°C prior to washing three times with PBS supplemented with NaCl 200 mM and 0.1% Triton and processed for western blot analysis with GFP antibody (Novus NB600-313).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GFP</div><div>suggested: (Novus Cat# NB600-313, RRID:AB_10002194)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293 cells were transiently transfected with the GFP tagged constructs using the phosphate calcium method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.6 Immunofluorescence: HeLa cells were transfected using the Genejuice transfection reagent (Novagen) according to the manufacturer protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PDZ domains were cloned into pETG-41A plasmid vectors as an N-terminal fusion to a histidine tag and a maltose-binding protein (His-MBP-tag).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pETG-41A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Invitrogen), PDZ domains of ZO-1, LNX2 and PARD3 were subcloned into pDEST™17 vector and MPP5-PDZ into pDEST™15 vector, allowing the production of recombinant proteins as a fusion to an N-terminal histidine and GST tag, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDEST™17</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pDEST™15</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pCMV ALFA E vector was constructed as follows: DNA sequence encoding the ALFA tag (MSRLEEELRRRLTE) followed by a linker (GGGGS) fused to the sequence corresponding to the alpha-variant of SARS-CoV2 E cDNA (GenBank: BCM16077.1) synthetized by Eurofins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV ALFA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ALFA-linker-E sequence was subsequently cloned into a pCMV backbone vector using ClaI and XhoI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_16459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequences corresponding to the PDZ domains were cloned into the pCMV GFP vector using EcoRI and XhoI sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were rebuilt using COOT (Emsley et al., 2010), and refinement was done with phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">refine of the PHENIX suite (Adams et al., 2010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All structural figures were generated with the PyMOL Molecular Graphics System, Version (Schrödinger).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

.ReadWise

zotero

anystyle.io

answer

Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

Learn more at Review Commons

---

Reply to the reviewers

Reviewer 1

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

*The manuscript by Wibisana et al. describes an impressive set of experiments that analyse the NFkB response at the single-cell level, using a variety of cutting-edge techniques (live cell imaging, single-cell RNA-seq, single-molecule RNA FISH, and single-cell ATAC-seq) in chicken DT40 B-cells.

In the fist half of the paper, the authors perform a detailed characterization of the cell-to-cell variation arising from a homogeneous stimulation with various doses of anti-IgM. They observe that the NFKB TF RelA forms clear nuclear 'foci' upon stimulation in DT40 cells: this was anecdotally shown in a different cell-type by the same authors in ref 7, but (to my knowledge) has never been systematically studied. This allows them to quantitatively analyse the foci formed in response to stimulation, and they show that this is dose-dependent, heterogeneous and biomodal, and exhibits properties of cooperativity. In parallel, the authors analyse the resulting stimulus-driven changes in gene expression, first using single-cell RNA-seq, and then, elegantly, using RNA FISH, which allows them to directly compare the number of RelA foci to gene expression in individual cells. Like the RelA foci, they find that cell-to-cell gene expression is heterogeneous and bimodal (this has been described before). Interestingly, though, they are able to show that individual stimulus-responsive genes exhibit distinct patterns of cell-to-cell hetereogeneity: they can categorize 4 clusters of responding genes according to different patterns of cell-to-cell variation at distinct stimulus doses, and moreover they show that while the heterogeneity of NFKBIA arises due to bimodal expression levels, that of CD83 is simply due to broad variation between cells. Although focused on NFkB, there is a lot of information here with some important (and non-intuitive) implications that could apply to many other stimulus-driven or developmental responses that exhibit heterogeneous patterns of gene expression. A more in-depth analysis of the single-cell datasets would certainly be very worthwhile and fruitful.

In the second half of the paper, the authors attempt to use their single-cell data, alongside ATAC-seq genomic analyses, to draw inferences about how or whether the model genes NFKBIA and CD83 are regulated by super-enhancers (SEs). Both of these genes are associated with SEs that gain accessibility upon stimulation (recapitulating the authors' findings in ref 8 in a different cell-type), and the CD83 promoter exhibits co-accessibility with two regions within an adjacent SE. The authors also show that both genes are sensitive to treatment with 1.6-HD, a compound that disrupts liquid-like condensates (a characteristic that has been reported for SEs), and CD83 is sensitive to an inhibitor of Brd4 (which has been associated to SE function). However, while these findings could be considered to be suggestive of regulation by SEs, they are clearly not definitive (nor do the authors claim so).

Finally, the authors show (figure 4a-c) that while the level of stimulus-driven gene upregulation correlates with co-accessibility with both SEs and typical enhancers (TEs), the cell-to-cell heterogeneity of gene expression correlates only with co-accessibility with SEs. This would agree with a model in which SE-regulated gene regulation may generally impart heterogeneous or switch-like gene expression. *

**Specific comments**

• The experiments are adequately presented, and the authors indicate that not only the sequencing data but also the analysis code is available. Nevertheless, the methods section is rather terse, and could benefit from more detail to understand the various analyses, particularly concerning the analyses of SEs in figures 3 and S7, where it is often difficult to understand how peaks or genes are categorized.

Response: We thank the Reviewer for pointing this out and we agree that the Methods section was not described in detail, particularly in how the SEs were analyzed and categorized. Therefore, we have added more details on how SEs were categorized in the Methods section as follows:

“ Peak calling and enhancer identification from ATAC-seq data were performed using Homer v4.10.4 (http://homer.ucsd.edu/homer/) using the bam files generated from the Cell Ranger pipeline. Tag directories were created for the bam file from each condition using the “makeTagDirectory” program with the “--sspe -single -tbp 1” option. Peak calling was performed using the “findPeaks” program with the “-style super -typical -minDist 5000 -L 0 -fdr 0.0001” option. This procedure stitches peaks within 5 kb and ranks regions by their total normalized number reads and classifies TE and SE by a slope threshold of 1. Peak annotation was subsequently performed using the “annotatePeaks.pl” program with the GRCg6a.96 annotation file. The consequent peak files were merged between each stimulation condition for the SE and TE peaks separately using the “mergeBed” program of bedtools. Peak annotation was performed for the second time for the merged peaks to create the final SE and TE peaks. ATAC fold-change was then calculated between both conditions for the merged peaks separately for SE and TE. Genes associated with both SE and TE were assigned only to the SE.”

Similarly, we have added more details for other analyses in the Method section and the main sentences.

• The imaging, scRNA-seq and RNA-FISH experiments are well-presented, although the supplementary figures 4 and 5 include key results that would merit inclusion within the main figures. *

Response: We thank the Reviewer for this comment. We have included supplementary figures 4b and 5d in the main figures (new Fig. 2g) since both of these figures represent the raw data revealing the differences between smFISH counts and RNA-seq derived gene expression.

• It is strking that although all the conclusions about SEs are drawn almost exclusively from analysis of ATAC-seq data, no raw ATAC-seq data is directly shown in any figure (even in the browser snapshots of figure 4d & e). It would be important to show the actual ATAC data from which the inferences of figures 3 and 4 are drawn, especially so that it is possible to visualize the implication of a particular 'ATAC fold-change' or of 'ATAC-gained enhancers'. Response: We have added a browser snapshot of the ATAC-seq data, presenting the super-enhancer region assigned to both CD83 and NFKBIA* (new Fig. 3c).

Reviewer #1 (Significance (Required)):

• This manuscript can be considered as a follow-up of the authors' previous paper (Michida 2020, ref 8), here focusing on cell-to-cell heterogeneity rather than on the overall magnitude of the stimulus-induced response. Overall, the experiments are well-performed and bring new data to an interesting angle of gene regulation. However, the analyses presented do not seem to fully exploit the data, and the authors do not manage to present any strong conclusions, particularly relating to the possible involvement of super enhancers.

Response: To strengthen our conclusions about the possible involvement of super-enhancers in regulating heterogeneity, we performed additional analyses on the properties of the SE including the number of transcription factors, NF-κB and PU.1 binding motifs and the length of the enhancers, according to a previous report (Michida et al., 2020, Cell Rep). This was also conducted to confirm whether the ATAC-seq-based SE identification method presents results consistent with those provided by H3K27Ac-ChIP-based methods utilized in the previous study (Michida et al., 2020, Cell Rep). SEs revealed longer genomic length (new Supplementary Fig. 8a) and this length was positively correlated with the ATAC signal (new Supplementary Fig. 8b). Furthermore, gained and lost SE revealed a correlation with enhanced gene expression upregulation and downregulation, respectively, compared to TE (new Fig. 3g). We also demonstrated that SE-regulated genes have a higher Fano factor change, which is consistent with the state of an SE whether it is gained or lost (new Fig. 5a, 5b). For binding motif analysis, we observed a slightly higher PU.1 motif density at SEs (new Supplementary Fig. 11), corresponding to the results of the previous study (Michida et al., 2020, Cell Rep). Interestingly, only the density of NF-κB and not PU.1 was correlated with ATAC signal change in SE (new Fig. 4a), suggesting that those SEs were controlled by nuclear translocation of NF-κB.

As a mechanism to produce gene expression heterogeneity in phenotypically identical cells, we observed that co-accessibility, which has been reported to be concordant with genomic contacts is correlated to Fano factor change, indicating that gene expression heterogeneity possibly stems from cis-regulatory interactions. NF-κB activation has been reported to increase the heterogeneity in some genes and is attributed to the accumulation of Ser5p RNAPII (Wong et al., 2018, Cell Rep). Additionally, Ser5p RNAPII has been reported to accumulate at enhancer regions (Koch et al., 2011, Nat Struct Mol Biol), and that the accumulation of RNAPII is suggested to assist in gene expression activation through enhancer-promoter contact (Thomas et al., 2021, Mol Cell). Our results support these conclusions since co-accessibility or putative cis-regulatory interactions correlate to Fano factor changes. SE can form phase-separated transcription hubs containing multiple enhancers and/or promoters, which may enable the higher diffusion rate of active enhancers; therefore, it may induce a higher possibility of genomic DNA interactions (Gu et al., 2018, Science). In contrast, the enrichment of TATA motif has also been proposed to generate transcriptional heterogeneity (Faure et al., 2017, Cell Syst). Therefore, we examined this possibility with our data. However, we observed a higher occurrence of TATA box in genes associated with lost SE (new Supplementary Fig. 18) which might have caused gene expression heterogeneity in unstimulated cells. This heterogeneity might be due to the differences in Pol II loading intervals (Tunnacliffe & Chubb, 2020, Trends Genet) however the noise associated with gained SE is possibly generated by the fluctuation of high-order biomolecular assembly. Therefore, we believe that the source of heterogeneity in these conditions were different.

Additionally, we performed Hill function analysis to reveal the threshold behavior of gene expression in our analysis since previously gained SEs were associated with threshold gene expression (Michida et al., 2020, Cell Rep). In this study, we presented that threshold behavior in gained SE is related to motif density of NF-κB (Fig. 4d), however, threshold behavior does not seem to be related to heterogeneous gene expression.

Following these results, we concluded that NF-κB activated SE has two closely related but distinct functions for gene control: (1) enhanced heterogeneity and fold-changes and (2) switch-like expression. These are controlled by different mechanisms stemming from chromatin status: (1) frequency of cis-regulatory genomic interactions possibly mediated by phase separation and (2) cooperative binding of NF-κB to DNA. These differences were well represented by expression profiles of CD83 (higher heterogeneity and weak bimodal expression) and NFKBIA (lower heterogeneity and strong bimodal expression).

• For instance, the existence of multiple gene clusters that exhibit distinct patterns of heterogeneity implies that switch-like gene activation occurs on a per-gene basis, rather than corresponding to an all-or-nothing activation of individual cells. This would be an exciting finding, and the authors have the data to test this. Likewise, the division of heterogeneous gene expression into bimodal (like NFKBIA) or unimodal (like CD83) distributions could be a nice paradigm if systematically applied to the other 1335 differentially-expressed genes identified by the authors. * Response: We appreciate this comment. Following your comment, we analyzed the relationship between heterogeneity and bimodality (switch-like expression or high Hill coefficient) for the remaining genes. We observed that SE having a high Hill coefficient contained a higher number of NF-κB motif in SE (new Fig. 4), indicating that cooperative binding of NF-κB to DNA shaped non-linear gene expression profiles as we indicated in a previous paper (Michida et al., 2020, Cell Rep). Additionally, as described in the earlier section, we observed that heterogeneity arises from cis-regulatory genomic interaction. We compared these gene groups and observed that these properties were not completely shared (new Supplementary Fig. 15), indicating that bimodality and heterogeneity originated from different mechanisms. We assume that those differences are mediated through a combination of chromatin accessibility and the biophysical properties of NF-κB.

• In contrast, although the authors try to use their data to investigate gene regulation by SEs, these inferences are all somewhat indirect, and the authors themselves do not manage to draw any definitive conclusions. Response: We appreciate this comment. We performed the additional computational analysis and carefully interpreted the data. Additionally, we have now concluded that SEs have two major biological functions: (1) gene expression heterogeneity, which is mediated via cis-regulatory interactions (Fig. 5) and (2) bimodal gene expression, which is mediated by NF-κB binding (new Fig. 4). The latter finding has also been reported in a mouse primary B cell, albeit the mechanism causing heterogeneity was a novel conclusion of this study.

• I feel that the authors are under-selling their data here. As-is, the data represents more of a resource than a study with a clear message, but I believe that with more in-depth analysis the authors could make a much more significant advance, particularly concerning the cell-to-cell heterogeneity of gene expression. I would be very enthusiastic to review the same data again with a more detailed analysis, which I believe would enormously improve the manuscript. Response: We appreciate this comment. As described in this report and the revised manuscript, we performed a considerably detailed computational analysis and gained several novel insights to answer the question regarding the functional roles of SE. We are grateful to learn that gene expression patterns may be estimated from ATAC-seq profiles and that they may even be controlled. We hope that this Reviewer would observe the scientific value of our study and provide us with your valuable feedback on our revised manuscript.

Reviewer #2

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

Imaging and single cell sequencing analyses of super-enhancer activation mediated by NF-κB in B cells" by Wibisana et al. examined the relationship between super-enhancers, NF-κB nuclear aggregation, and target gene regulation. The authors have generated a large amount of data from fluorescent microscopy, scRNA-seq, scATAC-seq, smRNA FISH. While this is an impressive dataset in terms of diverse technically advanced methods employed, it is not clear what to take as a main conceptual advance. What could be the functional implications of observed cell-cell variability in B cell transcriptional responses to environmental stimuli? In addition to this general point, the following are specific comments that could improve the manuscript.

2. In Figure 2, smRNA FISH foci of CD83 and NFKBIA are quantified as # of spots per cell (Supplementary figure 5). But it is difficult to see in Figure 2 the colocalization of any mRNA spots with RelA foci. Ideally, it will be convincing to show by DNA FISH that these target loci are indeed located within NF-κB occupied super-enhancer puncta. Even with the current RNA FISH data, some colocalization analysis could have been performed. * Response: In Figure 2, we were unable to perform accurate colocalization analysis with the current smFISH data as the probes used by us map to exons. Moreover, we have also previously performed DNA-FISH; nevertheless, it was difficult to assess co-localization between the DNA and RelA proteins secondary to the degradation of RelA-GFP proteins. Therefore, we decided to perform intronic smRNA-FISH, which can be used to pinpoint the site of active transcription (Levesque and Raj, 2013, Nat Methods). The results, along with the quantification results, are presented in the new Fig. 2f.

• Supplementary Figure 5a shows lower correlations of # GFP-RelA foci to CD83 transcripts in comparison to NFKBIA. Even though the foci and smRNA FISH spots are derived from high resolution imaging data, we should remember that any snapshot measurements have limited information content for gene regulatory relationships. Live cell studies (for example, from the groups of Suzanne Gaudet, Kathryn Miller-Jensen, and Myong-Hee Sung) have shown that time-integrated measures (e.g. maximum fold change and area under the curve of RelA signaling time course in single cells) are better correlates to transcriptional output of target genes (Lee REC et al 2014 Mol Cell; Wong VC et al 2019 Biophysical J; Sung MH et al. 2014 Science Signal; Martin EW et al. 2020 Science Signal). *

Response: We thank the Reviewer for this valuable comment. One of the reasons for a lower correlation between GFP-RelA foci and CD83 transcripts compared to NFKBIA may be the difference in expression timing of CD83 and NFKBIA and the timing of nuclear localization of GFP-RelA. RelA localizes in the nucleus 10−30 mins after cell stimulation, and NFKBIA is an early responsive gene, however, CD83 is expressed later (new Supplementary Fig. 17). Therefore, this time difference possibly affects correlation accuracy. Although we agree that high-throughput time-course measurement of RelA-GFP combined with smFISH measurements, such as that reported in Wong VC et al., 2019, will be ideal, it is technically difficult since DT40 are suspension cells and the smFISH protocol requires multiple washing and centrifugation steps. Thus, with this experimental setup, we were unable to perform the time-course analysis.

Nonetheless, we measured the time-course foci formation at the same single-cells (new Supplementary Fig. 1b) and observed that it effectively represents Figure 1a, which is a snapshot of the population dynamics of RelA foci across time. Additionally, the observed dynamics, which revealed a steep initial increase and slight decrease with time, effectively recapitulates the previous reports (Lee et al., 2014, Mol Cell; Wong et al., 2019, Biophys J).

In our analysis, we performed imaging analysis to demonstrate that NF-κB foci formation is switch-like, and this formation might be involved in the formation of phase-separated condensates enhancing DNA to DNA contact. The number of foci may depend upon the intracellular concentration of NF-κB, and fold change in the RelA signal may be correlated with gene expression as previously reported (Lee et al., 2014, Mol Cell; Wong et al., 2019, Biophys J). However, there is another report presenting that promote/enhancer proximity is not related to gene expression (Alexander et al. 2019, eLife). Although we were unable to perform this analysis owing to the limitations stated above, we tried to find the relationship between RelA foci and gene expression by performing biochemical perturbations (Fig 1e-f, Fig 5h) and presented that these foci are related to gene expression.

• The analyses have been performed using DT40 cells. In the Methods section, no description was provided about what type of B cells DT40 is, even though few outside of the field may not know that the cells were immortalized from chicken. This is an important consideration, because some nuclear bodies and genome organization features are different between host species and they also depend on whether the cells are primary or transformed. Because the authors do not discuss this point, it seems possible that the findings about NF-κB aggregates and super-enhancers may not necessarily hold true for primary B cells. *

Response: We thank the Reviewer for pointing out these issues. We have added the following description on DT40 cells in the Methods section describing that DT40 cells are chicken bursal lymphoma cells.

DT40 B lymphocytes have been widely used as a B cell model for studying B cell receptor signaling (Mori et al., 2002, J. Exp. Med.; Patterson et al., 2002, Cell; Saeki et al., 2003, EMBO J.) due to its high gene targeting efficiency. We also previously confirmed that anti-IgM stimulation induces the NF-κB signaling pathway in mouse primary splenic B cells and DT40 and that the signaling molecules and dynamics in these cells are well conserved (Shinohara et al., 2014, Science; Shinohara et al., 2016, Sci. Rep.; Inoue et al., 2016, NPJ Syst. Biol. Appl.). However, we understand the Reviewer’s concerns. Therefore, we have provided the track view of primary B cell ATAC-seq data to demonstrate that the chromatin accessibility changes upon anti-IgM stimulation in CD83 and NFKBIA were similarly observed in primary B cell data (new Supplementary Fig. 9b) and that the upregulation and association with SE of CD83 and NFKBIA were also observed in primary B cell (new Supplementary Fig. 9a).

• Similarly, the GFP-RelA expressing DT40 cell generation should be described with more detail (beyond "provided by ..."). N-terminal or C-terminal fusion? Did the fusion construct contain an artificial promoter (e.g. CMV) or an upstream fragment of the genomic Rela locus (chicken or human)? Methods of transfection and cloning of stable lines? These choices affect the interpretation of the data, so they must be fully described and justified. *

Response: We thank you for pointing this out. We have added the following details on the RelA-GFP construct in the Methods section:

Mouse RelA-eGFP with eGFP on the C terminal was cloned into a pGAP vector containing Ecogpt resistance gene targeting endogenous GAPDH locus. This construct was further electroporated into wild-type cells and selected using Ecogpt to produce RelA-GFP-expressing DT40 cells.

• DT40 cells were cultured in 39 degrees. Michael White and colleagues have shown that high temperatures can alter NF-kappaB dynamics and function (https://www.pnas.org/content/115/22/E5243). Did the authors try lower temperatures to ascertain that the NF-kB aggregates and other major findings are still observed in 37 degrees? *

Response: We performed the experiments at 39 degrees to mimic the natural body temperature of chicken since DT40 cells were derived from chicken bursal lymphoma (Saribasak and Arikawa, 2006, Subcell Biochem). Previously, we cultured DT40 cells at 37 degrees and observed that the cell growth was inhibited, and thus, we believed that it was not ideal to perform experiments of DT40 cells at 37 degrees.

Reviewer #2 (Significance (Required)):

It is not clear what to take as a main conceptual advance.

Response: Considering the original manuscript, we agree with the Reviewer on the lack of strong emphasis on the conclusions of our study. Therefore, in this revised manuscript, we have focused on the comprehensive mechanism of heterogeneity and switch-like activation in gene expression control. As we described in the comments to Reviewer #1, we performed an additional in-depth computational analysis on SE and TE. Consequently, we demonstrated that enhanced heterogeneity and expression fold-changes mediated by SE are defined by the number of cis-regulatory genomic interactions in open chromatin regions (Figure 5), however, switch-like expression (bimodal patterns) is determined by the number of NF-κB binding in SE (new Figure 4). The latter finding has also been reported in a mouse primary B cell in our previous study (Michida et al. 2020, Cell Rep.). However, the mechanism causing heterogeneity is a novel conclusion obtained in this study. We also concluded that these similar, albeit quantitatively and slightly different characteristics in gene control can be achieved through a combination of chromatin accessibility of host cells and biophysical properties of NF-κB molecule, which is involved in phase separation.

What could be the functional implications of observed cell-cell variability in B cell transcriptional responses to environmental stimuli?

Response: We performed gene ontology analysis to reveal how the heterogeneously expressed genes (cluster 4) (Fig. 2d) presented enrichment for immune-related functions (Supplementary Fig. 5b). This result supports a previous study, which stated that variability in gene expression is related to function (Osorio et al., 2019, Cells).

This discussion is incorporated in the manuscript as follows:

“We observed that genes with an increased heterogeneity upon increasing stimulation dose are enriched with cell-type-specific immune regulatory genes (Supplementary Fig. 5b), supporting a previous report where heterogeneity in gene expression is tied to biological functions and may be used by cells as a bet-hedging or a response distribution mechanism (Osorio et al., 2019, Cells), where cells exhibit heterogeneity to enable response to changing environment and also allowing dose-dependent fractional activation respectively. This was observed in CD83, a B cell activation marker, demonstrating the involvement of heterogeneity in B cell development.”

truco

I am unsure of what "automatic OER Processing" might mean/ Can anyone help?

The closes I came was in the section of a International Journal of OER paper by Stephen Downes: A Look at the Future of Open Educational Resources where in the Artificial Intelligence section he illustrates an example of AI creating OER (?)

What is relevant to open education is that the services offered by these programs will be available as basic resources to help build courses, learning modules, or interactive instruction. For example, Figure 3 illustrates a simple case. It takes the URL of an image, loads it, and connects an online artificial intelligence gateway offered by Microsoft as part of its Azure cloud services using an API key generated from an Azure account.

The Azure AI service automatically generates a description of the image, which is used as an alt tag, so the image can be accessible; the alt tag can be read by a screen reader for those who aren’t able to actually see the image. In this case, the image recognition technology automatically created the text “a large waterfall over a rocky cliff,” along with a more complete set of analytical data about the image.

Yes this is interesting and is a useful tool for content creation, but to me seems a far leap to creating educational content.

SciScore for 10.1101/2021.11.25.470011: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study and corresponding experiments were approved by the local ethics committee (S64089) and all patients gave their written informed consent.<br>Consent: The study and corresponding experiments were approved by the local ethics committee (S64089) and all patients gave their written informed consent.<br>Euthanasia Agents: At day 4 post-infection, animals were euthanized by intraperitoneal injection of 500 μL Dolethal (200 mg/mL sodium pentobarbital, Vétoquinol SA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Syrian hamsters (Mesocricetus auratus) were purchased from Janvier Laboratories and kept per two in individually ventilated isolator cages (IsoCage N Bio-containment System, Tecniplast) at 21°C, 55% humidity and 12:12 day/night cycles.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">No randomization methods were used and confounders were not controlled, though all caretakers and technicians were blinded to group allocation in the animal facility and to sample numbers for analysis (qPCR, titration, and histology).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">No randomization methods were used and confounders were not controlled, though all caretakers and technicians were blinded to group allocation in the animal facility and to sample numbers for analysis (qPCR, titration, and histology).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Group size was calculated based on the independent t-test with an effect size of 2.0 and a power of 80% (effect size = delta mean/SD = 1 log10 decrease in viral RNA/0.5 log10), resulting in 5-6 animals/group.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">His-tag labeled SARS-CoV-2 RBD (The Native Antigen Company) was biotinylated with the EZ-Link Sulfo-NHS-LC-Biotin kit (Thermofisher Scientific) according to the manufacturer’s protocol, corresponding to 1-3 biotin groups per antibody molecule.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sulfo-NHS-LC-Biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the 60 minutes incubation, B cells were washed with FACS buffer and stained with PerCP-cy5.5 anti-human CD19 antibody (Biolegend, 363016)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD19</div><div>suggested: (BioLegend Cat# 363016, RRID:AB_2564207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FITC anti-human CD3 antibody (Biolegend, 300306) and PE streptavidin (Biolegend, 405203) for 25 minutes on ice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD3</div><div>suggested: (BioLegend Cat# 300306, RRID:AB_314042)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a positive and negative control, an anti-SARS-CoV-2 RBD mAb (40150-D004, Sino Biological) and anti-SARS-CoV-2 nucleocapsid antibody (MBS2563841, MyBioSource) were used, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid antibody ( MBS2563841</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, mouse anti-human IgG (Fc) antibody (Human Antibody Capture Kit, Cytiva) was immobilized on a CM5 chip according to manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibody neutralization assays: a. Production of S-pseudotyped virus and serum neutralization test (SARS2, SARS1, MERS, 229E): VSV S-pseudotypes were generated as described previously56.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two hours later, the medium was replaced by medium containing anti-VSV-G antibody (I1-hybridoma, ATCC CRL-2700) to neutralize residual VSV-G input.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, serial dilutions of antibodies were mixed separately with live SARS-CoV-2 Wuhan, alpha, beta and gamma virus strains, incubated at 37 °C for 1h, and added to the monolayer of Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1h</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells (SARS-CoV, SARS-CoV-2 and MERS-S) or BHK-21J cells (229E) were transfected with the respective S protein expression plasmids, and one day later infected (MOI = 2) with GFP-encoding VSVΔG backbone virus (purchased from Kerafast).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BHK-21J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To quantify nAbs, serial dilutions of serum samples were incubated for 1 hour at 37 °C with an equal volume of S pseudotyped VSV particles and inoculated on Vero E6 cells (SARS-CoV and SARS-CoV-2) or Huh-7 cells (229E and MERS-S) for 18 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Shortly, 104 VeroE6 cells/well were seeded in 96-well plates one day prior to the titration and inoculated with 10–fold serial dilutions of virus solutions and cultured for 3 days at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious virus was isolated by serial passaging on Huh7 and Vero E6 cells58; passage 6 virus was used for the study described here.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intramuscular pDNA electroporation: 3B8 was delivered in vivo, encoded in the CMV-driven pcDNA3.4 vectors, as an equimolar mixture of the 3B8 heavy and light chain plasmids (jointly referred to as ‘p3B8’).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed using Graphpad Prism 9.0 (Graphpad Software). b.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epitope binning graphs were made in Microsoft Excel and clustering was done with ClustVis web tool (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>ClustVis</div><div>suggested: (ClustVis, RRID:SCR_017133)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization IC50 values were determined by normalizing the serum neutralization dilution curve to a virus (100%) and cell control (0%) and fitting in Graphpad Prism (GraphPad Software, Inc.). b.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both strains were subjected to sequencing on a MinION platform (Oxford pore) directly from the nasopharyngeal swabs</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03831503</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of INO-A002 in Healthy Dengue Virus-naive Adults</td></tr></table>

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

This source can be verified through the references at the bottom of the page, which must be expanded from the text that says "Only the first few references on this page are shown above. Click to show more.".

SciScore for 10.1101/2021.11.17.468943: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.5 Cytotoxicity assays: Vero cell lines (ATCC® CCL-81™) were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.1 Cloning, protein overexpression and purification of SARS-CoV-2 PLpro: A fragment of SARS-CoV-2 ORF pp1a/ab encoding the PLpro domain and corresponding to amino acids 746-1060 of non-structural protein 3 (YP_009742610.1) was cloned into pETM11(EMBL), which encodes N-terminal hexa-his tag followed by a tobacco etch virus (TEV) protease cleavage site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pETM11</div><div>suggested: RRID:Addgene_108943)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Final rounds of manual refinement with either Refmac48 or Phenix49 together with manual model building applying COOT resulted in the final refined structures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsoft Excel and GraphPad Prism (version 8.3.1) were used for analyzing the results and preparation of corresponding figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture supernatant was harvest 42 h post-infection and viral RNA was purified using MagMAX™</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MagMAX™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50-values were calculated by fitting the data using GraphPad Prism version 8.00 (GraphPad Software, La Jolla California USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.23.469714: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a control, a same number of cells were stained with BV421 anti-hCD45 antibody (Biolegend, #368522) and the top 3% of the BV421-positive cells were sorted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hCD45</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the cells were washed two times and resuspended in FACS buffer containing the secondary antibodies at a 1:1000 dilution: AF647-labeled donkey anti-goat IgG (Invitrogen, #A32849) or AF488-labeled goat anti-rabbit IgG (Invitrogen, #A32731).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AF647-labeled donkey anti-goat IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A32731, RRID:AB_2633280)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated goat anti-human IgG Fc secondary antibody was used to detect the bound ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To compare GFP expressions in ACE2- and LRRC15-positive cells, pseudovirus-infected cells were stained for surface ACE2 and LRRC15 as described above with following secondary antibodies: AF405-labeled donkey anti-goat IgG (Invitrogen, #A48259) and PE-labeled donkey anti-rabbit IgG (Jackson ImmunoResearch, #711-116-152)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AF405-labeled donkey anti-goat IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PE-labeled donkey anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently incubated with recombinant anti-LRRC15 antibody (Abcam, #ab150376) and SARS-CoV-2 spike antibody [1A9] (GeneTex, #GTX632604) at 1:100, followed by incubation with 1:500-diluted Alexa Fluor 555 conjugated goat anti-rabbit IgG antibody (Abcam, #ab150078) and 1:200-diluted Alexa Fluor 488 conjugated goat anti-mouse IgG antibody (Abcam, #ab150117) for 60 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-LRRC15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab150117, RRID:AB_2688012)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For A375 cells, 5 µg/mL blasticidin (Gibco, #A1113903) and 1 µg/mL puromycin (Gibco, #A1113803) were added as appropriate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A375</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-dCas</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">7.8 x 107 A375-dCas cells were transduced with the CRISPRa library at ~0.3 MOI to make 2.4 x 107 transduced cells, which is sufficient for the integration of each sgRNA into ~500 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A375-dCas</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 8 x 106 HEK293T cells were plated in 10-cm tissue culture dishes and transfected using Lipofectamine2000 (Invitrogen) with plasmids encoding different CoV spike proteins or VSV-G protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For 1:1 ratio co-culture, 1 x 104 HeLa-ACE2 cells and 1 x 104 HeLa or HeLa-sgLRRC15 cells were plated per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa-sgLRRC15</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopic analysis: 8 x 103 HeLa-ACE2 cells and 3.2 x 104 HeLa or HeLa-sgLRRC15 cells (1:4 ratio) were co-plated per well in 8-well chamber slides (Nunc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A375-dCas or HeLa-dCas cells were generated by transducing with pLenti-dCas9-VP64-Blast (Addgene, #61425).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-dCas9-VP64-Blast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stable ACE2 expressing HeLa cells (HeLa-ACE2) were generated by transducing HeLa-dCas cells with pLENTI_hACE2_HygR (Addgene, #155296) followed selection with hygromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLENTI_hACE2_HygR</div><div>suggested: RRID:Addgene_155296)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ectopic expression of LRRC15, a lentiviral vector pCDH-MSCV-T2A-Puro (System Biosciences, #CD522A-1) was modified to enable zeocin selection instead of puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-MSCV-T2A-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A codon-optimized LRRC15 ORF was cloned into pCDH-MSCV-T2A-Zeo with a C-terminal 3xFLAG tag and used to transduce HeLa-ACE2 followed by zeocin selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-MSCV-T2A-Zeo</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sgRNAs were cloned into pXPR_502 (Addgene, #96923) with assistance from the Genome Engineering and iPSC Center (GEiC) at Washington University in Saint Louis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pXPR_502</div><div>suggested: RRID:Addgene_96923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene, #170447), MERS-CoV (Addgene, #170448) and VSV-G (Addgene, #12259) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of genetically modified cell lines: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACATGCAGGCACTGCACTG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 min incubation at 4°C, the cells were washed two times, fixed with 4% formaldehyde for 15 min and washed and resuspended in FACS buffer before analyzing by flow cytometry using FACSCelesta (BD Biosciences) or Cytek</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytek</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed with Flowjo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism 9 software was used to perform nonlinear regression curve-fitting analyses of binding data to estimate dissociation constants (KD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To compare LRRC15 expression in lung cell lines infected with SARS-CoV-2 vs mock controls [61], we accessed the raw count data from GSE147507 and performed differential expression analysis using DESeq2 as above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was determined using GraphPad Prism 9 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.24.469842: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M13</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound VHHs were detected by HRP-conjugated anti-Myc-tag antibody and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation samples were added to a monolayer of Vero E6 cells and incubated in a 5% CO2 incubator at 37 °C for 96-120 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning, expression and purification of recombinant SARS-CoV-2 RBD protein: The RBD nucleotide sequence of SARS-CoV-2 Wuhan-Hu-1 isolate (Genbank accession number MN908947, from 319 to 545 aa) was synthesized (Evrogen, Russia) and cloned into the pCEP4 mammalian expression vector (Thermo Fisher Scientific, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCEP4</div><div>suggested: RRID:Addgene_16479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHHs coding sequences were PCR amplified and cloned into a pHEN1 phagmid vector (33)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHEN1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the second round PCR nanobodies sequences were assembled together and amplified using pHEN1-F and pHEN1-R primers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHEN1-F</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHEN1-R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH-coding sequences were sequenced with Lac-prom (5’-CTTTATGCTTCCGGCTCGTATG-3’) and pIII-R (5’ CTTTCCAGACGTTAGTAAATG 3’) primers according to the protocol of the BigDyeTerminator 3.1 Cycle Sequencing kit for the Genetic Analyzer 3500 Applied Biosystems (Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIII-R</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values were calculated using four-parameter logistic regression using GraphPad Prism 9 (GraphPad Software Inc, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were aligned with MUSCLE (v3.8.31) (35).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The phylogenetic tree was reconstructed using the maximum likelihood method implemented in the PhyML program (v3.1/3.0 aLRT) (36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyML</div><div>suggested: (PhyML, RRID:SCR_014629)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphical representation and edition of the phylogenetic tree were performed with MEGA X (34).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.23.469747: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target proteins were detected using the following antibodies: mouse anti-Strep tag II (Millipore Sigma: 71590); rabbit anti-Caspase 3 (Cell signaling: 9662); rabbit anti-Cleaved-Caspase 3 (Cell signaling: 9664) and mouse anti-GAPDH antibody (Cell signaling: 2118).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep tag II</div><div>suggested: (Abnova Cat# PAB16601, RRID:AB_10677207)</div></div><div style="margin-bottom:8px"><div>anti-Caspase 3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Cleaved-Caspase 3</div><div>suggested: (Affinity Biosciences Cat# BF0711, RRID:AB_2846190)</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Cell Signaling Technology Cat# 2118, RRID:AB_561053)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 and 293T cell lines were maintained in the high glucose Dulbecco’s modified Eagle’s medium (DMEM) (Corning Cat#: 10-017-CV) with 10% fetal bovine serum (FBS, Gibco Cat#: 100-438-026) and 100 U/mL Penicillin-Streptomycin (Gibco Cat#:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in Eagle’s Minimum Essential medium (EMEM) (Quality Biological Cat#: 112-018-101) with 10% FBS and 100 U/mL Penicillin-Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of Mammalian Cell-specific Activities: 2 x 104 293T or 1 x 104 A549 and Calu-3 cells/well were seeded into a 96-well plate and cultured at 37°C/5% CO2 overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the mammalian ORF3a study, a lentiviral constitutive expression vector pLVX-EF1alpha-IRES-Puro (Takara) that carries the ORF insert (provided by Dr. Nevan J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fission Yeast Plasmid Transformation and Inducible SARS-COV-2 Gene Expression: The SARS-COV-2 gene-carrying pYZ1N plasmids were transformed into a wild type fission yeast SP223 strain by electroporation (5, 57).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYZ1N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were maintained in Eagle’s Minimum Essential medium (EMEM) (Quality Biological Cat#: 112-018-101) with 10% FBS and 100 U/mL Penicillin-Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Pair-wise t-test or one-way ANOVA was calculated using software Prism 9 (GraphPad, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 24 and 17. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.24.469776: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed according to Institute of Laboratory Animal Resources guidelines and the protocol was approved by the National Cancer Institute Animal Care and Use Committee.<br>Euthanasia Agents: All mice were anesthetized via isoflurane inhalation (3 - 5 % isoflurane, oxygen flow rate of 1.5 L/min) prior and during BLI using the XGI-8 Gas Anesthesia System.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">6–8-week-old male and female mice were used for all the experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times and incubated with the goat anti-human-IgG Fc secondary antibody conjugated with alkaline phosphatase (AP, Southern Biotech) at a 1:1000 dilution in blocking buffer for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular phagocytosis was determined by flow cytometry, gating on THP-1 cells that were triple-positive for GFP, efluor450 and efluor670 cellular dyes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were washed, sonicated, and incubated with goat anti-guinea pig C3 antibody conjugated with biotin (Immunology Consultants Laboratory) at RT for 1 h followed by incubation with streptavidin R-Phycoerythrin (PE,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-guinea pig C3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Before and after injection, serum samples were collected at 0 min, 10min, 1 h, 6 h, 24 h and 48 h and the ACE2-Fc serum concentration was estimated by indirect ELISA in which SARS-CoV-2 RBDwt (200 ng/well) were used as capturing molecule and the goat-anti-human IgG conjugated with AP (1:1000 dilution) were used as secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG1 Fc tag and 8xHis tag) (45), plasmids encoding the respective genes were transfected to 293F cells with the same protocol as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine viral titers, hACE2-expressing 293T cells (gift from Dr. Allison Malloy, USUHS) were infected with serial PsV dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent cellular phagocytosis was determined by flow cytometry, gating on THP-1 cells that were triple-positive for GFP, efluor450 and efluor670 cellular dyes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dilutions from infected cell homogenates were applied on Vero E6 monolayer. 24 hour post infection, infected Vero E6 cells were washed with PBS, lysed with Passive lysis buffer and transferred into a 96-well solid white plate (Costar Inc) and nanoluciferase activity was measured using Tristar multiwell Luminometer (Berthold Technology) for 2.5 seconds by adding 20 µl of Nano-Glo® substrate in nanoluc assay buffer (Promega Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">96-well Nunc Maxisorp plates (Sigma) were coated with SARS-CoV-2 RBDwt (residue 319-541) (50ng), RBDB.1.351 (50 ng), S-2P (75 ng), SB.1.1.7 (75 ng), SB.1.351 (75ng), SP.1 (75 ng), SB.1.526 (75 ng) and SARS-CoV RBD (50ng) per well in Tris-buffered saline (TBS) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SB.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in vivo PsV-based inhibition assays, 6-8-week-old K18-hACE2 mice were intranasally (i.n) treated with Synagis (control IgG, 25 µg), M27 or M81 (5 or 25 µg) one hour before challenge by SARS-CoV-2 PsVD614G or PsVB.1.617.2 (i.n., ∼108 RLU)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For PK studies, C57BL/6J mice were intravenously (i.v.) injected with 100 μg (5 mg/kg) of two engineered ACE2-Fc M81 or M86.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate SARS-CoV-2 RBDwt (residue 319-541 or residue 319-537, for crystallization), RBDB.1.1.7 (residue 329-527, N501Y) and RBDB.1.351 (residue 329-527, K417N/E384K/N501Y), the respective codon optimized DNA segments fused with an N-terminal secretion peptide and a C-terminal 6xHis tag were cloned into the pACP-tag (m)-2 vector using either EcoRI/NotI for RBDwt (319–541), RBD B.1.1.7 and RBDB.1.351 or BamHI/XhoI for RBDwt (319–537) as restriction enzymes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACP-tag</div><div>suggested: RRID:Addgene_101126)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monomeric ACE2wt and engineered ACE2LFMYQY2HA plasmids encoding ACE2 (residue 1-615) with C-terminal HRV-3C-cleavable 8xHis tag (45) were transfected to FreeStyle 293F cells and the resulting protein was purified over Ni-NTA columns (Cytiva).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2LFMYQY2HA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism was used to display the mean and SEM for all groups and used to calculate the area under the curve (AUC) within the concentration range of 0.05-2.5 nM using 5% binding as baseline (Fig. 2D & S2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative cycles of model building and refinement were done in Coot (79) and Phenix (80).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural analysis and Fig. generation were performed in PyMOL (81)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on an LSRII cytometer (BD Biosciences) and data analysis performed using FlowJo v10 (Tree Star)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YARC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired and analyzed with Living Image v4.7.3 in vivo software package (Perkin Elmer Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Living Image</div><div>suggested: (Living Image software, RRID:SCR_014247)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were processed and plotted using GraphPad Prism 8 v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

Thus far, the in vivo protective potential of an ACE2-Fc therapeutic has been tested only once in a Syrian hamster model (28) which has several limitations due to its inability to fully recapitulate SARS-CoV-2 pathogenesis and severity. To better test our lead ACE2-Fc variant we utilized a well characterized K18-hACE2 mouse model (67). Due to the constitutive high endogenous human ACE2 expression, this model is highly susceptible to SARS-CoV-2 infection and the disease progression partially recapitulates the severe pathological features of SARS-CoV-2 infection in humans. The model has also been used extensively for evaluating contributions from direct neutralization and Fc-effector activities mediated by nAbs (68) and a non-neutralizing Ab (69). However, a high basal level of hACE2 on target cells in this model, particularly in the brain, poses a significant obstacle for soluble ACE2-based antivirals such as our engineered ACE2-Fc to surmount and achieve protection. Despite these limitations, we detected a strong benefit to the administration of ACE2740 LFMYQY2HA–Fc GASDALIE variant both prophylactically and therapeutically in K18-hACE2 mice. In both settings, ACE2-Fc treatments were associated with markedly improved in vivo efficacy, e.g., a reduction in virus-induced body weight loss, pro-inflammatory cytokine responses and mortality, particularly in the therapeutic context. Given the human Fc-mouse FcγR mismatch may compromise Fc-effector functionality of ACE-Fcs in K18-hA...

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 56, 51 and 60. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

I would be cautious with the interpretation of Jiang et al. paper since the expressed spike proteins contains his-tag and the authors IMO didn't do a proper control so one can't exclude that the effect(s) seen it due to the his-tag.

Yes! Will this include margin notes taken with digital ink that is then recognized by OCR? (e.g. like myscript/kobo is doing). That would be truly transformative. Much more personal and flexible than typing some stuff into the margins.

https://www.amazon.com/Blog-Paper-Advanced-Taking-Technology/dp/1926892100/

Doing some research for my Paper Website / Blog.

Similar to some of the pre-printed commonplace books of old particularly with respect to the tag and tag index sections.

I sort of like that it is done in a way that makes it useful for general life even if one isn't going to use it as a "blog".

How can I design mine to be easily photographed and transferred to an actual blog, particularly with Micropub in mind?

Don't forget space for the blog title and tagline. What else might one put on the front page(s) for identity? Name, photo, address, lost/found info, website URL (naturally)...

Anything else I might want to put in the back besides an category index or a tag index? (Should it have both?)

tumbarumba = tmesis in Australia

dmq public Annotations

SciScore for 10.1101/2021.11.02.466951: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blots were then probed with SARS-CoV-2 spike antibody (NR-52947, BEI Resources, NIAID, NIH) in blocking buffer for 12 hr at 4°C, followed by secondary Goat Anti-Rabbit IgG antibody (ab6721, Abcam, RRID:AB_955447) incubation for 2hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>detected: (Abcam Cat# ab6721, RRID:AB_955447)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Actin was labelled using antibody against beta-actin [AC-15] (HRP) (ab49900, Abcam, RRID: AB_867494).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against beta-actin</div><div>detected: (Abcam Cat# ab49900, RRID:AB_867494)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293 cells were transfected with 100 ng/well of pGL3-Fluc plasmid using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol at around 75-90% confluency in a 96 well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus: The following cell lines were used in this study, namely HEK 293T cells (CRL-1573, ATCC, RRID: CVCL_0045)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>detected: (NIH-ARP Cat# 103-306, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HEK 293T cells stably expressing human ACE2 (NR-52511, BEI Resources, NIAID, NIH, RRID:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Vero-E6 cells (CRL-1586, ATCC, RRID: CVCL_0574).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>detected: (IZSLER Cat# BS CL 87, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NR-52282, BEI Resources, NIAID, NIH) was propagated and quantified by plaque assay in Vero-E6 cells as described before (Case et al., 2020)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytotoxicity assay: HEK-ACE2 cells were seeded in 0.1 mg/mL poly-L-lysine (P9155-5MG, Sigma-Aldrich) coated 96-well plate to reach 70-80% confluency after 24 Hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus infection: HEK ACE2 cells were seeded in poly-L-lysine coated 24-well plate to reach 80% confluency at the time of infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp1 expression and purification: The gene construct encoding the Nsp1 from SARS-CoV-2 in pCDNA 5-3X-Flag-Nsp1 was amplified and sub-cloned into pET28a with N-terminal His-tag (Schubert et al., 2020; Thoms et al., 2020) using appropriate primers (Supplementary table 1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA 5-3X-Flag-Nsp1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET28a</div><div>suggested: RRID:Addgene_114156)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">the cultures were then transferred at 16°C at 120 rpm, and the expression of pET28a-His-Nsp1 and pET28a-His-Nsp1Δ40 were induced by adding 1 mM of Isopropyl β-d-1-thiogalactopyranoside (IPTG) and allowed to grow for 18 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a-His-Nsp1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET28a-His-Nsp1Δ40</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293 cells were transfected with 100 ng/well of pGL3-Fluc plasmid using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol at around 75-90% confluency in a 96 well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGL3-Fluc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid expressing the Nsp1 protein (pcDNA 3.1-Nsp1) was co-transfected at 100 ng/well concentration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA 3.1-Nsp1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 48 hr incubation, cells were fixed with 4% paraformaldehyde, and crystal violet (C6158, Merck) staining was done to visualize the plaques. Plasmids: pLVX-EF1alpha-SARS-CoV-2-nsp1-2xStrep-IRES-Puro expressing SARS CoV-2 NSP1 was a kind gift from Prof. Nevan Krogan (Gordon et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-nsp1-2xStrep-IRES-Puro</div><div>suggested: RRID:Addgene_141367)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other plasmids used in this study include Plasmids pRL-TK (mammalian vector for weak constitutive expression of wild-type Renilla luciferase), pGL4 (mammalian vector expressing firefly luciferase), pIFN-β Luc (IFN beta promoter-driven firefly luciferase reporter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRL-TK</div><div>suggested: RRID:Addgene_11313)</div></div><div style="margin-bottom:8px"><div>pGL4</div><div>suggested: RRID:Addgene_48744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pMTB242 pcDNA5 FRT-TO-3xFLAG-3C-Nsp1_SARS2 was a kind gift from Prof. Ronald Beckmann.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMTB242</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the library was screened against the 18S rRNA interacting interface of Nsp1-C-ter using the Surflex-dock program, which is available in SYBYL v2.1 (Jain, 2003).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Surflex-dock</div><div>suggested: (Surflex-Dock, RRID:SCR_000196)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was analysed by using ThermControl software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermControl</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The two subsequent 100 ns runs from MD simulations were further subjected to perform the MM-PBSA by using the python script (mmpbsa.py) to calculate the binding energy of the two drugs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative intensity of bands was quantified using Fiji/imageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji/imageJ</div><div>suggested: None</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.29.466470: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Monoclonal antibodies MAb362 isotypes IgG1 and IgA1 has been described before(32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">REGN10987, S309 and CR3022 antibodies heavy and light variable region sequences(33, 34, 58) were synthesized and cloned into pcDNA3.1 vector (Invitrogen™, Thermo Fisher Scientific, Waltham, MA, USA) in-frame with human IgG heavy or light chain Fc fragment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 2G12 monoclonal antibody was expressed in ExpiCHO-S™ cells through co-transfection of plasmids encoding light and IgG heavy chains(59), using the ExpiFectamine™ CHO transfection kit (Gibco™, Thermo Fisher Scientific, Waltham, MA, USA) according to manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>2G12</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies 4A8 and 1A9 were purchased from BioVision (Milpitas, CA, USA) and GeneTex (Irvine, CA, USA), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1A9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-6x-His-tag polyclonal antibody, and both HRP-conjugated anti-mouse IgG Fc and anti-human IgG Fc were purchased from Invitrogen™ (Waltham, MA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-6x-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used a rabbit anti-6X-His antibody (Invitrogen™, Waltham, MA, USA) to detect histidine-tagged proteins or mouse 1A9 antibody (GeneTex, Irvine, CA, USA) for specific detection of SARS-CoV-2 SΔTM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6X-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were washed three times with PBS-T and then incubated with secondary HRP-conjugated anti-rabbit IgG (Abcam, Cambridge, UK) or anti-mouse IgG (Invitrogen™, Waltham, MA, USA) antibodies diluted in 0.5% (w/v) skim milk/PBS-T and incubated for one hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibodies, HRP-conjugated anti-human kappa antibody (SouthernBiotech, Birmingham, AL, USA) diluted 1:4000 in PBS was used in wells treated with MAb362, CR3022 and S309 antibodies, while HRP-conjugated anti-human IgG Fc (Invitrogen™, Waltham, MA, USA) diluted 1:10,000 in PBS was used in wells treated with REGN10987, 4A8 and 2G12 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human kappa</div><div>suggested: (Abgent Cat# AT4000a, RRID:AB_1554597)</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1). smFRET imaging: Labeled SΔTM spikes (100-200 nM) were incubated in the absence or presence of unlabeled ACE2 or the indicated antibody at a monomer:ACE2 or monomer:antibody ratio of 1:3 for 90 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two-tailed nonparametric Spearman test with 95% confidence was performed to evaluate the correlation level between the occupancy of SΔTM in the open conformation due to allosteric antibody binding and ACE2 binding (Figs. 4 and 5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2 binding (Figs. 4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">glycoprotein ectodomain (SΔTM) (residues Q14–K1211) with SGAG substitution at the furin cleavage site (R682 to R685), and proline substitutions at K986 and V987, was synthesized by GenScript® (Piscataway, NJ, USA) and inserted into pcDNA3.1(−).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SΔTM hetero-trimers for smFRET experiments were expressed by co-transfection with both the untagged SΔTM (D614 or D614G) construct and the corresponding 161/345A4-tagged SΔTM plasmid at a 2:1 molar ratio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SΔTM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SΔTM concentration was also estimated by densitometric analysis of protein bands on immunoblots with the monoclonal antibody 1A9 as described below, and using ImageJ software v1.52q (NIH, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All smFRET data were processed and analyzed using the SPARTAN software (www.scottcblanchardlab.com/software) in Matlab (Mathworks, Natick, MA, USA)(65).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">smFRET trajectories were idealized to a 3-state hidden Markov model and the transition rates were optimized using the maximum point likelihood algorithm(66), implemented in SPARTAN.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPARTAN</div><div>suggested: (SPARTAN, RRID:SCR_014901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dissociation constants (KD) were determined using GraphPad Prism version 9.2.0 (GraphPad Software, San Diego, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural analysis: Protein structures from RCSB PDB were visualized and analyzed using PyMOL™ software version 2.0.7 (The PyMOL Molecular Graphic System,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL™</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• No funding statement was detected.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.15.468737: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 nsp12, nsp10 and nsp7 gene were cloned into a modified pET-21b vector with the C-terminus possessing a 6×His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-21b</div><div>suggested: RRID:Addgene_132607)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nsp8 gene was cloned into the modified pET-32a vector with the N-terminus possessing a trx-His6-tag and PreScission Protease site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-32a</div><div>suggested: RRID:Addgene_120288)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nsp7-pET-21b plasmid was transformed into E. coli Rosetta-gami2 (DE3) and the transformed cells were cultured at 37 °C in LB with a final concentration of 100 μg/ml ampicillin and 25 μg/ml chloramphenicol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nsp7-pET-21b</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nsp14 gene (nsp14-ExoN (residues 1–289)) was cloned into the modified pET-28b vector with the N-terminus possessing a MBP-tag and PreScission Protease site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28b</div><div>suggested: RRID:Addgene_47327)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR product was digested with Xho1 and BamH1 and ligated into pET-15b vector, and transformed into E-coli DH5α to obtain clones.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-15b</div><div>suggested: RRID:Addgene_108953)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.08.467773: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Mouse studies: Mouse studies were conducted at Murigenics (Vallejo, CA) under IACUC approved protocols.<br>IACUC: Mouse studies: Mouse studies were conducted at Murigenics (Vallejo, CA) under IACUC approved protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Balb/c mice (Envigo), 6–8 weeks old were used for all studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked for 1h in 5% skim milk in TBST and then probed with an anti-S2 mouse monoclonal antibody (GeneTex) at a 1:1000 dilution for 2h-overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were washed (0.05% Tween 20 in 1X TBS) and then probed with a Rabbit anti-Mouse HRP antibody (Bethyl labs) for 1h before washing and detection with a SuperSignal West Femto Maximum Sensitivity Substrate (Pierce).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Mouse HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A parallel blot using a mouse anti-actin antibody (Thermo Fisher) was used to ensure equivalent protein amounts per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracellular staining was performed in FACS buffer (PBS + 2% FBS + 2mM EDTA) with the following antibodies: CD4 (GK1.5, Biolegend), CD8 (53-6.7, BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular staining was then performed in permeabilization buffer with the following antibodies: IFNγ (XMG21.2, Invitrogen), TNFα (MP6-XT22, eBiosciences), IL2 (JES6-5H4, eBiosciences), IL4 (11B11, Biolegend), IL10 (JES5-16E3, Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JES5-16E3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The intensity of the light being emitted is inversely proportional to the amount of anti-SARS-CoV-2 neutralizing Spike antibodies bound to the VSVΔG – Spike ΔCT particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 neutralizing Spike</div><div>suggested: (Creative Diagnostics Cat# CABT-CS064, RRID:AB_2891088)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated with anti-nucleocapsid protein primary antibody cocktail (clones HM1056 and HM1057) (EastCoast Bio, North Berwick, ME) for 60 minutes at 37°C (Battelle Memorial Institute, Patent Number 63/041,551 Pending, 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed and the secondary antibody (goat anti-mouse IgG Horse Radish Peroxidase (HRP) conjugate; Fitzgerald, North Acton, MA) was added to the wells, and the plates were incubated for 60 minutes at 37°C1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed and incubated with 25 μL of 1 μg/mL SULFO-TAG labeled anti-species antibody (MSD), diluted in DPBS + 1% BSA (Sigma-Aldrich, St. Louis, MO), for 1 hour at room temperature on an orbital shaker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MSD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis: HEK293F cells seeded at 5e5 cells/mL were infected with an MOI of 1 IU/cell.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VSVΔG virus was transduced in HEK293T cells previously transfected with the spike glycoprotein of the SARS-CoV-2 coronavirus (Wuhan strain) for which the last 19 amino acids of the cytoplasmic tail were removed (ΔCT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation of the serum/plasma-pseudotyped virus complex, the serum/plasma-pseudotyped virus complex was transferred to the plate containing Vero E6 cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female Balb/c mice (Envigo), 6–8 weeks old were used for all studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence of a E1 (578-3404 bp)/E3 deleted virus (2,125-31,825 bp) was assembled into pUC19 from VR-594-derived and synthetic (SGI-DNA) fragments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC19</div><div>suggested: RRID:Addgene_50005)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pA68-E4d-Spike plasmids were linearized, purified using a Nucleospin kit (Machery-Nagel) and transfected into 2 mL of 293F cells (0.5 mL/mL) using TransIT-Lenti (Mirus bio).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pA68-E4d-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike sequences were PCR amplified and cloned into PacI/BstBI sites of a pUC02-VEE vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC02-VEE</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vector generation: The ChAd68 nucleotide sequence was based on the wild-type sequence obtained by MiSeq (Ilumina sequencing) of virus obtained from the ATCC (VR-594).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of flow cytometry data was performed using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing was performed using the R programming language and graphed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03639714</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of a Personalized Neoantigen Cancer Vaccine</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03953235</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of a Personalized Cancer Vaccine Targeting Shared Ne…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04776317</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Chimpanzee Adenovirus and Self-Amplifying mRNA Prime-Boost P…</td></tr></table>

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.25.465714: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The KYODOKEN Institutional Animal Care and Use Committee approved the protocols for these studies (approval number 20200312) and monitored health conditions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">half-siblings—a 19-month-old male named “Puta” and a 19-month-old female named “Christy”—were immunized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blotted membranes were incubated overnight at 4°C with the C9 antibody or the C-terminally 6×His-tagged homodimer of nanobodies—the dilution ratios of P158, P334, and P543 were 1:5000, 1:1000, and 1:2500, respectively—in Tris-buffered saline (TBS, pH 7.4) containing 0.005% Tween 20 (TBST) and 5% skim milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C9</div><div>suggested: (LSBio (LifeSpan Cat# LS-C9-1000, RRID:AB_1276501)</div></div><div style="margin-bottom:8px"><div>P334</div><div>suggested: (Leinco Technologies Cat# P334, RRID:AB_2831621)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the case of nanobody-based blotting, after 3 washes with TBST, the membranes were incubated with 1:5000-diluted anti-His-tag antibody (MBL) in TBST containing 5% skim milk at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membranes were soaked with 1:5000-diluted HRP-conjugated anti-rabbit or anti-mouse IgG secondary antibodies (GE Healthcare) in TBST containing 5% skim milk for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-6×His-tagged antibody-positive fractions were gathered and concentrated via VIVAspin 6 size exclusion columns (30,000-MWCO) to reach a volume under 0.5 ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-6×His-tagged</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 3 washes with PBST, HRP-conjugated anti-alpaca VHH antibody (Jackson) at a dilution of 1:5000 was reacted at room temperature for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-alpaca VHH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the cells were incubated with an anti-His antibody (Abcam) on ice for 30 min and then Alexa 647-conjugated anti-rabbit IgG (Dako).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBST, an appropriately diluted anti-His-tagged antibody and anti-C9-tagged antibody in blocking buffer were added and reacted at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tagged</div><div>suggested: (StressMarq Biosciences Cat# SPC-167, RRID:AB_2703750)</div></div><div style="margin-bottom:8px"><div>anti-C9-tagged</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: HEK and K562 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM: Invitrogen) supplemented with 10% foetal bovine serum (FBS) and antibiotics (1% penicillin and streptomycin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus production: HIV-1-based SARS-CoV-2 spike pseudotyped virus was prepared as follows: LentiX-HEK293T cells were transfected using a polyethyleneimine transfection reagent (Cytiva) with plasmids encoding the C-terminally C9-tagged full-length SARS-CoV-2 spike variants (original, alpha, beta, and delta) and HIV-1 transfer vector encoding a luciferase reporter, according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LentiX-HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopy analyses for cell staining: HEK cells were transiently transfected with plasmids encoding the C-terminally C9-tagged full-length SARS-CoV-2 spike variants using Lipofectamine 3000 (Thermo) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vector of the SARS-CoV-2 S2 domain (residues 744-1213) was constructed by removing an N-terminal part of the extracellular domain of the SARS-CoV-2 spike (residues 31-743) and subcloned into the pcDNA3.1(+) vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1 ( + )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthesized genes were subcloned in the pMES4 vector to express N-terminal PelB signal peptide-conjugated and C-terminal 6×His-tagged nanobodies into the bacterial periplasm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMES4</div><div>suggested: RRID:Addgene_98223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vector pWPI-IRES-Bla-Ak-ACE2-TMPRSS2 was acquired from AddGene (plasmid #154983).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pWPI-IRES-Bla-Ak-ACE2-TMPRSS2</div><div>suggested: RRID:Addgene_154983)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">coli TG1 cells (Agilent Technologies Japan, Ltd., Tokyo, Japan) were transformed with the ligated plasmids under chilled conditions (Bio-Rad Laboratories, Inc., Hercules, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data of reads were trimmed of the adaptor sequence using cutadapt v1.1859, and low-quality reads were subsequently removed using Trimmomatic v0.3960.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The remaining paired reads were merged using fastq-join61 and then translated to the amino acid sequences using EMBOSS v6.6.0.062.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBOSS</div><div>suggested: (EMBOSS, RRID:SCR_008493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, unique amino acid sequences in each library were counted using a custom Python script combining seqkit v0.10.163 and usearch v.1164.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM image processing and refinement: The images were processed using RELION 3.169.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were motion corrected using MotionCor270, and the contrast transfer functions (CTFs) were estimated using CTFFIND 4.171.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CTFFIND</div><div>suggested: (CTFFIND, RRID:SCR_016732)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were imported and further processed with non-uniform refinement in cryoSPARC v3.2.072.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the models were manually fitted into the density using UCSF Chimera v1.1573 and modified in Coot v0.8.9.274, real space refinement was performed in PHENIX v1.19.175.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were prepared using UCSF Chimera73, ChimeraX77, and PyMOL v2.5.0 (Schrödinger, LLC, New York, NY).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The program refmac582 in the ccp4 suite83 and the program Phenix-refine75 were used for structural refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ccp4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.13.468472: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals that lost more than 25% of their initial body weight were euthanized in accordance with our animal ethics protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Two groups of ferrets (5 female and 5 male ferrets in the vaccine group and 3 female and 3 male ferrets in the control group) were immunized intranasally with a single-dose 1×106 PFU of dNS1-RBD and CA04-WT virus respectively diluted in 1640 media to a final 500 μL volume.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were separated on a 10% gel, and then following transfer, blots were incubated with an anti-influenza A NP protein antibody 19C10 generated by our laboratory (1:1000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-influenza A NP protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">and anti-V5 tag antibody (Thermo,1:5000) and visualized with horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Invitrogen, 1:5000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C69682-5000, RRID:AB_1653096)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Based on the ELISA results using a sandwich assay with anti-RBD monoclonal antibodies on both sides (Wantai, Beijing, China) and plaque assay results, serial passages 1 to 10 of purified vaccines were confirmed to be stable under current vaccine manufacturing conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-RBD IgG measurements: RBD-specific antibody titers in serum samples collected from immunized animals with 1×106 PFU of vaccine were determined by indirect ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diluted sera (1:100) were successively diluted in a 2-fold series and applied to each well for 1 h at 37°C, followed by incubation with goat anti-mouse, anti-hamster or anti-human antibodies conjugated with HRP for 1 h at 37°C after 3 washes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were stained with murine antibodies for phenotype and activation (CD4 [clone GK1.5, APC/Cy7], CD8 [clone 53-6.7, PerCP/Cy5.5], CD11b [clone M1/70, PE], CD11c [clone N418, BV421],</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (Miltenyi Biotec Cat# 130-109-536, RRID:AB_2657974)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD11b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD11c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BV421</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunohistochemical staining was performed by using a mouse monoclonal anti-SARS-CoV-2 N protein antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney cells (293T), African green monkey kidney epithelial cells (Vero E6), and Madin-Darby canine kidney cells (MDCK) were maintained in DMEM-high glucose (Sigma Aldrich, USA) supplemented with 10% low endotoxin FBS (Cegrogen Biotech, Germany) and penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and passage of dNS1-RBD viruses: Eight pHW2000 plasmids containing the DelNS1 segment and the other seven influenza virus genomic segments, together with an NS1 expression plasmid, pCX-CA04-NS1-Flag, which derived from the parental influenza virus A/California/04/2009(H1N1) (GenBank: MN371610.1-371617.1), were transfected into 293T cells and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 titration assay: Live virus titers in homogenized lung tissues and cell cultures were measured by the standard TCID50 method in Vero E6 cells seeded in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization and infection of mice: BALB/c mice were immunized intranasally with 50 μL containing 1×106 PFU of the vaccine prepared as indicated above under isoflurane anesthesia, while the control group was administered CA04-WT or CA04-dNS1 virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For cellular immune response analyses of PBMCs, splenic lymphocytes, pulmonary lymphocytes and lymph node cells, C57BL/6 mice (6-8 weeks old) were immunized intranasally with 1×106 PFU of the vaccine by the one-dose or two-dose regimen as described above (10 animals in each group).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization and infection of hACE2-KI/NIFDC mice: hACE2-KI/NIFDC mice (8-10 weeks old) were divided into three groups and treated intranasally with 1×106 PFU of the vaccine by gently adding 50 μL droplets of virus stock for the vaccine-immunized group (5 animals) at two time points (days 0 and 14), and then, the vaccine-immunized group and unvaccinated group (3 animals each) were challenged with 1×104 PFU of SARS-CoV-2 by the intranasal route 30 days post immunization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-KI/NIFDC</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence encoding the RBD segment was then cloned into the NS1 deletion plasmid pHW2000-DelNS1 as described previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHW2000-DelNS1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and passage of dNS1-RBD viruses: Eight pHW2000 plasmids containing the DelNS1 segment and the other seven influenza virus genomic segments, together with an NS1 expression plasmid, pCX-CA04-NS1-Flag, which derived from the parental influenza virus A/California/04/2009(H1N1) (GenBank: MN371610.1-371617.1), were transfected into 293T cells and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHW2000</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCX-CA04-NS1-Flag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were analyzed by FlowJo V10.6.0 and GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was assigned when P values were < 0.05 using GraphPad Prism 8.0 (GraphPad Software, Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.31.466651: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sample collection, preparation, and storage: All studies were approved by the Institutional Review Board of Washington University in St Louis.<br>IRB: Sample collection, preparation, and storage: All studies were approved by the Institutional Review Board of Washington University in St Louis.<br>Consent: Written consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For selection, where a clone spanned both the GC and LNPC compartments, and/or multiple time points, a compartment and a timepoint were first randomly selected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated goat anti-human IgG (H+L) antibody (Jackson ImmunoResearch, 109-035-088, 1:2500) was used to detect monoclonal antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-088, RRID:AB_2337584)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated goat anti-Human IgG Fcγ fragment (Jackson ImmunoResearch, 109-035-190, 1:1500), HRP-conjugated goat anti-human serum IgA α chain (Jackson ImmunoResearch, 109-035-011, 1:2500), and HRP-conjugated goat anti-human IgM (Caltag, H15007, 1:4000) were used to detect plasma antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human serum IgA α chain</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-011, RRID:AB_2337580)</div></div><div style="margin-bottom:8px"><div>anti-human IgM (Caltag, H15007</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, a mammalian cell codon-optimized nucleotide sequences coding for the soluble version of S (GenBank: MN908947.3, amino acids 1-1,213) including a C-terminal thrombin cleavage site, T4 fold trimerization domain and hexahistidine tag was cloned into the mammalian expression vector pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed using FlowJo v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">V(D)J gene annotation and genotyping: Initial germline V(D)J gene annotation was performed on the preprocessed BCRs using IgBLAST v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.17.138 with IMGT/GENE-DB release 202113-239.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/GENE-DB</div><div>suggested: (IMGT/GENE-DB, RRID:SCR_006964)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCR analysis: BCR analysis was performed in R v4.1.0 with visualization performed using base R, ggplot2 v3.3.544, and GraphPad Prism v9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Clonal overlap between B cell compartments was visualized using circlize v.0.4.1345.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>circlize</div><div>suggested: (circlize, RRID:SCR_002141)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees for S+ clones containing BMPCs were constructed on a by-participant basis using IgPhyML v1.1.346 with the HLP19 model47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgPhyML</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene annotation on human reference chromosomes and scaffolds in Gene Transfer Format (‘gencode.v32.primary_assembly.annotation.gtf’) was downloaded (2021-06-02) from GENCODE v3252, from which a biotype (‘gene_type’) was extracted for each feature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENCODE</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control was performed as follows on the aggregate gene expression matrix consisting of 360,803 cells and 36,601 features using SCANPY v1.7.253 and Python v3.8.8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

A potential limitation to our analyses of S-binding clones is that our selection strategy may have excluded some low-abundance or low-affinity S-specific clones. Nonetheless, we were able to account for 45% and 67% of all GC B cell and LNPC clones, respectively identified by scRNA-seq. This is the first study to provide direct evidence for the induction of antigen-specific BMPCs by an mRNA-based vaccine in humans. Notably, none of the 11 participants from whom post-vaccination bone marrow specimens were examined had a history of SARS-CoV-2 infection. BMPCs that recognized contemporary seasonal influenza virus vaccine antigens and diphtheria/tetanus vaccine antigens were present at frequencies roughly 10- and 2-fold greater than those against SARS-CoV-2 S, respectively. This is likely due to both the greater number of antigenic targets contained in the former vaccines and the repeated exposures to influenza and tetanus/diphtheria vaccine antigens our study participants likely experienced in comparison to the initial exposure to the novel SARS-CoV-2 S antigen. There are some epitopes within the S protein that are conserved between human seasonal coronaviruses and SARS-CoV-228,29. Cross-reactive B cells targeting these epitopes participate in PB and GC B cell responses to SARS-CoV-2 vaccination6,30. It is unlikely, however, that a substantial proportion of the SARS-CoV-2 S+ BMPCs we observed six months after immunization were part of a pre-existing pool of BMPCs, as in a previou...

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.29.466401: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against the His-tag (1:2000, Invitrogen) were followed by secondary HRP conjugated antibodies (1:2000, Dako, Denmark), for detection of both proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sf9 cells transfected by following were used to express the S protein by following bac-to-bac baculovirus expression system (Thermo Fisher, SG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: CLS Cat# 604328/p700_Sf9, RRID:CVCL_0549)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S, SARS-CoV-2 S1 and two variants of SARS-CoV-2 S2 proteins, produced by ACROBiosystems (USA), were used for BN-PAGE, MST and to stimulate THP-1 cells and for in vivo experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: CLS Cat# 300356/p804_THP-1, RRID:CVCL_0006)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse inflammation model and in vivo imaging: BALB/c tg (NF-B-RE-Luc)-Xen reporter mice (Taconic Biosciences, Albany, NY, USA, 10– 12 weeks old) were used to study the immunomodulatory effects of SARS-CoV-2 S protein subunits alone or in combination with LPS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The image was obtained using a Gel Doc Imager (Bio-Rad Laboratories,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial coordinates of E. coli lipid A and LPS were obtained from CHARMM-GUI LPS modeller,62 while the initial coordinates of the S protein were extracted from the cryo-EM structure of S ECD in the closed state (PDB: 6XR8)23 with missing loops constructed using Modeller version 9.21.63 Protein and lipid were parameterized using the CHARMM36 forcefield.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">70 All simulations were performed using GROMACS 201871 and the trajectories visualised in VMD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.11.11.468228: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzymatic assays: NEMO peptide expression and purification: The constructs of Human NEMO (residues 215-247) and mouse NEMO (residues 221-250) cloned into pGEX-6p-1 vector were transformed into BL21 (DE3) cells and selected using ampicillin-enriched LB media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEX-6p-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3CLpro expression and purification: 3CLpro WT enzyme for assays was prepared independently from a clone of the SARS-CoV-2 NSP5 gene in pD451-SR (Atum, Newark, CA) according to published procedure 6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pD451-SR</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bands were visualized with BullDog Bio Acquastain. 5.2. Crystallography: 3CLpro WT expression and purification: BL21(DE3) cells were transformed with pMCSG53 pDNA containing a 3CLpro WT insert with an autoprocessing-sensitive N-terminal Maltose Binding Protein (MBP) tag and a PreScission protease-sensitive C-terminal His6 tag (provided by Andrzej Joachimiak).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMCSG53 pDNA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative refinement was performed manually in Coot 51 and REFMAC 52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All bonds of the peptide were kept rigid as the goal was to preserve the initial conformation and compute the binding free energy using the AutoDock Vina scoring function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDock</div><div>suggested: (AutoDock, RRID:SCR_012746)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

Racism happens between different racial groups, but sexism can happen in the same racial group. Black women bear the tag"black" and "women", so they may encounter more discrimination than other groups.

daughters are the shelther wokers

https://collect.readwriterespond.com/antennapod/

I feel your pain here Aaron.

Perhaps it helps, perhaps not, but I've been using AntennaPod for a few years now. In particular I love it on Android because I can use the share functionality to share to a custom email address which posts to reading.am for an account that aggregates everything I'm listening to. Then I port the RSS feed of that back into my site. It's a stupid amount of manual work, but it mostly works.

Alternately you could share material you listen to to Huffduffer and pull data out that way as well. My problem here is that Huffduffer is more of a bookmark service than a "listened to this" sort of service, though you could always add a "listened" tag to the things you've heard in the past.

The tougher part of all this is that podcasts have "canonical" links for the podcast episodes (sometimes) and an entirely different link for the audio file which has no meta data attached to it (presuming you can even find the URL for the audio file to begin with.)

AntennaPod allows you to pick and choose what you want to share, so usually I default to the audio file to get that in to the workflow and finding/adding the data for the particular episode is a bit easier.

I will say that this is one of the ugliest and most labor intensive workflows I've got for social posts, so I'm usually only doing it and posting publicly for things that I really think are worth the time that make for interesting notes/observations that go along with the post.

I'm curious to see what others come up with for this workflow.

Reviewer #3 (Public Review):

The emergence of AR-V7 and other AR splice variants in patient tumors has been shown to track with inferior response to AR targeted and chemotherapies in prostate cancer. Using a series of sophisticated imaging techniques the authors have determined that the AR-V7 uses a mechanism for nuclear import distinct from the FL-AR and the AR-V567 variant. AR-V7 also appears to have very fast intranuclear mobility, a characteristic shown to be associated with antagonist bound AR and yet AR-V7 efficiently activates transcription of a reporter gene and at least a subset of AR target genes. This study provides new insights into how AR-V7 may contribute to the pathology of CRPC.<br> Although it is well accepted that the AR-Vs serves as a strong biomarker for resistance to antiandrogen treatment, it is still being debated as to whether and how AR-Vs contribute to the pathology of castration resistance prostate cancer. In this regard, significant efforts have been invested to understand how these splice variants work and how to best target them. Several models of have been proposed, some of which suggested that the AR-Vs can dimerize with the full-length (FL) receptor and require FL-AR for activity, others indicated that AR-V has unique activities independent of FL-AR. Using a series of sophisticated imaging techniques, the authors have addressed some of these unresolved issues in the field, in particular determining that AR-V7 uses a mechanism for nuclear import distinct from the FL-AR and the AR-V567 variant. AR-V7 also appears to have very fast intranuclear mobility, a characteristic shown to be associated with antagonist bound AR; and yet, AR-V7 efficiently activates transcription of a reporter gene and at least a subset of AR target genes. Overall, this is a valuable study, and the authors are to be commended for the high-quality figures and illustrations. Specific strengths include the following points:

1. It has been observed that the AR-V7 predominantly resides in the nucleus; however, the mechanism(s) by which AR-V7 used for nuclear import is not clear. Using live imaging combined with pharmacological and genetic approaches the authors have determined that the importin / complex is required for FL-AR, but not AR-V7 nuclear import. However, nucleoporin complex and Ran-GTP activity are required for FL-AR import, as expected, and are at least partially required for AR-V7 nuclear accumulation. These series of studies have confirmed previously finding that AR-V7 uses a mechanism for nuclear import, distinct from the FL-AR and the AR-V567 variant.

2. Using mutagenesis of the D-box and DNA binding mutants, the authors have also contrasted the structural requirements within FL-AR vs AR-V7 for nuclear localization and transcription. It was determined that the dimerization surface is required for AR-V7 nuclear retention but is dispensable for FL-AR. However, disruption of DNA binding with a single point mutation has demonstrated that DNA binding is not an obligatory step for FL-AR and AR-V7 nulcear retention. This series of experiments have enhanced our understanding of the nuclear cytoplasmic dynamics of AR-V7 and how it differs from FL-AR and suggests that interfering with the dimerization interface may be a means by which AR-V7 can be targeted.

3. Using FRAP and photoconvertible fluorescent protein tag, the authors were able to track the intranuclear dynamics of AR and AR-V7 in real time, which is a strength of this study. They have determined that AR-V7 has higher sub-nuclear mobility compared to FL-AR and that DNA binding is required for even the short residence time of this mutant AR on the chromatin. Together these data suggested that AR-V7 and FL-AR may use different means to activate transcription.

There are some weaknesses that could be addressed to improve the work:

1. Most of the studies were done in PC3 AR negative cell line. It would be helpful to confirm some the key findings in AR positive cell line as the import mechanism may not be the same in AR negative vs AR-positive cell lines.

2. In Figure 2 and 3 where authors used mutagenesis to determine the structural requirements of FL-AR and AR-V7 for nuclear import/retention. These studies used nuclear:cytoplasmic ratios as readouts, not transport kinetics, and thus the observed changes in N/C ratios could be the results of changes in nuclear export and should be discussed appropriately.

3. The observation that co-expression of AR-V7 increased nulcear FL-AR in the absence of ligand is interesting. The fact that IPZ interferes with nuclear accumulation of FL-AR in the presence of AR-V7 indicated that FL-AR import still requires importin but does not rule out the possibility that FL-AR via its dimerization with AR-V7 within the nucleus could lead to increased retention of FL-AR within the nucleus, a possibility that the authors should consider.

4. The authors used ChIP assays to confirm the fast chromatin mobility of AR-V7 they have observed using FRAP, however ChIP efficiency could differ significantly using different antibodies and the results should be discussed with caution. Although the authors tried to confirm the same using chromatin bound fraction as another readout for transient chromatin binding of AR-V7, it was unclear why the authors didn't use endogenous AR-V7 in 22RV1 cells to look at chromatin bound fraction, as overexpressed protein may have different behavior compared to endogenous protein.

Relational tags

la omt en 1994 definió turismo como “las actividades que realizan las personas durante sus viajes y estancias en lugares distintos al de su entorno habitual, por un período de tiempo consecutivo inferior a un año con fines de ocio, por negocios y otros” (Sancho, 1998, p. 11).<

MI COMENTARIO:

annotation meta: may need new tag: company [aspiring] to be bigger / take over the world

An important list of pk2b & web-tag problems:

• cannot search user activity & annotations; less so when offline
• half-baked UX
• cannot integrate apps, across platforms, desktop/mobile, cloud/local.
• What if sites disappear (next chapter)?

Also apparently by group!

Look for your group ID code and stick it in the equation. https://hypothes.is/stream.rss?group=[yourgroupscode]

or combine them!! https://hypothes.is/stream.rss?user=[yourusername]&tag=[tagnameyouresearchingfor]

How, in this case, Hannah would refer to an image from within the description?

What about the emergence of non-hierarchal methods? (Can these logically be sorted somehow without this structure?)

With digital commonplacing methods, I find that I can sort and search for things temporally by date and time as well as by tag/heading.

Cross reference:

• https://www.heise.de/newsticker/meldung/Missing-Link-Luhmanns-Denkmaschine-endlich-im-Netz-4364512.html#annotations:ed1DZDnAEeyWdbsat73FrA
• http://takingnotenow.blogspot.com/2007/12/luhmanns-zettelkasten.html#annotations:IBHItPaBEeuVb1Nwojnj3Q

Since they give the students no restrictions on what to write about, it resulted in having many "thematic tags. It is amazing how the types were varied.

Of course someone has published a zettelkasten notebook for taking notes to be moved into one's zettelkasten at a later date.

It includes space for notes as well as meta data box which includes labels and spaces for the following:

• UID
• Parent UID
• Zettel
• tags
• refs

It's also got (at least one) page for an index in the end titled "tag list" with a two column ruling

This follows the general pattern of pre-printed commonplace books which was common with at least John Locke's index pre-printed.

Other examples include published bullet journals with custom formatting.

SciScore for 10.1101/2021.10.25.21265476: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participant recruitment and study approval – Toronto cohorts: Negative control serum samples were from patients enrolled in cancer studies pre-COVID-19 (prior to November 2019; Mount Sinai Hospital (MSH) Research Ethics Board (REB) studies #01-0138-U and #01-0347-U), which were archived and frozen in the Lunenfeld-Tanenbaum Research Institute (LTRI</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antibody production: The llama single domain antibody (VHH) VHH72-hFc1X7 (VHH72-Fc) was described previously (PDB entry 6WAQ_1) (17); additional VHHs (NRCoV2-04 and NRCoV2-20) were isolated in-house from llamas immunized with recombinant SARS-CoV-2 trimeric spike ectodomain SmT1 (Supplementary Figure 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NRCoV2-20</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH sequences were fused to an antibody-dependent cell-mediated cytotoxicity (ADCC)-attenuated human IgG1 Fc domain (hFc1X7, from patent US 2019 352 383A1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1 Fc domain ( hFc1X7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-human-IgG monoclonal antibodies (mAbs) IgG#5 and IgG#6 were derived from mice immunized with human IgG; heavy chain (HC) and light chain (LC) variable domain sequences (VH and VL) were fused to mouse IgG2a and mouse kappa LC constant sequences, respectively, to express full-length mAbs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>mouse IgG2a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antibody-negative blood was spotted directly from EDTA Vacutainer tubes onto DBS cards.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All matched plasma and contrived DBS samples were tested using the anti-SARS-CoV-2 ELISA IgG kit (EUROIMMUN, Lübeck, Germany), according to the manufacturer’s instructions, to verify that donors were either positive or negative for SARS-CoV-2 antibodies prior to shipping to Toronto and Ottawa.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ELISA IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For spike and its RBD, the recombinant antibodies used were VHH72-Fc IgG (NRC; see above), human anti-spike S1 IgG (clone HC2001, GenScript, #A02038), human anti-Spike S1 IgM (clone hIgM2001, GenScript, #A02046), and human anti-spike IgA (clone CR3022, Absolute Antibody, Oxford, United Kingdom, #Ab01680-16.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike S1 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Spike S1 IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For N, the antibodies used were human anti-nucleocapsid IgG (clone HC2003, GenScript, #A02039)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-nucleoprotein IgM (CR3018 (03-018), Absolute Antibody, #Ab01690 -15.0), and anti-nucleoprotein IgA (CR3018 (03-018), Absolute Antibody, #Ab01690 -16.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleoprotein IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-nucleoprotein IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3018</div><div>suggested: (Imported from the IEDB Cat# CR3018, RRID:AB_2833185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative control antibodies purified from human serum (final 1 µg/mL; human IgG, Sigma-Aldrich, Oakville, ON, Canada,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human secondary antibodies (recombinant anti-human IgG#5-HRP, goat anti-human IgG Fcy-HRP (Jackson ImmunoResearch Labs, West Grove, PA, USA, #109-035-098)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human secondary</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG#5-HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div><div style="margin-bottom:8px"><div>anti-human IgG Fcy-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 100 μL samples of titrations of anti-SARS-CoV-2 S CR3022 Human IgG1 (Absolute Antibody, Ab01680-10.0), anti-SARS-CoV-2 S CR3022 Human IgA (Absolute Antibody, Ab01680-16.0), or anti-SARS-CoV-2 S CR3022 Human IgM (Absolute Antibody, Ab01680-15.0) were diluted in 1% w/v skim milk in PBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S CR3022 Human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Human</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S CR3022 Human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S CR3022 Human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final isotype-specific secondary antibodies used were anti-human IgG#5-HRP (Supplementary Figure 3), anti-human IgA-HRP (Jackson ImmunoResearch Labs, 109-035-011), and anti-human IgM-HRP (Jackson ImmunoResearch Labs, 109-035-129).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA-HRP</div><div>suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two concentrations of secondary antibody IgG#5-HRP (0.09 and 0.18 μg/mL) were assessed using dilution curves of the VHH72-Fc antibody (to detect spike and its RBD) or an anti-N antibody (to detect N; Supplementary Figure 7), and the best concentration (0.18 μg/mL) was further tested on a dilution series of 32 serum samples provided by CBS (Supplemental Figure 8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VHH72-Fc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also tested anti-RBD NRCoV2-04 and NRCoV2-20 recombinant calibration antibodies, which were comparable to VHH72-Fc in reference curves (Supplementary Figure 7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NRCoV2-04</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For chemiluminescent assays, 10 µL of goat anti-human IgM-HRP (1:10,000; 0.80 ng/well) or goat anti-human IgA-HRP (1:12,000, 0.66 ng/well) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein production: Spike trimer: The SARS-CoV-2 spike ectodomain construct (SmT1) with S1/S2 furin site mutations, K986P/V987P prefusion-stabilizing mutations, and human resistin as a trimerization partner (15) was produced using stably transfected Chinese Hamster Ovary (CHO) pools (CHOBRI/2353™ cells) and purified as described (8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHOBRI/2353™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The construct was expressed by transient gene expression in CHOBRI/55E1™ cells as described above (15).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHOBRI/55E1™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH and mAb sequences were synthesized by GenScript using C. griseus codon bias for expression in CHO cells and cloned into the pTT5™ plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2-BAP cDNA was expressed by transient gene expression in CHOBRI/55E1 cells as described (15) with the addition of 5% (w/w) pTT5™-BirA (an Escherichia coli biotin ligase) expression plasmid as described previously (18).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHOBRI/55E1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleocapsid: N cDNA (corresponding to amino acids 1–419 of YP_009724397) was synthesized by GenScript (Piscataway, NJ, USA; using Cricetulus griseus codon bias) with a C-terminal FLAG-Twin-Strep-tag-(His)6 tag and cloned into the pTT5 expression plasmid (NRC) to create NCAP (16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amino acids 331–521 of the SARS-CoV-2 spike protein (YP_009724390.1) corresponding to the RBD were cloned into the pTT5™ vector using EcoRI and BamHI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2-BAP cDNA was expressed by transient gene expression in CHOBRI/55E1 cells as described (15) with the addition of 5% (w/w) pTT5™-BirA (an Escherichia coli biotin ligase) expression plasmid as described previously (18).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5™-BirA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ottawa: Samples from DBS cards were punched manually or in a semi-automated manner using a PerkinElmer DBS puncher (PerkinElmer, Woodbridge, ON, Canada; 3.2 mm discs) or a BSD600 Ascent puncher (BSD Robotics; 3 mm discs) and eluted in 100 μL/disc PBS + 1% Triton X-100 for up to 16 h (minimum 4 h) in 96-well U-bottom plates on a shaker at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Canada</div><div>suggested: (Brain Canada, RRID:SCR_005053)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other data analyses: Plots were generated in R using the ggplot2, lattice, latticeExtra, grid, and gridExtra packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

The authors validated the shRNAs using multiple methods.

The shRNA was infected with a fluorescence tag, called green fluorescent protein or GFP. The infected embryos were then visualized at multiple developmental stages. The treated embryos fully fluoresced green, including the gonads, which indicated that the virus successfully introduced the shRNA to the embryos.

The authors also checked the levels of transcript between the control shRNA- (a non-specific sequence) and Kdm6b shRNA-treated embryo gonads. In the green, GFP+ gonads, the shRNAs specifically reduced Kdm6b by up to 80% when compared to the controls.

A common technique to visualize nucleotide (DNA or RNA) in cells.

A chemical or radioactive label is added to a nucleotide sequence that is complimentary to the sequence of interest. When added to the cells, this complimentary nucleotide sequence will bind to and tag the sequence of interest, allowing scientists to visualize the DNA or RNA of interest within the cell.

You can read more about in situ hybridization methods here: https://www.nature.com/scitable/topicpage/fluorescence-in-situ-hybridization-fish-327/

A widely-used technique used to image proteins on or within cells. It uses antibodies to bind and tag a protein of interest.

The first antibody specifically binds the protein of interest, for example KDM6B. Then, a second antibody carrying a fluorescent dye attaches to the first antibody.

These proteins are visualized using a microscope with lasers. The lasers excite the fluorophore, which in turn emits specific light waves. Here, the KDM6B is marked by the emission of light waves in the green spectrum and beta catenin produces waves in the red spectrum.

Here is a brief introduction to immunofluorescence techniques: https://oni.bio/nanoimager/super-resolution-microscopy/immunofluorescence/

that's nice!

Dónde especificar las plantillas para los menús. Si no usas las tuyas, el paquete usa plantillas por defecto usando bootstrap3

A címkefelhő (tag cloud) egy adott weboldal tartalmára jellemző kulcsszavak látványos, vizuális ábrázolása. Az ábrázolásmódot befolyásolja az adott szó vagy címke valamely tulajdonsága, például a szövegbeli gyakorisága vagy az olvasói használat gyakorisága.

• about : literate programming

this is just leveraging the basic desires of human for social bonding and recognition and also satisfying the ego, we will not break the commitments for the fear of being ostracized by the public

SciScore for 10.1101/2021.10.16.21265096: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Some cleaned Fasta files were also uploaded to SnapGene (version 5.3.2) for multisequence analysis via the MAFFT tool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnapGene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With these factors all considered, an optimal tree was selected from the 21 trees for re-rooting via FigTree (https://github.com/rambaut/figtree/releases/tag/v1.4.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMol structural modeling: The PyMol molecular graphics system (version 2.4.2, https://pymol.org/2/) from Schrödinger, Inc. was used for downloading structure files from the PDB database for further analysis and image export.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were cropped via Adobe Photoshop and further presentation using Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div><div style="margin-bottom:8px"><div>Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pandemic and vaccination data: Pandemic and vaccination data were downloaded from the Our World in Data website (https://ourworldindata.org/explorers/coronavirus-data-explorer?zoomToSelection=true&time=2020-03-01..latest&facet=none&pickerSort=desc&pickerMetric=total_cases&Metric=Confirmed+cases&Interval=Cumulative&Relative+to+Population=false&Align+outbreaks=false&country=~OWID_WRL) as a .csv file for further processing via Excel and figure generation through Prism 9.0 and Adobe Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.13.464050: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and expression vectors: HEK293T cells and SiHa cells were procured from the central cell line repository of RGCB (CCL</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SiHa</div><div>suggested: KCB Cat# KCB 2013026YJ, RRID:CVCL_0032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CaCo-2 cells were obtained from ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CaCo-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DLD-1 cells were obtained from Sigma (Merck #90102540).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DLD-1</div><div>suggested: ECACC Cat# 90102540, RRID:CVCL_0248)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with lenti-ZsGreen (Addgene) and 10 µg of psPAX2 (Addgene) and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19, Addgene) at a ratio of 1:2:1 using the transfection reagent (Lipofectamine 3000, Thermo Fisher Scientific #L3000001).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was added to the HEK293T-HA-ACE2 cells for 4 hours, followed by fresh medium, and wells with IgG served as control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-HA-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunization and serum preparation: BALB/c mice were immunized with purified RBD-His protein expressed in E. coli as per the standard protocol approved by IAEC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Spike S1 Gene with C terminal OFP Spark fluorescent tag (pCMV3-C-OFPSpark) was obtained from Sino biological (#VG40591-ACR)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV3-C-OFPSpark</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Full-length DNA clone of Human angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with C terminal GFPSpark tag (pCMV3-hACE2-GFPSpark) was obtained from Sino biological (#HG10108-ACG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV3-hACE2-GFPSpark</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mammalian expression vector for soluble ACE2 pcDNA3-sACE2 (WT)-sfGFP (#145171) was obtained from Addgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3-sACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The packaging vectors and Lenti ZsGreen were from Addgene (pHIV-Zsgreen #18121</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-Zsgreen</div><div>suggested: RRID:Addgene_18121)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immobilization of GFP Nanobody to Agarose beads: The bacterial expression vector for anti-GFP nanobody pGEX-6P-1 was procured from Addgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGEX-6P-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with lenti-ZsGreen (Addgene) and 10 µg of psPAX2 (Addgene) and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19, Addgene) at a ratio of 1:2:1 using the transfection reagent (Lipofectamine 3000, Thermo Fisher Scientific #L3000001).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pCDNA 3.1_Spike_Del19</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were acquired and analyzed using NIS-Elements software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIS-Elements</div><div>suggested: (NIS-Elements, RRID:SCR_014329)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.13.464307: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-His tag antibodies, diluted at 50 μg/mL in 10 mM sodium acetate, pH 4.5, were immobilized on both the active and reference flow cells surface of the activated CM5 sensor chip using amine coupling method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 200 RU of His-tagged SARS-CoV-2 and SARS-CoV spike trimers and RBDs were captured onto the chip for the active surface, and anti-His antibody alone served as the reference surface.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK293T/17 (cat# CRL-11268) and Vero E6 cells (cat# CRL-1586) were from ATCC, 293T-ACE2 cells were kindly provided by J. Sodroski of Harvard Medical School, and they were cultured in 10% fetal bovine serum (FBS, GIBCO cat# 16140071) supplemented Dulbecco’s Modified Eagle Medium (DMEM, ATCC cat# 30-2002) at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were grown to 80% confluency before transfection with the spike gene using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proteins were expressed in HEK293 Freestyle cells (Invitrogen) in suspension culture using serum-free media (Invitrogen) and transfected into HEK293 cells using polyethyleneimine (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were then converted into percentage neutralization at a given sample dilution or mAb concentration, and the averages ± SEM were plotted using a five-parameter dose-response curve in GraphPad Prism v.8.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing was performed using cryoSPARC v2.15 [14].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model building and refinement: The 2-36-RBD complex model was built starting from template PDB structures 6BE2 (Fab) and 7BZ5 (RBD) using Phenix Sculptor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix Sculptor</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated and manual model building were iteratively performed using real space refinement in Phenix [16] and Coot [17].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geometry validation and structure quality assessment were performed using Molprobity [18].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Molprobity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The visualization of sequence entropy was displayed by PyMol version 2.3.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.13.464254: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In brief, female Syrian hamsters (Mesocricetus auratus) of 6-8 weeks old were anesthetized with ketamine/xylazine/atropine and inoculated intranasally with 50 μL containing 1×104 TCID50 Beta B.1.351 (derived from hCoV-19/Belgium/rega-1920/2021; EPI_ISL_896474, 2021-01-11).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody isolation and recombinant production: Antigen specific IgG+ memory B cells were isolated and cloned from PBMC of SARS-CoV-2 convalescent individuals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen specific IgG+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">goat anti-human IgG secondary antibody (Southern Biotech, 2040-04) was added and incubated for 45 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat anti-human IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2040-04, RRID:AB_2795643)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h, infected cells were washed an additional five times with DMEM prior to adding media supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant diluted 1:25, from CRL-2700, ATCC) to reduce parental background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 4% PFA (Electron Microscopy Sciences, #15714S), permeabilized with Triton X-100 (SIGMA, #X100-500ML) and stained with an antibody against the viral nucleocapsid protein (Sino Biologicals, #40143-R001) followed by a staining with the nuclear dye Hoechst 33342 (Fisher Scientific, # H1399) and a goat anti-rabbit Alexa Fluor 647 antibody (Invitrogen, #A-21245).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>#X100-500ML</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Molecular Probes Cat# A-21245, RRID:AB_141775)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2, Vero-TMPRSS2) (32)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped viruses were prepared using Lenti-X 293 cells seeded in 15-cm dishes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization experiments, HEK-293T cells expressing hACE2 (Crawford et al. 2020) in DMEM supplemented with 10% FBS and 1% PenStrep were seeded at 20,000 cells per well into clear bottom, white manually poly-D-lysine coated 96 well plates and incubated at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of authentic SARS-CoV-2 viruses: Vero-TMPRSS2 cells were seeded into black-walled, clear-bottom 96-well plates at 2 × 104 cells/well and cultured overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-surface mAb-mediated S1 shedding: CHO cells stably expressing the prototypic SARS-CoV-2 Spike protein were harvested, washed in wash buffer (PBS 1% BSA 2 mM EDTA) and resuspended in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral replication fitness assays: Vero E6 cells (ATCC, CRL-1586) were seeded at 1×106 cells per well in 6-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 15-minute incubation, Jurkat cells stably expressing FcγRIIIa receptor (V158 variant) or FcγRIIa receptor (H131 variant) and NFAT-driven luciferase gene (effector cells) were added at an effector to target ratio of 6:1 for FcγRIIIa and 5:1 for FcγRIIa.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">fold-on trimerization motif, and an 8× His tag in the pCMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the Database IMGT (http://www.imgt.org), the VH and VL gene family and the number of somatic mutations were determined by analyzing the homology of the VH and VL sequences to known human V, D and J genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UCA sequences of heavy and light variable regions were constructed using IMGT/V-QUEST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 45 min incubation, absorbance at 405 nm was measured by a plate reader (Biotek) and data plotted using Prism GraphPad.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 30 sec stabilization step in KB, biosensors were moved in SARS-CoV or SARS-CoV-2 :2 dilution series (starting concentration: 18.5 nM) for the 600 sec association step, and then moved back in KB to record dissociation signals for 540 sec.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (BioLegend Cat# 946101, RRID:AB_2892515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were baseline subtracted, results fitted using the Pall FortéBio/Sartorius analysis software (version 12.0) and plotted using GraphPad Prism (version 9.1.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed and visualized with Prism (Version 9.1.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Micrographs were recorded using the Leginon software on a 120 kV FEI Tecnai G2 Spirit with a Gatan Ultrascan 4000 4k</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3D refinements were carried out using non-uniform refinement along with per-particle defocus refinement in CryoSPARC (57).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model building and refinement: UCSF Chimera (61) and Coot (62) were used to fit atomic models into the cryoEM maps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This variant was originally isolated in house from nasopharyngeal swabs taken from travelers returning to Belgium (baseline surveillance) and were subjected to sequencing on a MinION platform (Oxford Nanopore) directly from the nasopharyngeal swabs (65).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your code and data.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.16.464644: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

NIH rigor criteria are not applicable to paper type.

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cleaned Fasta file was then uploaded to SnapGene (version 5.3.2) for multisequence analysis via the MAFFT tool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SnapGene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With these factors all considered, an optimal tree was selected from the 21 trees for re-rooting via FigTree (https://github.com/rambaut/figtree/releases/tag/v1.4.4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting tree was exported for image processing via Adobe Photoshop and subsequent presentation via Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMol structural modeling: The PyMol molecular graphics system (version 2.4.2, https://pymol.org/2/) from Schrödinger, Inc. was used for downloading structure files from the PDB database for further analysis and image export.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were cropped via Adobe Photoshop and further presentation using Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your code.

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.13.21264916: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Deidentified data from staff testing and patients were obtained from the Infections in Oxfordshire Research Database (IORD) which has generic Research Ethics Committee, Health Research Authority and Confidentiality Advisory Group approvals (19/SC/0403, ECC5-017(A)/2009).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody rabbit anti-human whole IgG conjugated to alkaline phosphatase (Sigma, USA) or a secondary antibody mouse anti-human IgA conjugated to horse radish peroxidase (Sigma, USA) was added at a dilution of 1:1000 in casein–PBS solution and incubated for 1 hour at RT after which a final wash was performed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human whole IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the IgA secondary antibody, plates were developed by adding Tetramethylbenzidine (TMB) (Thermo scientific USA) to visualize and Sulfuric acid to stop the reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A 1x working concentration of the SULFO-TAG anti-human IgG Detection Antibody was prepared in Diluent 100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (RevMAb Biosciences Cat# 31-1019-MK, RRID:AB_2783627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microplates were coated with RBD in Dulbecco’s Phosphate Buffered Saline (DPBS) to bind corresponding ACE2 or blocking antibodies of the sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MSD V-PLEX assay: IgG antibody responses to SARS-CoV-2 spike, RBD, NTD and nucleocapsid and the spike proteins of SARS-CoV-1, HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 were assessed using the Meso Scale Diagnostics (MSD) Multi-Spot Assay System (MSD, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.17.464700: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient Samples and Collection: Use of human samples for this study was approved by the University of Ottawa Ethics Review Board: Certificates H-04-20-5727, H-04-21-6643 and H-07-20-6009.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In initial experiments, aliquots of each fraction were visualized via immunoblotting (anti-His antibody; Cat: SAB2702218</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In conjunction, titration curves of conformation-dependent monoclonal IgM (Absolute Antibody, Ab01680-15.0), IgA (Absolute Antibody, Ab01680-16.0), and IgG (Absolute Antibody, Ab01680-10.0) CR3022 antibodies were used as reference material to assess protein folding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>titration curves of conformation-dependent monoclonal IgM ( Absolute Antibody , Ab01680-15.0) , IgA ( Absolute Antibody , Ab01680-16.0)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG ( Absolute Antibody , Ab01680-10.0 ) CR3022 antibodies</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking, plates were washed thrice with PBS-T, and followed by addition of 100 μL of the respective diluted serum samples and CR3022 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were incubated for two hours on a shaker at room temperature, washed thrice with PBS-T followed by the addition of 50 μL of the respective secondary-HRP antibody at specified dilutions (1:4000 secondary anti-human IgG-HRP (NRC anti-hIgG#5-HRP</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surrogate Neutralization ELISA (snELISA) assay for evaluation of neutralization in serum samples: The described methodology was adapted from the surrogate neutralization ELISA assay as shown in Abe et al. 2020, for the evaluation of the relative inhibition of neutralizing antibodies to RBD protein from binding to soluble ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD Production in mammalian cells: For comparison, a mammalian RBD was produced in HEK 293F cells and purified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Mount Sinai, NYC) encoding the Whuhan-Hu-1 RBD (MN908947) sequence coding for the amino acid 319-541 and fused with the N-terminal SARS-CoV-2 spike secretory signal and a C-terminal hexa-histidine tag was transfected into 293F cells cultivated in Freestyle 293 expression media (Thermo Fisher, #12338018) at 37°C, 7% CO2, while shaking (125rpm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Whuhan-Hu-1 RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The construct was codon-optimized for N. benthamiana expression and was synthesized by GenScript into the pHREAC vector (Peyret et al., 2019) via BsaI sites</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHREAC</div><div>suggested: RRID:Addgene_134908)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lectin-binding human chaperone calreticulin (NP_004334.1) was codon-optimized for N. benthamiana and synthesized in the pHRE vector (Peyret et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHRE</div><div>suggested: RRID:Addgene_134909)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient expression in Nicotiana benthamiana: Prior to infiltration, pHREAC-RBD and pHRE-calreticulin were freshly transformed into Agrobacterium tumefaciens strains AGL1 and Gv2260, respectively, via electroporation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHREAC-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHRE-calreticulin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dissociation constant (KD) was determined using 4-parameter curve fitting with GraphPad Prism 9.1.2 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

I love the verbs chosen for each page/discussion/assignment. It is a great call to action! The structure is outstanding. The only issue I see with this display is that the image raises an equity issue - students who require screen readers will not be able to access this information unless there is a really long alt tag associated with the image.

Go here https://github.com/clojure/tools.build

Reviewer #1 (Public Review): 

In this manuscript, the authors challenge the long-standing conclusion that Orco and IR-dependent olfactory receptor neurons are segregated into subtypes such that Orco and IR expression do not overlap. First, the authors generate new knock-in lines to tag the endogenous loci with an expression reporter system, QF/QUAS. They then compare the observed expression of these knock-ins with the widely used system of enhancer transgenes of the same receptors, namely Orco, IR8a, IR25a, and IR76b. Surprisingly, they observe an expansion of the expression of the individual knock-in reporters as compared to the transgenic reporters in more chemosensory neurons targeting more glomeruli per receptor type than previously reported. They verify the expression of the knock-in reporters with antibody staining, in situ hybridization and by mining RNA sequencing data. 

Finally, they address the question of physiological relevance of such co-expression of receptor systems by combining optogenetic activation with single sensillum recordings and mutant analysis. Their data suggests that IR25a activation can modulate Orco-dependent signaling and activation of olfactory sensory neurons. 

The paper is well written and easy to follow. The data are well presented and very convincing due in part to the combination of complementary methods used to test the same point. Thus, the finding that co-receptors are more broadly and overlappingly expressed than previously thought is very convincing and invites speculation of how this might be relevant for the animal and chemosensory processing in general. In addition, the new method to make knock-ins and the generated knock-ins themselves will be of interest to the fly community. 

The last part of the manuscript, although perhaps the most interesting, is the least developed compared to the other parts. In particular, the following points could be addressed: 

- It would be good to see a few more traces and not just the quantifications. For instance, the trace of ethyl acetate in Fig. 6C, and penthyl acetate for 6G. 

- In Fig. 4D, the authors show the non-retinal fed control, which is great. An additional genetic control fed with retinal would have been nice. 

- It appears that mostly IR25a is strongly co-expressed with other co-receptors. The provided experiments suggest a possible modulation between IR25a and Orco-dependent neuronal activity. However, what does this mean? How could this be relevant? And moreover, is this a feature of Drosophila melanogaster after many generations in laboratories?

Noting here University of Edinburgh's collection of OERs that support SD4 including

• Foundations for All - supporting refugee scholars
• Wikimedia in Education published in cooperation with Wikimedia UK "bringing together a collection of case studies from across the UK in order to provide insight into the use of the Wikimedia projects in education."
• Critical Thinking in Global Challenges - a series of open licensed videos "to better understand what critical thinking is, and to practice and enhance critical thinking skills" and how they were applied in course activities designed around global issues

There's much more here https://open.ed.ac.uk/tag/sdg4/

Here is a way to make better highlights

SciScore for 10.1101/2021.10.12.464150: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from all patients, and all patient samples were collected after a full recovery from illness and under IRB approval.<br>IACUC: Animal work was performed at Lovelace Biomedical Research Institute (LBRI), with approval from the Institutional Animal Care and Use Committee (IACUC) and within Animal Biosafety Level 3 (ABSL3) containment.<br>Euthanasia Agents: All animals were euthanized with an euthanasia solution consisting of 390 mg of sodium pentobarbital and 50 mg of phenytoin per mL.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The FPF of delivered dose was calculated as the total amount of sugar or sugar alcohol (e.g., trehaose, mannitol) collected with an aerodynamic diameter below 5 µm as a percentage of the total amount of sugar or sugar alcohol deposited on the adapter, the induction port, stages 1–7 and Micro-Orifice Collector. 2.8. Efficacy of AUG-3387 in and in vivo model of SARS-CoV-2 infected Syrian Hamsters: An in vivo efficacy study was performed with male Syrian Hamsters (Mesocricetus auratus) approximately 9 weeks of age with a weight range of 110-134 g, at time of randomization, were sourced from Charles River Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The FPF of delivered dose was calculated as the total amount of sugar or sugar alcohol (e.g., trehaose, mannitol) collected with an aerodynamic diameter below 5 µm as a percentage of the total amount of sugar or sugar alcohol deposited on the adapter, the induction port, stages 1–7 and Micro-Orifice Collector. 2.8. Efficacy of AUG-3387 in and in vivo model of SARS-CoV-2 infected Syrian Hamsters: An in vivo efficacy study was performed with male Syrian Hamsters (Mesocricetus auratus) approximately 9 weeks of age with a weight range of 110-134 g, at time of randomization, were sourced from Charles River Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A fluorescently labelled anti-human IgG/IgA/IgM secondary antibody was also added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG/IgA/IgM</div><div>suggested: (Sigma-Aldrich Cat# S4893, RRID:AB_10625701)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For identification of surface bound antibodies binding to SARS-CoV-2, SARS-CoV-2 antigens conjugated to Alexa Fluor 488 stained SARS-CoV-2 antigen was used as a staining agent for single cell sorting of antigen reactive memory B cells into 96 well plates on a Sony SH-800 Cell Sorter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Thermo Fisher Scientific Cat# 53-6490-82, RRID:AB_2884046)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AUG-3705 was attached to the LSA flow cell via interaction with its V5 tag and a surface bound anti-V5 antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were enriched 4 times until 97% of the cells showed signal above the negative control as read out by staining with anti-ACE-2 and secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay: 2.4.1 ACE-2 Expressing HEK293T Cell Line Construction: An ACE2 expressing HEK293T cell line (“LentiX ACE2.S4”) was constructed by packaging pCMV-AC-GFP (Origene) into lentivirus and transducing HEK293T’s (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cell culture supernatant was diluted with 950 µL D10 media, and then serial diluted before 50 µL of each dilution was added to 8 wells of Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 96 hours, 100 µL CellTiterGlo reagent was added to each well of the infected Calu-3 cells to assay for live cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: BCRJ Cat# 0264, RRID:CVCL_0609)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay: 2.4.1 ACE-2 Expressing HEK293T Cell Line Construction: An ACE2 expressing HEK293T cell line (“LentiX ACE2.S4”) was constructed by packaging pCMV-AC-GFP (Origene) into lentivirus and transducing HEK293T’s (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-AC-GFP</div><div>suggested: None</div></div></td></tr></table>

---

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

---

Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

---

Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04872231</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Single Ascending Dose and Multiple Ascending Dose Study of V…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04576325</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Pharmacokinetic Profile of Voriconazole Inhalation Powder in…</td></tr></table>

---

Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>

SciScore for 10.1101/2021.10.12.464114: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

<table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Description of cohort and ethics statement: Samples were collected from participants enrolled in a prospective cohort study approved by the Biomedical Research Ethics Committee (BREC) at the University of KwaZulu–Natal (reference BREC/00001275/2020).<br>Consent: Written informed consent was obtained from each participant.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Four were males and 5 were females.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

Table 2: Resources

<table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For RBD expression experiments, 45 OD units of yeast were labeled in 1:100 diluted chicken-anti-Myc-FITC antibody (Immunology Consultants CMYC45F) to detect the RBD’s C-terminal Myc tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Myc tag .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the plasma incubations, the libraries were secondarily labeled for 1 hour with 1:100 fluorescein isothiocyanate-conjugated anti-MYC antibody (Immunology Consultants Lab, CYMC-45F) to label for RBD expression and 1:200 Alexa Fluor-647-conjugated goat anti-human-IgA+IgG+IgM (Jackson ImmunoResearch 109-605-064) to label for bound plasma antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MYC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-IgA+IgG+IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, version 0.8.10) to process Illumina sequences into counts of each barcoded RBD variant in each pre-selection and antibody-escape population.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape population .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Magnetic Separation Rack, Thermo Fisher Scientific, CS15000) was used to separate antibodies that bind RBD from the supernatant, and the supernatant (the post-RBD antibody depletion sample) was removed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>post-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Note that these assays were performed in 293T cells over-expressing human ACE2, which may underestimate contributions of non-RBD-binding antibodies to viral neutralization (7, 35, 60).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dilution series of the synthetic sera comprised of the anti-RBD antibody REGN10987 (72), which binds to both Wuhan-1-like RBD and B.1.351 RBD, and pooled pre-pandemic human serum from 2017-2018 (Gemini Biosciences; nos. 100–110, lot H86W03J; pooled from 75 donors) were performed such that the anti-spike antibody was present at a highest concentration of 0.25 µg/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pre-pandemic serum alone, without anti-RBD antibody depletion, was used as a negative control, averaged over 2 replicates</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was detected with TMB/E HRP substrate (Millipore Sigma, ES001) and 1 N HCl was used to stop the reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ES001</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of pseudotyped lentiviral particles: HEK-293T (American Type Culture Collection, CRL-3216) cells were used to generate SARS-CoV-2 spike-pseudotyped lentiviral particles and 293T-ACE2 cells (Biodefense and Emerging Infectious Research Resources Repository (BEI Resources), NR-52511) were used to titer the SARS-CoV-2 spike-pseudotyped lentiviral particles and to perform neutralization assays (see below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate spike-pseudotyped lentiviral particles (70), 6e105 HEK-293T (ATCC CRL-3216) cells per well were seeded in 6-well plates in 2 mL D10 growth media (Dulbecco’s Modified Eagle Medium with 10% heat-inactivated fetal bovine serum, 2 mM l-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Note that these assays were performed in 293T cells over-expressing human ACE2, which may underestimate contributions of non-RBD-binding antibodies to viral neutralization (7, 35, 60).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For experiments involving D614G spike, we used spike-pseudotyped lentiviral particles that were generated essentially as described in (70), using a codon-optimized SARS-CoV-2 spike from Wuhan-Hu-1 strain that contains a 21-amino-acid deletion at the end of the cytoplasmic tail (27) and the D614G mutation that is now predominant in human SARS-CoV-2 (30).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AWY101 yeast containing a negative control (containing an empty vector pETcon plasmid) were grown overnight at 30°C in galactose-containing media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pETcon</div><div>suggested: RRID:Addgene_41522)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting CCSs are available on the NCBI Sequence Read Archive, BioProject PRJNA770094,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI Sequence Read Archive</div><div>suggested: (NCBI Sequence Read Archive (SRA, RRID:SCR_004891)</div></div><div style="margin-bottom:8px"><div>BioProject</div><div>suggested: (NCBI BioProject, RRID:SCR_004801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The percent of neutralizing activity of early-2020 and B.1.351-convalescent plasmas due to RBD-binding antibodies is plotted with the plotnine python package, version 0.8.0 (https://plotnine.readthedocs.io/en/stable/index.html), shown as a Tukey boxplot (middle line indicating median, box limits indicating interquartile range) with individual measurements overlaid as points.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All raw sequencing data are available on the NCBI Short Read Archive at BioProject PRJNA770094, BioSample SAMN22208699, SAMN22208700.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI Short Read Archive</div><div>suggested: None</div></div></td></tr></table>

---

Results from OddPub: Thank you for sharing your code and data.

---

Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:

Our study has several limitations. The cohorts of individuals infected with early 2020 and B.1.351 viruses are small, and are geographically and temporally distinct. Nevertheless, the two cohorts are relatively well-matched with respect to age, sex, and days-post symptom onset of sample collection (Table 1) and assays were performed under comparable conditions. Our deep mutational scanning measured binding to yeast-displayed RBD, which may not capture all relevant features of full-length spike in the context of virus. Finally, our neutralization assays used pseudotyped lentiviral particles and ACE2-overexpressing cells, and some recent works suggest that the relative importance of different spike epitopes for neutralization can depend on the viral system and target cell line used (7, 35, 36, 60). Although the B.1.351 variant has now been displaced by the Delta variant, our results illustrate the need to understand immunity elicited by different SARS-CoV-2 variants. As population immunity due to infection or vaccination increases, preexisting immunity is becoming an increasingly important driver of SARS-CoV-2 evolution (61), as has shown to be the case for seasonal coronaviruses (62, 63). Moreover, as individuals begin to accumulate more complex SARS-CoV-2 immune histories due to multiple infections and/or vaccinations, the effects of immune imprinting or original antigenic sin (64, 65) may start to interact with the variant-specific immunodominance hierarchies we have describ...

---

Results from TrialIdentifier: No clinical trial numbers were referenced.

---

Results from Barzooka: We did not find any issues relating to the usage of bar graphs.

---

Results from JetFighter: We did not find any issues relating to colormaps.

---

Results from rtransparent:

• Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
• Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
• No protocol registration statement was detected.

---

Results from scite Reference Check: We found no unreliable references.

---

<footer>

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

</footer>